식물 원형질에서 mRNA Interactome 캡처

Biochemistry

Your institution must subscribe to JoVE's Biochemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

여기, 우리는 Arabidopsis thaliana 엽초 엽 원형체에 적용된 상호 작용 캡처 프로토콜을 제시한다. 이 방법은 생체 내 UV 가교 결합에 비판적으로 의존하며 생리 환경으로부터 식물 mRNA 결합 단백질의 분리 및 동정을 허용합니다.

Cite this Article

Copy Citation | Download Citations

Zhang, Z., Boonen, K., Li, M., Geuten, K. mRNA Interactome Capture from Plant Protoplasts. J. Vis. Exp. (125), e56011, doi:10.3791/56011 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

RNA 결합 단백질 (RBP)은 RNA의 운명을 결정합니다. 그들은 모든 RNA 생합성 경로에 참여하며 특히 mRNA (messenger RNAs)의 전사 후 유전자 조절 (post-transcriptional gene regulation, PTGR)에 기여합니다. 지난 몇 년 동안, 효모 및 포유류 세포주의 많은 mRNA 결합 단백질은 mRNA 결합 단백질 (mRBPs)의 동정을 가능케하는 "mRNA 상호 작용 체 포획 (interaction)"이라는 새로운 방법의 사용을 통해 성공적으로 분리되었다. 생리적 인 환경에서 직접적으로. 이 방법은 올리고 (dT) 비드에 의한 메신저 리보 뉴클레오타이드 복합체 (mRNP)의 생체 내 자외선 (UV) 가교 결합, 풀다운 및 정제, 및 질량 분석기 (MS)에 의한 가교 결합 단백질의 후속 확인으로 구성된다. 아주 최근에 같은 방법을 적용하여 여러 가지 식물 mRNA 결합 프로테옴이 다른 Arabidopsis 조직 공급원에서 동시에보고되었다 : 뿌리 뽑힌 묘목, 잎 조직,엽초 엽 모세포 및 배양 된 뿌리 세포를 포함한다. 여기, 우리는 Arabidopsis thaliana 엽초 엽 원형질에 대한 최적화 된 mRNA 인터랙티브 캡쳐 방법을 제시하는데, 이는 다양한 세포 분석을 포함하는 실험을위한 다용도 도구의 역할을하는 세포 유형이다. 최적의 단백질 수율을위한 조건에는 조직의 시작과 UV 조사 시간이 포함됩니다. 중간 규모 실험 (10 7 세포)에서 얻은 mRNA 결합 프로테옴에서 RNA 결합 능력을 가진 RBP가 과다하게 나타 났으며 많은 새로운 RBP가 확인되었다. 실험을 확대 (10 9 세포) 할 수 있으며 최적화 된 방법을 다른 식물 세포 유형 및 종에 적용하여 식물에서 mRNA 결합 단백질을 광범위하게 분리, 분류 및 비교할 수 있습니다.

Introduction

진핵 생물은 세포 생물학적 과정을 유지하기 위해 다중 RNA 생합성 조절 경로를 사용합니다. 알려진 종류의 RNA 중에서 mRNA는 매우 다양하며 단백질과 그 이소 형의 코딩 용량을 가지고 있습니다 1. PTGR 경로는 pre-mRNA 2 , 3 의 운명을 지시합니다. 서로 다른 유전자 군의 RBP가 RNA의 조절을 조절하고, PTGR에서는 특정 mRBP가 기능적 mRNP를 형성하는 직접적인 물리적 상호 작용을 통해 mRNA를 유도합니다. 따라서, 식별 및 mRBPs의 특성과 mRNPs 것은 지난 30 년 .Over 세포의 mRNA 대사 2의 규정을 이해하는 데 중요하다, 다양한 시험 관내 방법 - RNA 전기 영동 이동성의 변화 (REMSA) 분석, 지수 농축 분석에 의한 리간드의 체계적 발전을 포함하여 (RBNS), 방사성 표지 또는 정량 분석 ​​(RNA Bind-n-Seq, RBNS)형광 RNA 결합 분석, X 선 결정학 및 NMR 분광법은 4, 5, 6, 7, 8, 9 - 널리 주로 포유 동물 세포에서 RBPs 연구에 적용되어왔다. 포유류 RBP에 대한 이러한 연구의 결과는 RNA-binding Protein DataBase (RBPDB)를 통해 검색 할 수 있으며, 이는 공개 된 관측치 10 을 수집합니다.

이러한 in vitro 접근법은 강력한 도구이지만 주어진 RNA 풀 시퀀스로부터 결합 된 RNA 모티프를 결정하므로 새로운 표적 RNA를 발견 할 수있는 능력이 제한적입니다. 계산 전략은 단백질 서열의 보존을 기반으로 게놈 전체의 RBPs을 예측하고 (15)를 구성하는 마찬가지입니다. 이를 극복하기 위해 새로운 실험 방법 인 ha이는 관심의 RBP가 상호 작용하는 RNA 모티프의 식별 및 결합의 정확한 위치 결정을 가능하게합니다. "crosslinking and immunoprecipitation"(CLIP)이라고 불리는이 방법 은 생체 내 UV 가교 결합 후 면역 침전 11로 구성 됩니다. 초기 연구에 따르면 245 nm보다 큰 자외선 파장에서 DNA 및 RNA 뉴클레오티드의 광 활성화가 발생할 수 있습니다. 티미 딘을 통한 반응이 선호되는 것으로 보인다 (광 반응성 감소 순서 : dT ≥ dC> rU> rC, dA, dG) 12 . 파장이 254 nm (UV-C) 인 UV 광을 사용하여 단 몇 옹스트롬 (Å) 범위에서 RNA 뉴클레오타이드와 단백질 잔기 사이의 공유 결합이 생성되는 것으로 관찰되었습니다. 따라서이 현상을 RNA와 RBP의 "zero-length"가교라고합니다. 이것은 엄격한 정화 과정 배경이 거의없는 채약 13 , 14 .

CLIP에 보완적인 전략은 RBP의 풍경을 기술하기 위해 단백질 확인과 생체 내 UV 교차 결합을 결합하는 것입니다. 이러한 게놈 전체 mRNA에 결합 된 프로테옴의 수는, "mRNA의 상호 작용 체 캡처"(18)라고, 효모 세포, 배아 줄기 세포 (는 ESC),이 새로운 실험 방법을 사용하여 인간의 세포 라인 (즉, HEK293와 헬라)에서 분리 된 19 , 20 , 21 . 이 방법은 생체 내 UV 가교 결합과 mRNP 정제 및 MS 기반 프로테오믹스로 구성됩니다. 이 전략을 적용함으로써, 비표준 RBD를 포함하는 많은 새로운 "달빛"RBP가 발견되었고, 더 많은 단백질이 이전에 상상했던 것보다 RNA 결합 능력을 가지고 있음이 분명 해졌다"> 15, 16, 17.이 방법의 사용은 새로운 애플리케이션과 RBPs을 조사 할 때 새로운 생물학적 질문에 대답 할 수있는 기능을 허용합니다. 예를 들어, 최근의 연구는 mRNA에 결합 된 프로테옴 (핵심 RBP의 보존을 조사하고있다 proteome) 22 .

식물 RBP는 이미 성장과 발달에 관여하고있다 ( 예 : 개화시기의 후 전사 조절, 24 시간주기, 미토콘드리아와 엽록체의 유전자 발현) 24 , 25 , 26 , 27 , 28 , 29 . 또한, 그들은 비 생물 적 스트레스에 반응하는 세포 과정에서 기능을 수행하는 것으로 생각된다 ( 예, 감기, 가뭄, salinity 및 abscisic acid (ABA)) 31 , 32 , 33 , 34 . RNA 인식 모티프 (RRM) 및 K 상 동성 (KH) 도메인 서열 모티프에 기초하여 애기 장대 게놈에 200 개 이상의 예측 된 RBP 유전자가 존재하며; 쌀에는 대략 250 개가 35 , 36 으로 기록되어있다. 예상되는 많은 RBP가 식물에만 고유 한 것으로 여겨지는 것은 주목할 만하다. ( 예를 들어, RRM 도메인을 포함하는 예측 된 Arabidopsis RBP의 약 50 %에 걸친 metazoan ortholog는 없다) 35) , 이는 많은 사람들이 새로운 기능을 수행 할 수 있음을 시사한다. 대부분의 예측 RBPs의 기능은 23지지 않은 남아있다.

Arabidopsis 에서 발현 된 mRNA- 결합 된 프로테옴의 분리는 모종, 잎 조직, 배양 된 뿌리 세포 및 잎의 엽초 원형질체를mRNA의 상호 작용 체 캡처은 최근 39 (38)보고되었다. 이 연구는 가까운 장래에 식물에서 기능적 RBP를 체계적으로 목록화할 강력한 가능성을 보여줍니다. 여기, 우리는 식물 protoplasts ( 즉, 세포 벽이없는 세포)에서 mRNA interactome 캡처에 대한 프로토콜을 제시한다. Arabidopsis thaliana 엽초 엽 원형 엽 세포는 잎 세포의 주요 유형이다. 분리 된 원형질체는 세포에 자외선을 최적으로 닿게합니다. 이 세포 유형은 기능적 특성을 위해 단백질을 일시적으로 발현하는 분석법에서 사용할 수 있습니다 40 , 41 . 또한 protoplasting 다른 여러 식물 세포 종류 및 종을 42, 43, 44에 적용되어왔다 (., Bargmann 바움 및 2010; 예를 들어, 피터슨 등, 2009 년 홍콩 등, 2012)..

<p class = "jove_content">이 방법은 총 11 단계 ( 그림 1A )를 포함합니다. Arabidopsis 엽초 엽 원형체를 먼저 단리하고 (단계 1) UV 조사를하여 가교 결합 된 mRNP를 형성한다 (단계 2). 원형질체가 변성 조건 (단계 3) 하에서 용해 될 때, 가교 결합 된 mRNP는 용해 / 결합 완충액에서 방출되고 oligo-d (T) 25 비드에 의해 당겨진다 (단계 4). 몇 차례의 엄격한 세척 후에, mRNP를 정제하고 추가로 분석한다. mRBPs의 변성 펩티드는 가교 결합 mRNA가 정제되기 전에 프로 테이나 제 K에 의해 분해되고 RNA 품질은 qRT-PCR (단계 5 및 6)에 의해 검증된다. RNase 처리 및 단백질 농도 (단계 7) 후에, 단백질 품질은 SDS 폴리 아크릴 아미드 겔 전기 영동 (SDS-PAGE) 및은 염색 (단계 8)에 의해 조절된다. 단백질 밴드 패턴의 차이점은 가교 샘플 (CL)과 비가 교 샘플 (non-crosslinked sample) 사이에서 쉽게 시각화 될 수 있습니다.UV 조사를받지 않은 원형질체로부터의 음성 대조군 샘플). 단백질의 확인은 MS 기반 프로테오믹스를 통해 이루어집니다. CL 샘플의 단백질은 1 차원 폴리 아크릴 아미드 겔 전기 영동 (1D-PAGE)으로 분리되어 가능한 배경 오염을 제거하고, 트립신을 사용하여 짧은 펩타이드로 "in-gel digestion"되고 정제됩니다 (9 단계). 질량 분광기 (nano-LC-MS)에 결합 된 나노 역상 액체 크로마토 그래피는 mRNA- 결합 프로테옴에서 결정적인 단백질의 양을 결정할 수있게합니다 (단계 10). 마지막으로, 확인 된 mRBPs는 생물 정보학 분석을 사용하여 특성화되고 목록 화됩니다 (11 단계).

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Arabidopsis Leaf Mesophyll 원형질체 단리

참고 : 유 등의 알에 의해 설명 된 애기 장대 잎의 엽육의 원형질체는 기본적으로 격리되어, 2007, 몇 가지 수정 (40)..

  1. 식물의 성장
    1. 성층화를 위해 어둠 속에서 4 ℃에서 2 일 동안 약 200 개의 애기 장대 Col-0 에코 타입 종자를 멸균 수에 담근다.
      참고 :이 시드 수는 비 CL 샘플과 CL 샘플 하나에 충분합니다 (1.3 단계 참조).
    2. 토양과 질석의 50 % ( v / v ) 혼합물로 냄비를 준비하고 쟁반에 증류수로 냄비를 담가 토양을 적시십시오.
    3. 젖은 토양에 뿌려 씨를 뿌리십시오. Arabidopsis 종자가 발아를 위해 빛을 필요로하기 때문에 추가 토양으로 씨앗을 덮지 마십시오.
      참고 : 식물 성장 조건은 23 ° C에서 12 시간 밝기 / 12 시간 암주기이며,개화하기 전에 5 주 동안 성장 실에서 100 μmol m -2 s -1 의 광도를 갖는. 4 주된 식물도 사용할 수 있습니다 40 .
      참고 : 1.2.1에서 3.2.3 단계의 설명 된 모든 재료와 시약은 2 개의 시료 ( 즉, 1 개의 비 CL 시료 (UV-C 조사를받지 않은 대조 시료)와 1 개의 CL 시료 (연구 UV-C 조사를받는 샘플)).
  2. 등장 성 효소 용액의 제조
    1. 1 차 등장액 효소 용액 (400 mM 만니톨, 20 mM KCl 및 20 mM MES 완충액 (pH 5.7)) 80 mL를 만들어 즉시 10 분 동안 60 ° C 배양기에서 용액을 가열한다.
    2. 따뜻한 1 차 등장액에 Cellulase R10 ( w / v 1.5 %) 1.2 g과 Macerozyme R10 ( w / v 0.4 %) 분말 0.32 g을 넣는다.
    3. 부드럽게 저어 준 효소 분말을 조심스럽게 용액에 넣습니다. 랩10 분 동안 60 ° C 배양기에서 용액을 가열하고 효소 용액이 깨끗한 밝은 갈색이 될 때까지 기다리십시오.
    4. 얼음에서 3 분 동안 용액을 냉각시키고 1 M CaCl 2 800 μL와 10 % ( w / v ) BSA 800 μL를 용액에 첨가한다.
    5. 0.22 μm 필터를 통해 피펫 팅하고 필터링하여 용액을 균질화하십시오. 두 개의 대규모 페트리 접시 (150mm x 20mm)에이 최종 등장액 효소 용액을 분액합니다.
  3. 애기 장대 장미 잎 줄기의 제조
    참고 : 각 페트리 접시 150 잎은 비 CL 샘플 또는 CL 샘플 하나에 권장됩니다.
    1. 새롭고 날카로운 면도날을 사용하여 완전히 확장 된 두 번째 또는 세 번째 진정한 잎 (평균 : 장미 당 3 ~ 4)을 0.5 ~ 1mm 잎 스트립으로 선택하여 잘라냅니다.
    2. isotonic 효소 솔루션에 즉시 스트립을 전송하고 잠수함.
      참고 : 빛에 닿지 않도록 항상 덮개를 덮으십시오그는 알루미늄 박과 페트리 접시. 나뭇잎을 부수 지 마십시오. 모든 스트립이 용액에 잠기고 표면에 떠 다니지 않았는지 확인하십시오.
  4. Arabidopsis 엽초 엽 원형체의 분리
    1. 알루미늄 호일로 덮인 페트리 접시를 진공 데시 케이 터에 넣고 30 분 동안 진공하에 리프 스트립에 침투시킵니다. 그 후, 실온에서 2.5 시간 동안 흔들지 않고 어둠 속에서 페트리 접시를 품어 라.
    2. 부드럽게 그리고 간략하게 접시를 수평으로 손으로 흔들어, 원형질체를 효소 용액으로 완전히 방출하려고 시도한다.
  5. 원형질 수확 및 계수
    1. 35 ~ 75 μm 나일론 메쉬를 통해 원형질체 현탁액을 걸러냅니다. 각 시료의 여액을 두 개의 50 mL 둥근 바닥 튜브 (각 튜브에 약 20 mL의 여액)에 나누어줍니다.
    2. 각 페트리 접시를 10 ML의 W5 버퍼 (154 MM NaCl, 125 MM CaCl
    3. 총 4 개의 튜브를 100 xg에서 5 분간 회전시켜 원형질체를 펠렛으로 만든다. 뜨는을 삭제하고 부드럽게 W5 버퍼 10 ML와 각 튜브에 원형질체 알약을 resuspend.
      참고 : 원형질체 펠릿을 재현 할 때, 튜브를 거꾸로 뒤집어서 펠렛이 사라질 때까지 손으로 부드럽게 돌리십시오. 셀을 손상시키지 않도록 직접 펠렛을 피펫하지 마십시오.
    4. 1.5.3 단계를 한 번 반복하고 각 샘플의 두 개의 튜브에있는 원형질체 현탁액을 하나의 50-mL 둥근 바닥 튜브와 결합시킵니다. 얼음에 튜브를 보관하십시오.
    5. hemocytometer를 사용하여 원형질체를 계산합니다.
      참고 : 25 큐브 내의 각 20 세포는 2 x 10 5 protoplasts / mL와 같습니다. 150 잎은 대략 1 x 10 7 세포를 산출해야한다.non-CL 및 CL 샘플에서 동일한 총 원형질 수를 갖도록 조절하십시오.
    6. 30 분 동안 얼음 위에 원형질을 보관하십시오. 그 후, 100 x g에서 5 분 동안 튜브를 회전시킵니다. 뜨는을 삭제하고 MMg 솔루션 (400 MM 만니톨, 15 MM MgCl 2 및 4 MM MES 버퍼 (산도 5.7)) 20 ML와 각 튜브에 protoplasts을 resuspend.

2. UV 조사에 의한 Vivo mRNA- 단백질 가교

참고 : 비 CL 샘플 튜브는 얼음에 보관하십시오. CL 샘플은 즉시 자외선을 조사해야합니다.

  1. CL 샘플 튜브에서 1 x 10 7 셀을 포함하는 원형질체 현탁액을 새로운 대형 페트리 접시 (150mm x 20mm)로 옮기고 플레이트 표면을 덮기 위해 30ml의 빙냉 MMg 용액을 첨가합니다. 부드럽게 pipetting하여 전체 MMg 버퍼에있는 세포를 확산. 즉시 UV 가교 장치에 상단 덮개없이 페트리 접시를 놓습니다.
    참고 : UV 램프 사이의 높이페트리 접시는 8cm입니다.
  2. 1 분, 3 분 또는 5 분 동안 254 nm 파장 자외선 및 0.00875 W / cm 2 자외선 강도로 샘플을 조사하십시오. 방사선 조사 후, 원형질체 현탁액을 2 개의 새로운 50 mL 둥근 바닥 튜브로 신속하게 나누어줍니다. 접시의 바닥을 씻어서 얼음처럼 차가운 MMg 용액 5mL를 추가하여 원형질체의 나머지를 모으고이 두 개의 튜브에이 세포 현탁액을 첨가합니다.
    참고 : 1 분이 최적 조건으로 선택되었습니다. 설명은 대표 결과 에서 찾을 수 있습니다.

3. 변성 조건 하에서의 원형질체 용해

  1. 용해 용 원형질체 펠렛의 제조
    1. 2 분의 2 CL 샘플 튜브와 함께 non-CL 샘플 튜브를 100 xg에서 5 분간 스핀하고 상등액을 버립니다. 비 CL 샘플 원형질 펠릿의 튜브를 얼음에 다시 놓습니다.
    2. 각 CL 시료 튜브에 ice-cold MMg 용액 10 mL를 넣는다.펠릿을 다시 걸러 내고 다시 50 mL 둥근 바닥 튜브에 넣으십시오. 튜브를 100xg에서 5 분간 회전시킵니다. 상등액을 제거한 후 CL 샘플 튜브 원형질체 펠렛을 얼음에 보관하십시오.
  2. 원형질체 용해 및 원형질체 용 해물 균질화
    1. 빙냉 용해 / 결합 완충액 (500mM LiCl, 0.5 % ( w / v ) 리튬 도데 실 설페이트 (LiDS), 5mM 디티 오 트레이 톨 (DTT), 20mM 트리스 -HCl (pH 7.5) 및 1mM EDTA (pH 8.0))를 각 샘플의 세포 펠릿에 첨가 하였다. 현탁액이 균일하게 밝은 녹색이 될 때까지 대략 20 회 위 / 아래로 pipetting하여 원형질체를 대략 녹여 라.
    2. 균질화를위한 좁은 바늘 (0.9 x 25mm 2 ) 50 ML 유리 주사기를 통해 protoplast의 lysate 두 번 통과하십시오. 얼음에 lysate를 10 분 동안 품어 낸다. 액체 질소로 lysate를 동결시키고 -80 ° C에서 최대 3 주 동안 보관하십시오.

4. mRNP 풀다운 및 정제Oligo-d (T) 25 개의 비즈

참고 : 다음의 설명 된 모든 재료 및 시약은 단계 4.1에서 단계 4.4까지 하나의 샘플 ( 즉, CL이 아닌 샘플 또는 CL 샘플)에 대해서만 사용됩니다. 비드 상청액 용해 / 결합 완충액을 버린 후에는 원형질체 용 해물을 비드가 들어있는 튜브에 즉시 첨가해야합니다.

  1. 올리고 (dT) 캡쳐를위한 올리고 -d (T) 25 자성 비드의 제조
    1. 냉동 된 원형질체 용해 액을 실온에서 해동. lysate가 완전히 녹을 때, lysate 튜브를 얼음 위에 놓아 둔다.
    2. 얼음에 6 개의 새로운 2 mL 둥근 바닥 미세 원심 분리 튜브에 oligo-d (T) 25 자석 비드 (5 mg / mL)를 나누어줍니다. 각 튜브에서 600 μl의 용해 / 결합 완충액으로 비드 현탁액을 부드럽게 씻고 4 분 동안 부드럽게 4 분 동안 위아래로 pipetting하여 pipetting하십시오. 구슬을 얼음에 붙이십시오.
  2. 제본
    1. 장소구슬을 자기 캡쳐하고 현탁액을 제거하는 3 분 동안 4 ° C의 자기 랙에 구슬을 담은 6 개 튜브.
      참고 : 튜브를 자성 선반에 넣을 때 구슬이 완전히 포착 될 때까지 기다리십시오. 최소 3 분이 걸립니다.
    2. 상등액을 버리고이 6 개 튜브에 즉시 프로토 박스트 용 해물 9 mL를 나누어 준다. 균질 갈색 현탁액이 나타날 때까지 pipetting하여 잘 섞어 부드러운 회전을 적용하여 1 시간 4 ° C에서 원형질체 용 해물에있는 비즈를 품어.
      참고 : 30 분에서 1 시간까지의 배양 시간을 권장합니다.
  3. 세탁
    1. 3 분 동안 4 ° C에서 자기 랙에 튜브를 다시 놓습니다. 모든 구슬이 튜브의 측면에 캡처되면 6 개의 새로운 2 ML 둥근 바닥 microcentrifuge 튜브에 protoplast의 lysate를 수집하고 일시적으로 4 ° C에 저장하십시오. protoplast lysate를 즉시 폐기하지 마십시오. lysate 유지4 ° C.
    2. 구슬에 빙냉 완충액 1 (500mM LiCl, 0.1 % ( w / v ) LiDS, 5mM DTT, 20mM Tris-HCl (pH 7.5) 및 1mM EDTA (pH 8.0)) 1.5mL를 첨가한다. 각 튜브에. 구슬을 Resuspend하고 1 분 부드러운 회전을 적용합니다. 3 분 동안 4 ° C에서 자기 랙에 튜브를 다시 놓고 뜨는 폐기하십시오. 세척 버퍼로이 세척 단계를 한 번 반복하십시오.
    3. 얼음 세척 버퍼 2 (500 MM LiCl, 5 MM DTT, 20 MM 트리스 - HCl (pH 7.5) 및 1 MM EDTA (pH 8.0)) 1.5 ML을 사용 하여이 세척 단계의 동일한 절차를 두 번 반복하고 얼음 - 차가운 저염 완충액 (200mM LiCl, 20mM 트리스 -HCl (pH 7.5) 및 1mM EDTA (pH 8.0)) 1.5mL.
      참고 : mRNPs가 protoplast lysate에서 효율적으로 분리 된 경우 세척 버퍼 2 ( 그림 1B )로 세척하는 단계에서 CL 샘플의 비드 펠렛 주변에 "후광"이 보이게됩니다.
  4. 용출
    1. 500 μL 추가용출 완충액 (20 mM Tris-HCl (pH 7.5) 및 1 mM EDTA (pH 8.0))을 각 튜브 내의 비드에 첨가 하였다. 부드럽게 구슬을 resuspend하고 poly (A) -tailed RNAs를 공개하기 위해 3 분 50 ° C에서 품어. 부드럽게 pipetting하여 구슬을 resuspend. 5 분 동안 4 ° C에서 자기 랙에 튜브를 다시 놓습니다.
    2. 모든 용리액 (총 약 3 mL)을 깨끗하고 멸균 된 RNase가없는 15 mL 원뿔형 바닥 튜브에 옮기고 혼합하십시오.
      참고 : RNA의 품질과 양은 분광 광도계 장치를 사용하여 즉시 결정할 수 있습니다.
      참고 : 각 시료의 RNA 농도는 약 10 ng / μL이며 A 260 / A 280 비율은 1.9입니다. 단리 된 폴리 (A) -tailed RNA는 일반적으로 70 % 이상의 순도를 갖기 때문에 A 260 / A 280의 비율은 1.6과 2.0 사이 여야합니다. RNA 농도가 너무 낮 으면 시작 원형질 세포의 수를 최대 10 9 개로 늘립니다. 견본액체 질소에서 얼려 장기 보관을 위해 80 ° C에서 보관할 수 있습니다.
    3. 추가 2 라운드에 대해 4.2 단계에서 4.4 단계를 반복하고 oligo - d (T) 25 구슬을 다시 사용하여 원형질체 용 해물에서 poly (A) -tailed RNA를 고갈시킵니다.
      참고 : 3 회의 풀다운 절차 후, 각각의 non-CL 또는 CL 샘플에 대해 총 9 mL의 용리액이 있어야합니다. RNA 분해를 피하기 위해 4 ° C에서 모든 작업을 수행하십시오. 구슬을 재사용 또는 재생하려면 4.5 또는 4.6 단계를 수행하십시오.
  5. 재사용 된 올리고 -d (T) 25 비드의 제조
    1. 얼음 - 차가운 용리 완충액 1 ML과 빙냉 용해 / 바인딩 버퍼 1 ML와 비즈를 두 번 씻어 500 ML에 다시 소금 LiCl 농도를 조정합니다.
    2. 4.1 단계를 따르고, 상등액을 버리고, 각 튜브에 저장된 원형질체 용해 액을 옮기고, 4.2 단계에서 4.4 단계까지의 모든 과정을 2 회 더 반복하십시오.
  6. 25 구슬의 재생
    참고 : 구슬을 저장하여 다른 실험에 사용할 수 있습니다 (최대 재사용 횟수는 3 회).
    1. 4.4 단계에 따라 0.1 M NaOH 1 mL를 넣고 5 분 동안 실온에서 회전하여 배양한다. 각 튜브에 대해 1 mL의 세척 완충액 1으로 2 회 세척하고 평형을 위해 0.1 % Tween-20이 포함 된 1x PBS (pH 7.4)로 3 회 세척합니다. 4 ℃에서 0.1 % Tween-20을 함유하는 무균 RNase-free 1x PBS (pH 7.4) 300 μL로 각 튜브의 비드를 보관하십시오.
      참고 :이 실험에서 Arabidopsis CL 샘플에 사용 된 비즈는 다음 번에 동일한 식물 샘플에만 사용할 수 있습니다.

5. 단백질 분해 효소 K 처리 및 mRNA 정제

  1. 프로 테이나 제 K 처리
    1. 자외선 가교 단백질을 소화하기 위해 각 시료의 용리액 1 mL에 8 μL의 Proteinase K 용액 (2 μg / μL)을 첨가합니다. Br등불 소용돌이.
  2. mRNA 정제
    1. 용리액을 37 ° C에서 1 시간 동안 인큐베이션하십시오. 잔류 오염물을 제거하기 위해 RNA 정제 키트를 사용하여 RNA를 정제하십시오.
      참고 : 정제 후 RNA는 qRT-PCR 분석을 사용하여 RNA 품질 검사를 할 준비가됩니다.
      참고 : RNA mini kit 및 TRIzol 시약과 같은 다른 키트도 사용할 수 있습니다 14 .

6. qRT-PCR 분석

  1. 역전사
    1. 1 μg의 RNA를 주형으로하여 역전사 시스템을 사용하여 1 차 cDNA의 효율적인 합성을 달성하십시오. 시료를 nuclease가없는 물로 5 ng / μL로 희석하십시오.
  2. qRT-PCR을 이용한 cDNA 정량
    1. 주형으로 cDNA의 10 NG와 qPCR 마스터 믹스 및 실시간 PCR cycler를 사용하여 cDNA를 증폭하고 계량. 다음 PCR 프로그램을 사용하십시오 : 95 ° C에서 10 분(1 단계, 1주기) 및 95 ℃에서 15 초, 60 ℃에서 1 분 (2 단계, 40주기).
      참고 : 여기에 사용 된 참조 유전자는 내인성 내부 통제 유전자 인 UBQ10 (AT4G05320)입니다. UBQ10 및 18S rRNA에 대한 qRT-PCR 프라이머는 Li , 2014 및 Durut , 2014, 45 46에 기재되어있다 . Primer sequence는 Material Table에 나열되어 있습니다.

7. RNase 처리 및 mRBP 농도

  1. RNase 처리
    1. RNase A와 RNase T1을 함유 한 RNase 칵테일을 약 100 U의 용리액 8 mL에 넣으십시오. 용리액을 nuclease가없는 물로 대체 한 RNase 칵테일이 포함 된 음성 대조 시료를 포함시킵니다. 간단히 보텍스하고 37 ° C에서 1 시간 동안 배양한다.
  2. mRBP 농도
    1. RNase 분해 후, 용리액을 농축하십시오g 원심 분리 필터 장치. 최종 부피는 75 μL이며, 총 단백질 수율은 농축 후 각 시료 약 2 μg입니다. 장기 보존을 위해 샘플을 -80 ° C에 두십시오.

8. SDS-PAGE 및은 염색

  1. SDS-PAGE
    1. 25 μL의 농축 된 용리액 (CL 샘플) 또는 대조 샘플 (비 CL 샘플)을 2 x loading dye 15 μL와 섞으십시오. 샘플을 95 ° C에서 5 분간 가열하고 단백질 마커를 포함하여 5 % 스태킹 겔과 12 % 분해 겔이 들어있는 SDS-PAGE 젤에 넣습니다.
    2. 단백질을 60V에서 40 분간 압축하고 약 1 시간 동안 160V에서 분리 염료가 분해 겔의 끝에 도달 할 때까지 분리합니다.
  2. 은 염색법
    1. 매회 5 분 동안 초순수로 SDS-PAGE 젤을 두 번 씻으십시오. 상업 실버 은색 얼룩 키트를 사용하여 단백질의 은색 얼룩을 수행합니다.
      참고 : 단백질 밴드는 5 분 이내에 보여 져야합니다. 밴드가 매우 밝은 색으로 5 분을 넘어서 보일 경우 시작 원형질의 수를 최대 10 9 개까지 늘리는 것이 좋습니다.

9. 트립신 다이 제스트 단백질 밴드 및 펩타이드 정제

  1. 트립신 소화
    참고 : mRBP 식별을 위해 각 샘플에서 농축 된 mRBP 용액을 25 μL 취하여 두 번째 1D-PAGE 젤을 실행하십시오. 실버 스테인드 젤은 MS 분석과 호환되지 않기 때문에 사용할 수 없습니다.
    1. 1D - PAGE 젤을 실행 후, 고정 솔루션 (50 % ( V / V ) 메탄올과 10 % ( V / V ) 아세트산)에 겔을 1 시간 동안 고정하십시오. 부드럽게 흔들어 얼룩 용액 (0.1 % ( w / v ) Coomassie Brilliant Blue R-250, 50 % ( v / v ) 메탄올 및 10 % ( v / v ) 아세트산)에서 20 분 동안 젤을 염색하십시오. 탈염 용액 (40 % ( v / v ) 메탄올 및 10 % ( v)/ v) 아세트산)로 1 시간 동안 처리 하였다. 폐기 후 젤을 5 % ( v / v ) 아세트산에 보관하십시오.
      참고 : 삭제 중에는 배경이 완전히 소멸 될 때까지 새로운 destain 솔루션을 교체 할 수 있습니다.
    2. 관심있는 밴드를 젤 밖으로 잘라냅니다. 이어지는 최적의 트립신 소화 및 펩타이드 추출을 위해 밴드를 약 1 mm 3 조각으로 더 잘라냅니다. 10 분 동안 100 MM 암모늄 중탄산염 (NH 4 HCO 3 ) 50 μL로 겔 조각을 수화. 젤 조각을 완전히 덮으십시오.
      1. 수화 솔루션을 조심스럽게 제거하고 10 분 동안 아세토 니트릴 (CH 3 CN)로 겔 조각을 탈수하십시오. 조심스럽게 아세토 니트릴 용액을 제거하십시오.
      2. 수화에서 탈수까지 두 번 반복하십시오. 마지막으로 아세토 니트릴 용액을 제거하십시오.
        참고 : 겔 실행 시간은 실험 목적에 따라 다릅니다. 장기간에 걸쳐 단백질을 잘 분리 할 수 ​​있으므로 염색 된 특정 젤 금지추가 분석을 위해 ds를 잘라낼 수 있습니다. 단백질을 유지하고 오염 물질을 제거하는 것이 목적이라면, 짧은 시간이면 충분합니다.
    3. 6.6 MM DTT 솔루션의 500 μL를 추가하고 10 분 동안 겔 조각을 품어. DTT 솔루션을 제거하고 95 % ( V / V ) 아세토 니트릴 솔루션 500 μL로 겔 조각을 두 번 씻으십시오.
      1. 세척 후, 아세토 니트릴 용액을 제거하고 어둠 속에서 10 분 동안 55 mM iodoacetic acid (IAA) 용액 500 μL와 겔 조각을 품어 라.
      2. 배양 후, 용액을 제거하고 95 % ( v / v ) 아세토 니트릴 용액 500 μL로 겔 조각을 다시 씻으십시오. 젤 조각을 말리십시오.
    4. 소화 완충액 (50 MM NH 4 HCO 3 , 5 mM CaCl 2 및 6 ng / μL 트립신) 25 μL로 겔 조각을 완전히 삽입하고 트립신이 젤로 침투하도록 45 분 동안 얼음에 보관하십시오. 37 ° C에서 밤새 젤 조각을 품어 zymatic 소화.
  2. 펩타이드 정제
    1. 트립신 펩타이드를 추출하기 위해 소화 완충액과 맴돌이의 겔 조각에 50 mM NH 4 HCO 3 80 μL를 반복 첨가한다. 추출물을 수집하십시오. 50 % 80 μL (V / V) CH 3 CN, 5 % (v / v)의 포름산 (FA)로 두번 추출 단계를 반복한다.
      참고 : 총 최종 추출물은 약 240 μL이어야합니다.
    2. 진공 농축 또는 동결 건조하여 약 10 μL로 추출물을 풀 및 농축하고 0.1 % ( v / v ) 수성 트리 플루오로 아세트산 (TFA) 수용액 25 μL를 첨가한다. 제조자의 프로토콜에 따라 샘플을 μ-C18 컬럼으로 탈색한다.
    3. 4 - 10 μL의 60 % ( w / v ) CH 3 CN 및 0.1 % ( v / v ) FA로 펩티드를 용출시킨다. 펩타이드를 동결 건조시키고 분석 할 때까지 -20 ° C에서 보관하십시오.
제목 "> 10.Nano-LC-MS

  1. 나노 역상 액체 크로마토 그래피
    참고 : 액체 크로마토 그래피 장비와 온라인으로 결합 된 질량 분석기로 LC-MS 분석을 수행하십시오. 이기구는 C18 컬럼 (2 μm 입자, 100Å 공극 크기, 50 μm x 15 cm 크기)을 갖추고 있어야합니다.
    1. 용액 (2 % ( V / V ) CH 3 CN 및 0.1 % ( V / V ) FA) 16 μL에 동결 건조 펩티드를 Resuspend. C18 precolumn (3 μm의 입자 크기, 100 Å의 기공 크기, nanoviper 및 75 μm의 X 2 cm의 차원)에 5 μL / 분의 유속에서 펩타이드 솔루션 5 μL를 삽입하고로드합니다.
    2. 10.1.2. 300nL / min의 유속으로 95 분의 기울기를 사용하여 펩타이드를 분리합니다. 이 분리 구배 동안 5 분, 50 분 및 18 분에 각각 이동상 B를 4 %에서 10 %, 10 %에서 25 % 및 25 %에서 45 %로 증가시킵니다. 마지막으로, 1 분 안에 이동상 B를 95 %까지 급격히 증가시킵니다. 후각 95 분 분리 구배는 5 분에 4 %에서 95 %까지의 10 분 구배가 포함 된 고유의 헹굼 단계를 적용합니다.
      주 : 이동상 A는 19.92 %의 H 2 O 80 % 99.9 % H 2 O, 0.1 % (v / v)의 FA 및 이동상 B이다 CH 3 CN, 0.08 % (V / V (/ V w) ) FA.
  2. 질량 분광 분석법
    1. 400에서 1,600 m / z 범위의 질량을 갖는 데이터 의존 모드에서 질량 분석기를 작동하십시오.
    2. 분열 스펙트럼을 생성하기 위해 MS1에서 최대 10 개의 가장 강한 이온을 선택하십시오. 해상도를 MS1의 경우 70,000, MS2의 경우 17,000, 자동 이득 제어 (AGC) 대상을 3,000,000 및 1,000,000 이온으로, 최대 이온 주입 시간 (IT)은 MS1의 경우 256 및 64ms로 설정하십시오 및 MS2를 각각 나타낸다.
    3. 가장 풍부한 이온의 반복 된 단편화를 피하기 위해 동적 인 제외를 10 초로 설정하십시오.
      참고 : 여기서, 6 개 이상의 전하를 갖는 이온은 eMS2에 대해 xcluded.
  3. 정 성적 proteomics : 펩타이드 및 단백질 식별
    1. Peaks 스튜디오 소프트웨어 47 , 48 , 49 와 같은 소프트웨어를 사용하여 단편 스펙트럼을 분석하십시오.
      참고 : NovoHMM 30 및 PepNovo 37 ( de novo sequencing) 및 SEQUEST 54 및 Mascot 55 ( 데이터베이스 검색 용)와 같은 기타 소프트웨어 패키지도 펩타이드 식별에 사용할 수 있습니다.
    2. 동일한 질량 (<2 ppm 차이) 및 보유 시간 (<2 분)으로 스펙트럼을 결합하고 품질 임계 값이 0.65 이상인 스펙트럼 만 유지하여 모델링 할 분류 집합에 대한 Swiss-Prot 데이터베이스 (버전 : 2013 년 12 월)를 검색합니다. 식물 Arabidopsis thaliana . 다음 검색 매개 변수를 사용하십시오 : 몬의 사용을 통해 10 ppm의 전구 물질 질량 허용 오차동위 원소 질량; 20 mmu의 조각 질량 내성; 소화 효소로서 트립신 (trypsin)으로서 최대 2 개 분열 절단; 고정 된 변형으로서의 시스테인 카바 미도 메틸화; 메티오닌 산화를 변수 변경으로; 및 펩티드 당 최대 3 개의 가변적 인 번역 후 변형을 포함한다. 확인 후 FDR (False Discovery Rate) <5 %가 획득되도록 신뢰할 수있는 펩타이드 및 단백질 식별을위한 점수 임계 값을 수동으로 설정합니다.
  4. 정량적 프로테오믹스 : 질량 분석 데이터의 통계 분석
    1. proteomics 데이터의 라벨없는 정량을 위해 LC-MS ( 예 : Progenesis)를 사용하십시오.
      참고 : MS1 펩티드 피크 영역 (또는 강도)은 질량에 따라 스튜디오 소프트웨어에 의해 확인 된 펩타이드와 연결되어 있으며 최대 허용 오차는 10ppm입니다.
      참고 :이 소프트웨어는 모든 전하 상태의 피크 면적을 2 <+ 및 8 + . 정량적 데이터는 내부 스크립트 (PEAKS peptide identification)와 연결되어 있습니다 (최대 허용 오차는 10 ppm입니다).
    2. 각 펩타이드의 평균 log2 배 변화 (CL / non-CL)를 계산하십시오. 독특한 펩티드의 fold-changes를 단백질별로 그룹화합니다.
      참고 : 각 그룹에서 단백질의 최종 fold-change는 펩티드의 평균 fold-change와 같습니다.
    3. 통계적 유의성을 평가하기 위해 각 그룹에 대해 Student 's t -test를 사용하여 p- 값을 계산합니다. R 소프트웨어 패키지 (버전 3.3.0)를 적용하여 Benjamini-Hochberg (BH) 방법을 사용하여 모든 그룹의 FDR에 대한 p- 값을 수정합니다.
    4. R 소프트웨어 패키지 (버전 3.3.0)와 호환되는 "보정"기능 패키지 (버전 1.7.2)를 사용하여 화산 플롯을 그립니다.
      참고 : 여기에서 -log10 조정 p 값 (-log10 (adj. p 값))은 식별 된 모든 단백질의 log2 배 변화의 함수입니다. 단백질은log2 배의 변화가 2 이상인 경우 mRNA 결합 프로테옴에서 양성으로 판정된다.

11. 확인 된 mRNA- 결합 Proteome의 카탈로그

  1. Gene Ontology (GO) 데이터베이스와 InterPro 데이터베이스를 통한 "family and domain"을 통해 "분자 기능과 생물학적 과정"항목을 기반으로 10 단계에서 확인 된 단백질을 3 가지 범주로 분류하십시오.
  2. 카테고리 I 또는 "Ribosomal proteins"은 검출 된 모든 리보솜 단백질을 포함하고 RNA와 상호 작용하거나 RNA 생물학에서 알려진 또는 알려지지 않은 기능과 결합하는 주석이 달린 단백질 도메인을 포함하는 카테고리 II의 단백질 또는 "주요 RBP"를 정의합니다 .
  3. 주석이 첨부 된 RNA 결합 도메인이없는 RNA 생물학에서 알려진 또는 알려지지 않은 기능을 가진 단백질이 카테고리 III 또는 "후보 RBPs"에 배치되면 I의 주석에 기반하여 카테고리 III의 효소를 정의합니다ntEnz 데이터베이스.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

우리는 세척 버퍼 2 ( 그림 1B )와 함께 세척 단계 4.3에서 CL 샘플의 비드 펠렛을 둘러싼 특징적인 후광을 관찰했습니다. 그것이 조사되지 않았지만,이 현상은 자성 포획 동안 가교 결합 된 mRNP 복합체가 비드 응집체와 간섭하여보다 확산 된 응집체가 형성되는 것으로 설명 될 수있다. 그것은 (T) (25)의 비드 포착 올리고 D 14 효과적이라는 것을 나타낸다.

비 CL 대조군과 CL 표본 모두에서 18S rRNA보다 유의하게 높은 UBQ10 기준 mRNA 수준이 도 1c에 제시되어 있다 . 이것은 poly (A) -tailed mRNA에만 결합 할 수있는 oligo-d (T) 25 비드의 포획으로 인해 용리액에서 mRNA가 풍부 해짐을 나타냅니다. 올리고 -d (T) 25 비드 포획의 효율은 추가로 suppRNase 처리 및 mRBP 농도 (단계 7) 후에도 1D에 나타낸 바와 같이, SDS-PAGE 및은 염색법 (단계 8)에 의해 지시 하였다. 비 CL 대조구와 CL 표본 차선 사이의 단백질 밴드 패턴의 차이가 분명히 관찰 될 수 있으며, 비 CL 대조 샘플 레인에 존재하는 단백질 밴드는 RNase의 존재에 의해 설명 될 수있다. 이것은 CL 샘플에서 mRBPs의 강력한 농축을 설명합니다.

가교 결합의 효율은 UV 조사의 지속 시간을 변화시킴으로써 제어 될 수있다. 충분한 가교 결합은 있지만, 원형질체 손상 및 RNA 분해의 회피는 최적이다. 그림 1D 에서 모든 CL 샘플의 특정 단백질 밴드 패턴은 다른 UV 조사 시간 (1, 3, 5 분)을 비교할 때 얻어졌습니다. 동일한 자외선 강도 (0.00875W / cm 2 )에서, 가장 최적의 조건은 구별 할 수 없기 때문에 1 분 또는 3 분으로 나타났습니다단백질 밴드 강도. 더 긴 가교 시간 (5 분)으로 더 약한 밴드 강도가 관찰되었다. 가교 결합 기간이 짧으면 페트리 접시에서 원형질체를보다 쉽게 ​​옮길 수 있고 수집 할 수 있다는 장점이 있기 때문에 1 분을 최적 조건으로 생각했습니다. 원형질은 접시 바닥에 붙어 있기 때문에 자외선을 조사하는 동안 페트리 접시의 바닥으로 빠르게 침전 될 수 있습니다. 이로 인해 UV 조사 시간이 길어지면 튜브를 수집하고 전달하기가 더 어려워집니다.

최적화 된 조건에 기초하여, 3 개의 생물학적 복제로부터의 단백질의 동정은 단계 9 및 10에서 기술 된 질적 및 양적 프로테오믹스에 의해 순차적으로 달성되었다. 정량적 프로테오믹스 ( 도 1E , 우측)에 의한 분석에서 총 341 개의 단백질 CL 샘플에서 확인되었으며, 그 중 36 개가 비 CL 대조군 및d CL 샘플에서 검출되었고, 단지 8 개의 단백질 만이 비 CL 대조 샘플에서 검출되었다. SDS-PAGE와 silver-staining 분석은 oligo-d (T) 단백질의 효율을 확인하는 좋은 도구라는 아이디어를 뒷받침하는 두 단백질 간의 식별 된 단백질 수의 엄청난 차이가 다른 단백질 밴드 패턴 ( 그림 1D ) 25 구슬 캡처. 정량적 프로테오믹스 ( 그림 1E , 왼쪽)에 의한 분석에서, 총 325 개의 단백질 (청색 및 녹색으로 착색 된)은 log2 배의 변화가 2보다 큰 것을 나타냈다. 이들 단백질 중에서, 100 개의 단백질 (청색) 값은 유의 수준보다 높습니다. 따라서 그들은 또한 긍정적 인 히트로 정의되었습니다. 또 다른 225 개의 단백질 (녹색)의 p- 값이 데이터 희박성 (data sparsity)으로 인해 유의 수준보다 낮은 0.05보다 컸다는 것이 주목할 만하다. 다른 말로하면, 펩티드 농도의 높은 가변성을 가진, 각 단백질에 대해 존재하는 낮은 펩타이드가 존재한다는 것이다es. 그러나, 이들 모두는 CL 샘플에서만 정 성적으로 검출 되었기 때문에 양성으로 간주되었다.

GO 및 InterPro 데이터베이스 50 (11 단계)에 따라이 325 개의 단백질을 범주 I (리보솜 단백질), 범주 II (주 RBP) 및 범주 III (후보 RBP) ( 그림 1F )로 분류했습니다. 카테고리 I에는 123 개의 리보솜 단백질이 있었고 카테고리 II에는 70 개의 주석이 달린 클래식 RBP가 관찰되었다. 분자 RNA 결합과 RNA 생물학 ( 그림 1F , 오른쪽)과 연결되어 있으며 전체 mRNA 결합 프로테옴의 약 38 %와 22 %를 차지하는 주석이 달린 대부분의 단백질을 포함하는이 두 범주는 최적화 된 mRNA 상호 작용의 높은 효율을 나타냅니다 포착. 마지막 40 % (132 후보 RBP)는 기존 RBD가 없기 때문에 카테고리 III에 분류되었습니다. 또한, 대부분의RNA 결합 및 RNA 생물학적 과정에서의 역할은 검증되지 않았다 ( 그림 1F , 왼쪽). 우리는이 카테고리의 단백질이 RNA 규정에서 새로운 기능을 나타낼 수 있다고 가정합니다.

그림 1
그림 1 : Arabidopsis Leaf Mesophyll Protoplast의 mRNA 결합 단백질 발견을위한 최적화 된 방법의 순서도와 결과. ( A ) 전체 방법의 주요 단계는 1에서 11까지이다. 세포와 분자의 추정 과정은 사진과 만화로 설명된다. 각 단계에 대한 세부 사항은 의정서에 집중적으로 기술되어있다. ( B ) 세척 단계 4.3 동안 CL 샘플에서 비드 펠렛을 둘러싸고 있지만 비 CL 대조 샘플에서는 보이지 않는 후광이 관찰되었다. ( C ) 상대적 UBQ10 mRNA와 18S rRNA 레벨의 비교q는 CLR이 아닌 대조군에서, CL은 qRT-PCR (값은 평균 ± SD (n = 3), * 및 **는 p <0.05 및 <0.01)과 유의 한 차이가 있음. ( D ) 0.00875 W / cm 2 의 자외선 강도로 1, 3, 5 분 동안 연속파 UV 소스에 의해 조사 된 CL 샘플과 비교 된 비 CL 대조 샘플의 농축 된 단백질 용리액. ( E ) proteomics에 의한 mRNA- 결합 단백체의 동정. Progenesis 소프트웨어 패키지 (왼쪽)에 의해 수행 된 정량적 프로테오믹스에서 화산 플롯은 평균 log2 배 변화 (CL / non-CL) 및 관련 조정 된 P 값 (-log10 (adj. p 값))을 표시합니다. 모든 단백질. Peaks 소프트웨어 패키지 (오른쪽)에 의해 수행 된 정성 proteomics에서 샘플의 단백질은 벤 다이어그램에 설명되어 있습니다. 단백질의 양은 숫자로 나열되어 있습니다. 펩티드와 단백질 수준에 FDR는 5 %의 밑에있다. 밝은 갈색 프레임 안의 단백질 수는 양성으로 간주됩니다. ( 외 2016에서 수정되었습니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

우리는 성공적으로 효모 및 인간 세포를 위해 개발 된 mRNA 상호 작용 포획을 엽초 엽 원형 엽록체에 적용했다. 잎 초 필 세포는 식물 잎의 지상 조직의 주요 유형입니다. 이 방법의 가장 큰 장점은 생체 환경에서 단백질을 발견하기 위해 생체 내 가교 결합을 사용한다는 것입니다.

이 프로토콜에서, 우리는 주로 최적의 실험 조건 (50) (예를 들어, 원형질체의 개수와 재료 UV 조사의 지속 시간을 시작으로 사용하기 위해)의 다수를 제시한다. CL 샘플에서 포획 된 단백질은 최소 10 7 개의 원형질체 (중간 규모)가 사용될 때 (단계 1.5.5) SDS-PAGE 및은 염색법으로 만 검출 될 수 있습니다. 농도가 낮 으면 SDS-PAGE에서 관찰 가능한 mRBP 패턴이 생성되지 않으므로 proteomics의 추가 분석에는 사용하지 않아야합니다. 실제로 10 7 개 이상의 세포를 사용합니다 ( 예 : 10 9 in대규모 실험)도 20있다. 실버 염색 분석 결과는 0.00875 W / 연속파 UV 소스에 의해 생성되는 강도 cm 2로 1 분간 UV 조사 최적 (도 1D)임을 시사한다. 임계 단계 ( 즉, mRNP 풀다운 및 올리고 -d (T) 25 비드에 의한 정제, 단계 4)에서의 높은 효율은 RT-qPCR,은 염색 및 MS 분석의 결과에 의해 뒷받침된다 ( 도 1C ; 1D1E , 오른쪽). 질적 및 양적 proteomics의 조합은 비 CL 컨트롤과 CL 샘플 간의 중복 영역에서 양성 RBP를 확인하는 데 도움이 될 수 있습니다 ( 그림 1E ). 확인 된 단백질의 대부분은 이전에 데이터 세트에 주석이 달려 있지 않은 RBP였다 ( 그림 1F ). 우리는 범주 III에서 이전에 알려지지 않은 RNA 결합 단백질을 후보 RBP로 제시했다 <sup class = "xref"> 50 ( 그림 1F ). 후보 RBP의 결합 특이성을 탐색하려면 앞서 언급 한 CLIP 방법 23 과 같은 다른 방법을 사용해야합니다. CLIP 51 의 사용을 통해 RBP가 Arabidopsis 에서 표적 mRNA 전 사체를 조절하는 RBP의 결합 특이성을 조사한 한 가지 예가 Zhang et al ., 2015에서 발견 할 수있다. 또한 PAR-CLIP의 대안으로 수정 된 방법 인 photoactivatable- ribonucleoside-enhanced crosslinking (PAR-CL, 365-nm UV-A)은 또한 효모와 인간 세포에서 mRNA- 결합 된 프로테옴의 연구를 위해 이전에 권장되었다 14 , 23 . PAR-CL은 4Su를 필요로하는데, 이는 세포에 의해 흡수되어 RNA 대사 과정에서 초기 RNA에 통합되어 매우 반응성이있어 UV-A (365-nm) 조사 하에서 아미노산 52 와 공유 결합을 형성 할 수있다ation. 현재, 엽육 원형질체 (53)로 식물 세포 및 외인성 4sU의 효율적인 흡수에 4sU의 독성에 초점을 맞춘 연구는 없다. 그러나 기존의 CL (254-nm UV-C)와 PAR-CL (365 nm UV-A)를 식물에 사용하는 것이 가능해질 것으로 믿어 지는데, 이는 생리 학적으로 다양한 RBP의 발견과 검증에 기여할 것입니다 미래의 환경.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

저자는 공개 할 것이 없습니다.

Acknowledgements

우리는 기존 UV 램프가 장착 된 UV 가교 장치를 제공 한 Joris Winderickx 교수의 실험실을 인정합니다. KG는 KU Leuven 연구 기금이 지원하며 FWO 교부금 G065713N의 지원을 인정합니다.

Materials

Name Company Catalog Number Comments
REAGENTS
0.8 M Mannitol Sigma M1902-500G Primary isotonic Enzyme solution &
MMg solution
2 M KCl MERCK Art. 4935 Primary isotonic Enzyme solution &
W5 buffer
0.2 M MES (pH 5.7)
(4-morpholineethanesulfonic acid)
Sigma-aldrich M2933 Primary isotonic Enzyme solution,
W5 buffer &
MMg solution,
Filtration sterilization
Cellulase R10 Yakult Pharmaceutical Industry Co., Ltd. CELLULASE
“ONOZUKA”
R-10, 10 g
Final isotonic enzyme solution
Macerozyme R10 Yakult Pharmaceutical Industry Co., Ltd. MACEROZYME R-10, 10g Final isotonic enzyme solution
10% (w/v) BSA
(Bovine Serum Albumin)
Sigma-aldrich A7906-100G Final isotonic enzyme solution &
Filtration sterilization
1 M CaCl2 Chem-Lab NV CL00.0317.1000 Final isotonic enzyme solution,
W5 buffer &
Digestion buffer
1 M NaCl Fisher Chemical S/3160/60 W5 buffer
2 M MgCl2 Sigma M8266-100G MMg solution
1 M LiCl
(Lithium Chloride)
Acros 199885000 Lysis/binding buffer,
Wash buffer 1,
Wash buffer 2 &
Low salt buffer
5% (w/v) LiDS
(Lithium Dodecyl Sulphate)
Sigma-aldrich L4632-25G Lysis/binding buffer,
Wash buffer 1 &
Filtration sterilization
1 M DTT
(Dithiothreitol)
Thermo Fisher Scientific
Wash buffer 1 &
Wash buffer 2
307866 Lysis/binding buffer,
1 M Tris-HCl (pH 7.5) (Tris(hydroxymethyl)aminomethane, Hydrochloric acid S.G. (HCl)) Acros &
Fisher Chemical
167620010 &
H/1200/PB15
Lysis/binding buffer,
Wash buffer 1,
Wash buffer 2,
Low salt buffer &
Elution buffer
0.5 M EDTA (pH 8.0) (Ethylenediaminetetraacetic acid) Sigma-aldrich ED-500G Lysis/binding buffer,
Wash buffer 1,
Wash buffer 2,
Low salt buffer &
Elution buffer
Tween 20 MERCK 8.22184.0500 Regeneration of oligo-d(T)25 beads
0.1 M NaOH VWR PROLABO CHEMICALS 28244.295 Regeneration of oligo-d(T)25 beads
1x PBS (pH 7.4)
(Phosphate Buffered Saline)
containing
(NaCl; KCl; Na2HPO4; KH2PO4)
Fisher Chemical, MERCK,
Sigma-aldrich & SAFC
S/3160/60,
Art. 4935,
71640-250G &
60230
Regeneration of oligo-d(T)25 beads
Proteinase K solution (2 μg/μL) Thermo Fisher Scientific 11789020 Protein digestion
Loading dye Invitrogen LC5925 SDS-PAGE
qPCR master mix Promega A6001 qRT-PCR assay
RNase Cocktail Thermo Fisher Scientific AM2286 RNA digestion
Methanol Sigma-aldrich 322415 Gel fixation and gel destaining
Acetic acid Sigma-aldrich 537020 Gel fixation and gel destaining
Coomassie Brilliant Blue R-250 Thermo Fisher Scientific 20278 Gel staining
1 M NH4HCO3
(Ammonium bicarbonate)
 
Sigma-aldrich 09830-500G Gel hydration &
Digestion buffer
CH3CN
(Acetonitrile)
Sigma-aldrich 34851-100ML Gel dehydration &
Peptide dissolving solution
IAA
(Iodoacetic acid)
Sigma-aldrich I4386-10G Alkylating agent
TFA
(Trifluoroacetic acid)
Sigma-aldrich 302031-10X1ML Peptide dissolving solution
FA
(Formic acid)
Sigma-aldrich 06554-5G Peptide extraction
Trypsin solution (6 ng/μL) Promega V5280 Digestion buffer
Name Company Catalog Number Comments
EQUIPMENT
Soil Peltracom LP2D Plant growth
Vermiculite 3 Sibli AS 05VERMICULIET Plant growth
Petri dish (150 x 20 mm) Sarstedt 82.1184.500 Carrier for protoplast suspension
0.22 μm filter Millipore SE2M229104 Homogenization of final isotonic enzyme solution
Razorblade Agar Scientific T585 Rosette leaf strips
35-75 μm nylon mesh SEFAR NITEX 74010 Protoplast suspension filtration
50 mL round bottom tubes Sigma-aldrich T1918-10EA Carrier for protoplast suspension
Hemocytometer
(Bürker hemocytometer)
MARIENFELD 650030 Protoplast cell counting
UV crosslinking apparatus
(HL-2000 HybriLinker)
UVP, LLC UVP95003101 in vivo UV crosslinking
UV lamp
(Sankyo-Denki G8T5)
SANKYO
DENKI
SD G8T5 in vivo UV crosslinking
50 mL glass syringe FORTUNA Optima Z314560 Homogenization of protoplast lysate
Narrow needle (0.9 x 25 mm) Becton Dickinson microlance 3 2021-04 Homogenization of protoplast lysate
Rotator Model L26 Labinco BV 26110912 Sample incubation by rotating
Oligo-d(T)25 magnetic beads
(5 mg/mL)
New England BioLabs S1419S mRNPs and mRNAs binding and pull-down
Magnetic rack Invitrogen CS15000 mRNPs and mRNAs binding and pull-down
Centrifugal filter units
(Amicon Ultra-4 centrifugal filter units)
EMD Millipore UFC800308 mRBP concentration
Pierce Silver Stain Kit Thermo Fisher Scientific 24612 Silver-staining assay
RNA purification kit
(InviTrap Spin Plant RNA Mini Kit)
STRATEC Molecular 1064100300 RNA purification
Spectrophotometer device (NanoDrop 1000 Spectrophotometer) Thermo Fisher Scientific ND-1000 RNA quality and quantity
Real-Time PCR cycler
(StepOne Real-Time PCR cycler)
Thermo Fisher Scientific 4376600 cDNA quantification
µ-C18 columns
(Millipore Zip Tip µ-C18 columns)
Sigma-aldrich 720046-960EA Peptide purification
Mass spectrometer
(Q Exactive Hybrid Quadrupole-Orbitrap Mass Spectrometer)
Thermo Fisher Scientific IQLAAEGAAPFALGMAZR Mass spectrometry-based proteomics
Liquid chromatography instrument (Ultimate 3000 ultra-high performance liquid chromatography (UHPLC) instrument) Thermo Fisher Scientific ULTIM3000RSLCNANO Mass spectrometry-based proteomics
C18 column
(Easy Spray Pepmap RSLC C18 column)
Thermo Fisher Scientific ES800 Mass spectrometry-based proteomics
C18 precolumn
(Acclaim Pepmap 100 C18 precolumn)
Thermo Fisher Scientific 160321 Mass spectrometry-based proteomics
Name Company Catalog Number Comments
Primers for qRT-PCR assay Sequences
UBQ10 mRNA
(Li et al., 2014)
Fw: AACTTTGGTGGTTTGTGTTTTGG
Rv: TCGACTTGTCATTAGAAAGAAAGAGATAA
18S rRNA
(Durut et al., 2014)
Fw: CGTAGTTGAACCTTGGGATG
Rv: CACGACCCGGCCAATTA

DOWNLOAD MATERIALS LIST

References

  1. Jankowsky, E., Harris, M. E. Specificity and nonspecificity in RNA-protein interactions. Nat Rev Mol Cell Biol. 16, (9), 533-544 (2015).
  2. Glisovic, T., Bachorik, J. L., Yong, J., Dreyfuss, G. RNA-binding proteins and post-transcriptional gene regulation. FEBS Lett. 582, (14), 1977-1986 (2008).
  3. Gerstberger, S., Hafner, M., Tuschl, T. A census of human RNA-binding proteins. Nat Rev Genet. 15, (12), 829-845 (2014).
  4. Lin, Q., Taylor, S. J., Shalloway, D. Specificity and determinants of Sam68 RNA binding. Implications for the biological function of K homology domains. J Biol Chem. 272, (43), 27274-27280 (1997).
  5. Deo, R. C., Bonanno, J. B., Sonenberg, N., Burley, S. K. Recognition of polyadenylate RNA by the poly(A)-binding protein. Cell. 98, (6), 835-845 (1999).
  6. Kattapuram, T., Yang, S., Maki, J. L., Stone, J. R. Protein kinase CK1 alpha regulates mRNA binding by heterogeneous nuclear ribonucleoprotein c in response to physiologic levels of hydrogen peroxide. J Biol Chem. 280, (15), 15340-15347 (2005).
  7. Patel, G. P., Ma, S., Bag, J. The autoregulatory translational control element of poly(A)-binding protein mRNA forms a heteromeric ribonucleoprotein complex. Nucleic Acids Res. 33, (22), 7074-7089 (2005).
  8. Song, J. K., McGivern, J. V., Nichols, K. W., Markley, J. L., Sheets, M. D. Structural basis for RNA recognition by a type II poly(A)-binding protein. Proc Natl Acad Sci USA. 105, (40), 15317-15322 (2008).
  9. Lambert, N., Robertson, A., Jangi, M., McGeary, S., Sharp, P. A., Burge, C. B. RNA Bind-n-Seq: quantitative assessment of the sequence and structural binding specificity of RNA binding proteins. Mol Cell. 54, (5), 887-900 (2014).
  10. Cook, K. B., Kazan, H., Zuberi, K., Morris, Q., Hughes, T. R. RBPDB: a database of RNA-binding specificities. Nucleic Acids Res. 39, Database issue D301-D308 (2011).
  11. Konig, J., Zarnack, K., Luscombe, N. M., Ule, J. Protein-RNA interactions: new genomic technologies and perspectives. Nat Rev Genet. 13, (2), 77-83 (2012).
  12. Hockensmith, J. W., Kubasek, W. L., Vorachek, W. R., von Hippel, P. H. Laser cross-linking of nucleic acids to proteins. Methodology and first applications to the phage T4 DNA replication system. J Biol Chem. 261, (8), 3512-3518 (1986).
  13. Pashev, I. G., Dimitrov, S. I., Angelov, D. Crosslinking proteins to nucleic acids by ultraviolet laser irradiation. Trends Biochem Sci. 16, (9), 323-326 (1991).
  14. Castello, A., et al. System-wide identification of RNA-binding proteins by interactome capture. Nat Protoc. 8, (3), 491-500 (2013).
  15. Nagy, E., Rigby, W. F. Glyceraldehyde-3-phosphate dehydrogenase selectively binds AU-rich RNA in the NAD(+)-binding region (Rossmann fold). J Biol Chem. 270, (6), 2755-2763 (1995).
  16. Hentze, M. W., Preiss, T. The REM phase of gene regulation. Trends Biochem Sci. 35, (8), 423-426 (2010).
  17. Nicholls, C., Li, H., Liu, J. P. GAPDH: a common enzyme with uncommon functions. Clin Exp Pharmacol Physiol. 39, (8), 674-679 (2012).
  18. Baltz, A. G., et al. The mRNA-bound proteome and its global occupancy profile on protein-coding transcripts. Mol Cell. 46, (5), 674-690 (2012).
  19. Castello, A., et al. Insights into RNA Biology from an Atlas of Mammalian mRNA-Binding Proteins. Cell. 149, (6), 1393-1406 (2012).
  20. Kwon, S. C., et al. The RNA-binding protein repertoire of embryonic stem cells. Nat Struct Mol Biol. 20, (9), 1122-1130 (2013).
  21. Mitchell, S. F., Jain, S., She, M., Parker, R. Global analysis of yeast mRNPs. Nat Struct Mol Biol. 20, (1), 127-133 (2013).
  22. Beckmann, B. M., et al. The RNA-binding proteomes from yeast to man harbour conserved enigmRBPs. Nat Commun. 6, (10127), 1-9 (2015).
  23. Bailey-Serres, J., Sorenson, R., Juntawong, P. Getting the message across: cytoplasmic ribonucleoprotein complexes. Trends Plant Sci. 14, (8), 443-453 (2009).
  24. Quesada, V., Macknight, R., Dean, C., Simpson, G. G. Autoregulation of FCA pre-mRNA processing controls Arabidopsis flowering time. EMBO J. 22, (12), 3142-3152 (2003).
  25. Lim, M. H., et al. A new Arabidopsis gene, FLK, encodes an RNA binding protein with K homology motifs and regulates flowering time via FLOWERING LOCUS C. Plant Cell. 16, (3), 731-740 (2004).
  26. Hornyik, C., Terzi, L. C., Simpson, G. G. The spen family protein FPA controls alternative cleavage and polyadenylation of RNA. Dev Cell. 18, (2), 203-213 (2010).
  27. Stern, D. B., Goldschmidt-Clermont, M., Hanson, M. R. Chloroplast RNA metabolism. Annu Rev Plant Biol. 61, 125-155 (2010).
  28. Schmal, C., Reimann, P., Staiger, D. A circadian clock-regulated toggle switch explains AtGRP7 and AtGRP8 oscillations in Arabidopsis thaliana. PLoS Comput Biol. 9, (3), e1002986 (2013).
  29. Staiger, D. RNA-binding proteins and circadian rhythms in Arabidopsis thaliana. Philos Trans R Soc Lond B Biol Sci. 356, (1415), 1755-1759 (2001).
  30. Fischer, B., et al. NovoHMM: a hidden Markov model for de novo peptide sequencing. Anal Chem. 77, (22), 7265-7273 (2005).
  31. Kwak, K. J., Kim, Y. O., Kang, H. Characterization of transgenic Arabidopsis plants overexpressing GR-RBP4 under high salinity, dehydration, or cold stress. J Exp Bot. 56, (421), 3007-3016 (2005).
  32. Raab, S., Toth, Z., de Groot, C., Stamminger, T., Hoth, S. ABA-responsive RNA-binding proteins are involved in chloroplast and stromule function in Arabidopsis seedlings. Planta. 224, (4), 900-914 (2006).
  33. Liu, H. H., et al. Molecular cloning and characterization of a salinity stress-induced gene encoding DEAD-box helicase from the halophyte Apocynum venetum. J Exp Bot. 59, (3), 633-644 (2008).
  34. Wang, S. C., Liang, D., Shi, S. G., Ma, F. W., Shu, H. R., Wang, R. C. Isolation and Characterization of a Novel Drought Responsive Gene Encoding a Glycine-rich RNA-binding Protein in Malus prunifolia (Willd.) Borkh. Plant Mol Biol Report. 29, (1), 125-134 (2011).
  35. Lorkovic, Z. J., Barta, A. Genome analysis: RNA recognition motif (RRM) and K homology (KH) domain RNA-binding proteins from the flowering plant Arabidopsis thaliana. Nucleic Acids Res. 30, (3), 623-635 (2002).
  36. Ambrosone, A., Costa, A., Leone, A., Grillo, S. Beyond transcription: RNA-binding proteins as emerging regulators of plant response to environmental constraints. Plant Science. 182, 12-18 (2012).
  37. Frank, A., Pevzner, P. PepNovo: de novo peptide sequencing via probabilistic network modeling. Anal Chem. 77, (4), 964-973 (2005).
  38. Marondedze, C., Thomas, L., Serrano, N. L., Lilley, K. S., Gehring, C. The RNA-binding protein repertoire of Arabidopsis thaliana. Sci Rep. 6, (29766), 1-13 (2016).
  39. Reichel, M., et al. In Planta Determination of the mRNA-Binding Proteome of Arabidopsis Etiolated Seedlings. Plant Cell. 28, (10), 2435-2452 (2016).
  40. Yoo, S. D., Cho, Y. H., Sheen, J. Arabidopsis mesophyll protoplasts: a versatile cell system for transient gene expression analysis. Nat Protoc. 2, (7), 1565-1572 (2007).
  41. Niu, Y., Sheen, J. Transient expression assays for quantifying signaling output. Methods Mol Biol. 876, 195-206 (2012).
  42. Petersson, S. V., et al. An auxin gradient and maximum in the Arabidopsis root apex shown by high-resolution cell-specific analysis of IAA distribution and synthesis. Plant Cell. 21, (6), 1659-1668 (2009).
  43. Bargmann, B. O., Birnbaum, K. D. Fluorescence activated cell sorting of plant protoplasts. J Vis Exp. (36), (2010).
  44. Hong, S. Y., Seo, P. J., Cho, S. H., Park, C. M. Preparation of Leaf Mesophyll Protoplasts for Transient Gene Expression in Brachypodium distachyon. J Plant Biol. 55, (5), 390-397 (2012).
  45. Li, Y., Van den Ende, W., Rolland, F. Sucrose Induction of Anthocyanin Biosynthesis Is Mediated by DELLA. Mol Plant. 7, (3), 570-572 (2014).
  46. Durut, N., et al. A duplicated NUCLEOLIN gene with antagonistic activity is required for chromatin organization of silent 45S rDNA in Arabidopsis. Plant Cell. 26, (3), 1330-1344 (2014).
  47. Han, Y. H., Ma, B., Zhang, K. Z. SPIDER: Software for protein identification from sequence tags with De Novo sequencing error. J Bioinform Comput Biol. 3, (3), 697-716 (2005).
  48. Han, X., He, L., Xin, L., Shan, B., Ma, B. PeaksPTM: Mass spectrometry-based identification of peptides with unspecified modifications. J Proteome Res. 10, (7), 2930-2936 (2011).
  49. Zhang, J., et al. PEAKS DB: de novo sequencing assisted database search for sensitive and accurate peptide identification. Mol Cell Proteomics. 11, (4), 010587 (2012).
  50. Zhang, Z., et al. UV crosslinked mRNA-binding proteins captured from leaf mesophyll protoplasts. Plant Methods. 12, (42), 1-12 (2016).
  51. Zhang, Y., et al. Integrative genome-wide analysis reveals HLP1, a novel RNA-binding protein, regulates plant flowering by targeting alternative polyadenylation. CellRes. 25, (7), 864-876 (2015).
  52. Steen, H., Jensen, O. N. Analysis of protein-nucleic acid interactions by photochemical cross-linking and mass spectrometry. Mass Spec Rev. 21, (3), 163-182 (2002).
  53. Miller, C., et al. Dynamic transcriptome analysis measures rates of mRNA synthesis and decay in yeast. Mol Syst Biol. 7, (458), 1-13 (2011).
  54. Eng, J., McCormack, A. L., Yates, J. R. An approach to correlate tandem mass spectral data of peptides with amino acid sequences in a protein database. J Am Soc Mass Spectrom. 5, (11), 976-989 (1994).
  55. Perkins, D. N., Pappin, D. J. C., Creasy, D. M., Cottrell, J. S. Probability-based protein identification by searching sequence databases using mass spectrometry data. Electrophoresis. 20, (18), 3551-3567 (1999).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics