Author Produced

Desarrollo de un Biosensor de ADN electroquímico para la detección de un patógeno de transmisión alimentaria

Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Se presenta un protocolo para el desarrollo de un biosensor electroquímico de ADN que comprende un electrodo de carbono nanopartículas modificadas, serigrafiados oro, estabilizado con ácido del poliláctico para la detección de Vibrio parahaemolyticus .

Cite this Article

Copy Citation | Download Citations

Nordin, N., Yusof, N. A., Radu, S., Hushiarian, R. Development of an Electrochemical DNA Biosensor to Detect a Foodborne Pathogen. J. Vis. Exp. (136), e56585, doi:10.3791/56585 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Vibrio parahaemolyticus (V. parahaemolyticus) es un patógeno de los alimentos comunes que contribuye a una gran proporción de problemas de salud pública a nivel mundial, que afecten significativamente a la tasa de morbilidad y mortalidad humana. Los métodos convencionales para la detección de V. parahaemolyticus como métodos basados en la cultura, Ensayos inmunológicos y métodos moleculares requieren manejo muestras complicadas y lentas, tediosas y costosas. Recientemente, biosensores han demostrado para ser un método de detección completa y prometedores con las ventajas de la detección rápida, rentabilidad y practicidad. Esta investigación se centra en el desarrollo de un método rápido de detectar V. parahaemolyticus con alta selectividad y sensibilidad usando los principios de hibridación de ADN. En la obra, caracterización de poliláctico sintetizado estabilizado con ácido nanopartículas de oro (AuNPs de PLA) fue alcanzada usando difracción de rayos x (DRX), Espectroscopia ultravioleta-visible (UV-Vis), microscopia electrónica de transmisión (TEM), emisión de campo Microscopía electrónica (FESEM) y voltametría cíclica (CV). También llevamos a cabo pruebas de estabilidad, sensibilidad y reproducibilidad de las AuNPs PLA. Encontramos que el PLA-AuNPs había formado una sólida estructura de nanopartículas estabilizadas en solución acuosa. También observamos que la sensibilidad mejoró como resultado el menor valor de resistencia (Rct) de transferencia de carga y un aumento del área superficial activa (0,41 cm2). El desarrollo de los biosensores de ADN se basó en la modificación de un electrodo serigrafiados de carbono (SPCE) con PLA-AuNPs y utilizando azul de metileno (MB) como el indicador de redox. Se evaluaron los acontecimientos de inmovilización e hibridación por voltametría de pulso diferencial (DPV). Encontramos complementarios, no complementarios, y oligonucleótidos no coincidentes específicamente fueron distinguidos por el biosensor fabricado. También se demostró la detección fiable sensible en estudios de reactividad cruzada contra diversos agentes patógenos transmitidos por los alimentos y en la identificación de V. parahaemolyticus en berberechos frescos.

Introduction

Un tema importante de debate público y científico en los últimos años, la intoxicación alimentaria se asocia fundamentalmente con 3 agentes: microorganismos1y química2parásitos3. Alimentos contaminados pueden causar consecuencias graves para la salud en seres humanos, especialmente en el grupo de mayor riesgo aquellos con sistemas inmunes débiles, los ancianos, mujeres embarazadas, bebés y niños pequeños4. Con más de 1 millón de casos de diarrea aguda que ocurre anualmente en niños menores de 5 años en África, Asia y América Latina, la intoxicación alimentaria es una importante enfermedad global5,6 y la Organización Mundial de la salud ha establecido microorganismos como el más importante colaborador7. Vibrio parahaemolyticus se destaca entre las más reconocidas cepas virulentas. Generalmente se encuentran en ambientes marinos, estuarinos y costeros8, es una bacteria gram negativa, que se activa en entornos de alta sal y causa grave gastroenteritis humana cuando está comido en marinos insuficientemente cocidos, maltratados o crudo productos9. Además, las condiciones médicas existentes en algunas personas hacen propensos a la infección de oído, septicemia o infección de V. parahaemolyticus10de la herida. Los factores de virulencia de V. parahaemolyticus hemolisinas se dividen en dos tipos que contribuyen a la patogénesis de la enfermedad: la hemolisina directa termoestable (TDH) codificadas por los genes tdh y hemolisina relacionada con TDH, codificadas por genes de trh11. Los marcadores de virulencia (genes tdh y trh) de V. parahaemolyticus se encuentran sobre todo en muestras clínicas y no en muestras ambientales.

V. parahaemolyticus posee la capacidad de sobrevivir en un amplio rango de condiciones, responder rápidamente a cambios ambientales12. Su mecanismo de proliferación aumenta su potencial de peligro como su toxicidad aumenta en paralelo con la masa de la celda13. Peor aún, el cambio climático está proporcionando estas bacterias con amplias condiciones para acelerar su célula de crecimiento población14. Debido a su alta frecuencia, V. parahaemolyticus necesita ser monitoreada a lo largo de la cadena alimentaria, particularmente en el comercio y la producción de pescados y mariscos ya que esos productos son donde se encuentran en cantidades enormes de15,16 en todo el mundo. Actualmente se identifican las bacterias y aislados utilizando una variedad de métodos, incluyendo pruebas bioquímicas, enriquecimiento y medios selectivos17, enzima-ligado Inmunomagnética sorbente ensayo (ELISA)18, electroforesis de pulso-campo (PFGE) 19, pruebas de aglutinación de látex y de polimerasa de las pruebas de reacción en cadena (PCR)20. Estos métodos generalmente requieren personal calificado, instrumentos sofisticados y técnicas laboriosas que no proporcionan información sobre la contaminación inmediatamente. Esto limita seriamente la posibilidad de detectar con prontitud contaminación perjudicial y aplicaciones in situ. Herramientas de detección rápida siguen siendo un desafío excepcional.

Biodetección está emergiendo como una opción promisoria para la detección de patógenos alimentarios ya que ofrece un ahorro de tiempo, rentable, práctico y en tiempo real análisis método21,22,23,24 . Sin embargo, aunque ha habido muchos resultados positivos de la detección de analitos en las muestras inoculadas y solución mediante biosensores, todavía hay una falta de investigación aplicada a muestras reales en mezclas acuosas o extractos orgánicos25. Recientemente, biosensores electroquímicos utilizando detección directa y/o indirecta del ácido desoxirribonucléico (ADN) han recibido una atención creciente entre los científicos, debido a su detección específica del objetivo complementario a través de un evento de hibridación26 , 27 , 28 , 29. estos enfoques únicos son más estables en comparación con los biosensores basados en enzimas, ofreciendo así una tecnología prometedora para la miniaturización y comercialización. El objetivo del estudio aquí reportado es construir una herramienta rápida que puede detectar V. parahaemolyticus con alta selectividad, sensibilidad y sentido práctico, basado en la especificidad de secuencia de ADN durante la hibridación. Estrategias de identificación implican la combinación de nanopartículas de oro (AuNPs de PLA) estabilizado con ácido poliláctico30 y electrodos serigrafiados de carbono (SPCEs) en presencia del indicador de hibridación, azul de metileno (MB). El potencial de la construcción de detección desarrollados es explorado utilizando muestras de berberechos frescos y lisado de ADN de las bacterias.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Nota: Todos los reactivos químicos y bioquímicos para ser utilizado deben ser de grado analítico y utilizan sin purificación adicional. Preparar todas las soluciones utilizando agua desionizada estéril. Autoclave de toda la cristalería antes de la esterilización.

PRECAUCIÓN: Utilice todas las prácticas de seguridad apropiadas cuando se realizan actividades de laboratorio, incluyendo el uso de controles (campana, guantera) de ingeniería y equipo de protección personal (gafas, guantes, bata, pantalón largo, cerrados zapatos).

1. fabricación y caracterización de electrodos modificados con PLA-AuNPs

  1. Preparación y caracterización de AuNPs PLA
    1. Rápidamente añadir 10 mL de solución de citrato de sodio (38,8 mM) a 100 mL de solución ácida acuosa de chloroauric (1 mM) de ebullición y enfriar hasta temperatura ambiente. Observar los cambios en el color de la solución preparada de AuNPs que comienza como amarillo, cambios a negruzco y finalmente termina como rojo rubí oscuro.
    2. Los pellets PLA en un molde de acero inoxidable para el proceso de fusión y precaliente a una temperatura de 190 ° C durante 10 minutos sigue con el procedimiento de prensado: ponerlos bajo una presión de 2,2 MPa durante 1 minuto como parte de la preparación de la hoja PLA. La hoja PLA estará lista para su uso después de refrescarse por cerca de 3 horas.
    3. Revolviendo vigorosamente, disolver 0,68 mg de las hojas PLA en 5 mL de cloroformo a temperatura ambiente. El PLA disuelto de la mezcla con 10 mL de la solución previamente preparada de AuNPs y revuélvalo homogéneo a temperatura ambiente. Las mezclas homogéneas se puede denota como PLA-AuNPs y caracterizaron con EDX FESEM, UV-Vis, XRD y TEM.
  2. Preparación y caracterización de electrodos serigrafiados de carbono modificados
    Nota: El SPCE utilizado en este estudio consta de un sistema de tres electrodos: un electrodo de trabajo de carbono y un contraelectrodo y un electrodo de referencia Ag/AgCl.
    1. Rápidamente pipetee 25 μl de la solución homogénea de PLA-AuNPs SPCE y aire secar 24 h antes de su uso.
    2. Electroquímicamente caracterizan los electrodos modificados, SPCE/PLA-AuNPs, en ferro cianuro de potasio (K3[Fe(CN)6]3 -/4 -) para medir el área superficial activa, espectroscopía de impedancia electroquímica, repetibilidad, reproducibilidad y estabilidad de30.

2. desarrollo del Biosensor electroquímico ADN

  1. Preparación de la sonda
    Nota: Las secuencias de la sonda de ssDNA y ADN complementario fueron seleccionadas en base a información del Centro Nacional de base de datos de información de biotecnología (NCBI).
    1. Compra de oligonucleótidos sintéticos (20-mer ssDNA sonda ADN complementario 20-mer, 20-mer Lencería desconjunta ADN y ADN no complementario 21-mer) como polvo liofilizado de laboratorios comerciales, basado en las siguientes secuencias:
      sonda de ssDNA thiolated: 5′ - / D/5ThioMC6-CGGATTATGCAGAAGCACTG - 3′
      ADN complementario: 3′ 5′ - CAGTGCTTCTGCATAATCCG -
      una base ADN no coinciden: 3′ 5′ - CAGTGCTTCTGC ṪTAATCCG -
      3 bases ADN no coinciden: 3′ 5′ - CAGTGCTTCT Ċ ṪṪTAATCCG -
      ADN no complementario: 3′ 5′ - CGCACAAGGCTCGACGGCTGA -
    2. Preparar las soluciones madre de los oligonucleótidos (100 μm) con una estéril solución de TE (10 mM Tris-HCl, 1 mM EDTA, pH 7.5), dividida en porciones analíticas. Conserve este a-4 ° C y luego realizar las diluciones adecuadas justo antes de usar.
  2. Optimización de la inmovilización y la hibridación
    Nota: Un SPCE modificado con PLA-AuNPs, denotado como SPCE-PLA-AuNPs, fue utilizado para este estudio y un método de fundición de gota fue utilizado para la inmovilización de ADN y la hibridación.
    1. En primer lugar, inmovilizar 25 μl de sonda de ssDNA thiolated en las AuNPs/PLA-SPCE y luego aire secará durante 24 h a temperatura ambiente, después de que será denotada por último como SPCE/PLA-AuNPs/ssDNA. Determinar la optimización de la condición de inmovilización mediante tres factores: la concentración de ssDNA (desde 0,2 a 1,4 μm), tiempo (desde 30 hasta 210 min) y temperatura (entre 25 a 75 ° C).
    2. Pipetear 25 μl de ADN complementario en la superficie de SPCE/PLA-AuNPs/ssDNA para llevar a cabo el evento de hibridación después de que puede ser finalmente denotado como SPCE/PLA-AuNPs/dsDNA. Determinar la optimización de las condiciones de hibridación por medio de los dos factores de tiempo (entre 5 y 30 min) y temperatura (entre 25 a 75 ° C).
    3. Sumerja el inmovilizado y electrodos hibridados en el μm 20 MB por 30 minutos Retire el ADN no específicamente adsorbida y MB exceso lavando con 0,5 M ABS/20 mM de NaCl (pH 4.5) y luego enjuagar con agua desionizada. Medida la corriente de pico de MB reducción utilizando la técnica de la DPV. Ejecutar la medida de DPV PBS de 0,1 M (pH 7) que contiene ningún indicador.
  3. Caracterización del biosensor de ADN fabricado
    1. Sumerja la SPCE/PLA-AuNPs en μm 20 MB por 30 min, lavar con ABS M 0,5/20 mM de NaCl (pH 4.5) y luego enjuague con agua desionizada antes de medir. Seguir un procedimiento similar para todas las interacciones, incluyendo la sonda DNA, ADN complementario, ADN no coinciden y no complementarios muestras de ADN.
    2. Medida de la reducción electroquímica.
      Nota: Se evaluó la DPV un Autolab comercialmente manufacturado con software de interfaz.
      Las mediciones de la DPV de la reducción electroquímica de MB en un potencial desde -0,5 V a 0,25 V, con un paso potencial de 0.005 V, amplitud de modulación de 0.05 V y una frecuencia de barrido de 7,73 mVs-1 en PBS de 0,1 M (pH 7), que contiene ningún indicador. La selectividad, sensibilidad, reproducibilidad y estabilidad del biosensor de ADN fabricado al calor fueron más estudiados. Resultados reportados fueron presentados como promedio de las mediciones de valor en tres repeticiones.

3. validación del Biosensor de ADN fabricado con muestras reales

  1. Preparación de las cepas bacterianas
    1. Seleccionar las muestras bacterianas basadas en la contaminación significativa de mariscos31,32 .
      Nota: V. parahaemolyticus como cepas de referencia y 8 otras cepas bacterianas (Campylobacter jejuni, Listeria monocytogenes, Salmonella typhimurium, Salmonella enteritis, Klebsiella neumonía, Escherichia coli O157: H7, Bacillus cereusy Vibrio alginolyticus) de los comunes transmitidas por los alimentos patógeno fueron empleados para la validación de biosensores de ADN electroquímica en este estudio.
    2. Llevar a cabo una subcultura rutinaria de cepas bacterianas en agar de su respectivo cada dos semanas para mantener su viabilidad, consulte la tabla 1 para las condiciones de cultivo.
    3. Mantener la conservación a largo plazo de las cepas bacterianas en sus respectivos caldos creciente que contiene 20% (v/v) de glicerol a-80 ° C como glicerol protege a las bacterias impidiendo la formación de cristales de hielo que pueden dañar durante el proceso de congelación. A continuación, inocular un bucle de la cultura de célula bacteriana conservadas en las poblaciones de glicerol en los respectivos caldos. Incubar los caldos según su respectivo crecimiento tiempo y temperatura cuando la necesidad de reactivar las bacterias.
    4. Determinar la cantidad de V. parahaemolyticus las células usando una placa de difusión técnica33, un estándar y un método bien conocido para la enumeración de microorganismos derivados de una serie de diluciones.
      1. Cultura de V. parahaemolyticus en caldo de soya tripticasa (TSB + 3% NaCl) a 37 ° C en un estado de agitación de 140 rpm. Luego, transfiera 1 mL del cultivo celular de las bacterias en 9 mL de TSB + 3% NaCl para obtener un factor de dilución 10-1 .
    5. Repita este paso nueve veces para obtener toda una serie de hasta 10-10 factor de dilución. A continuación, difunda 0,1 mL de cada factor de dilución (a partir de 10-1 a 10-10) en placa de agar selectivo de Vibrio para Colonia de conteo, respectivamente. Incubar las placas se incubaron a 37 ° C durante 24 h.
    6. Usar un contador de colonias para contar colonias individuales y luego back-calcular (cuenta la cantidad de UFC/pipeta x factor de dilución) para obtener una unidad formadora de colonias por mililitro densidad (UFC mL-1). Derivar la concentración de las colonias formando unidades (UFC) en las suspensiones celulares de las bacterias de la parcela de calibración de UFC mL-1 contra absorbancia.
  2. Preparación de la prueba de PCR
    1. Extracto de ADN genómico siguiendo la hervida los lisis procedimiento34. Primero, raya un individuo bacteriano cepa en medios de agar e inocular en medios de caldo, seguidos por incubación en su condición de crecimiento relativo, una 140 rpm agitación condición.
    2. Pipetear una cultura 1 mL de caldo en un tubo de centrífuga micro. Esto centrifugar a 4830 x g y 4 ° C durante 1 min obtener pellets. Utilice cerca de 500 μl de tampón TE estéril para re-suspensiones de la pelotilla. Mantenga la suspensión resultante por 10 min a 98 ± 2 ° C en un bloque de calefacción y enfriarlas inmediatamente a-18 ° C durante 10 min para lyse las células y liberar el ADN.
    3. Centrifugue el ADN genómico a 4830 x g y 4 ° C por 3 min obtener una suspensión clara y mantener el sobrenadante a-20 ° C para su uso posterior. Utilizar una medida biophotometer con absorción UV a una longitud de onda de 260 nm (como los ácidos nucleicos absorben la longitud de onda de la luz) y también en una longitud de onda de 280 nm (como las proteínas absorben la longitud de onda de la luz) para determinar la concentración y pureza de la extraída extracción de ADN genómico y luego identificar las cepas usando análisis bioquímicos estándar35 y verificarlas por 16S rRNA gene secuencia36. Finalmente, desnaturalizar el ADN genómico a 92 ° C por 2 min y enfriar rápidamente en agua con hielo antes de la aplicación para el biosensor.
    4. Además confirmar la presencia de V. parahaemolyticus mediante PCR para el gen toxR de destino. Realizar este procedimiento en un termociclador con un par de primer (5'-GTCTTCTGACGCAATCGTTG-3' y 5'-ATACGAGTGGTTGCTGTCATG-3'). Optimizar la amplificación de PCR en un volumen total de reacción de 25 μl de agua estéril (15.5 μl), buffer (5 μl), cartilla (1 μl, 10 μm), mezcla de dNTP (1 μl), plantilla de la DNA (2 μL) y Taq ADN polimerasa (0,2 μl, 10 x).
    5. Mezclar bien los componentes y arreglar la amplificación por PCR de la secuencia de destino en un termociclador programado para 30 ciclos de amplificación. En nuestro estudio, cada ciclo consistió en tres pasos reacciones es decir., desnaturalización inicial (94 ° C, 3 min) seguido de 30 ciclos de desnaturalización (94 º C, 1 min), recocido (63 ° C, 1,5 min) y extensión (72 º C, 1,5 min), seguido de la extensión final (72 ° C, min 7).
    6. Determinar los productos amplificados y sus tamaños mediante electroforesis en gel de agarosa al 1.5%. Capturar las imágenes de gel con un sistema de documentación de gel producidos comercialmente.
  3. Preparación de muestras de conchas
    1. Obtener muestras frescas.
      Nota: Nuestros berberechos frescos (Pacífico occidental Anadara granosa) fueron obtenidos del mercado mojado en Serdang, Selangor y con rapidez al laboratorio en una caja del refrigerador del hielo para el análisis. Las muestras se dividen en 2 grupos, a saber, el grupo de tratados y no tratado, asumiendo que los berberechos se cosecharon uniformemente desde el inicio de la cosecha hasta colocarlos en almacenamiento en frío.
    2. Tratamiento previo de berberechos en el grupo tratado por almacenar a-20 ° C durante 24 h, seguido por la exposición a la luz UV a 20 ° C durante 4 horas antes de la extracción de ADN.
      Nota: La temperatura de congelación y la exposición Ultravioleta utilizado para el control grupo de mata o por lo menos limita la acumulación natural V. parahaemolyticus en los berberechos. No aplique un mayor régimen de pasteurización de 70 ° C, de la condición controlada en este estudio se pretende simular la situación real de los berberechos frescos. Mientras tanto, analizar las muestras directamente en el grupo no tratado sin ningún pre-tratamiento tan pronto como llegan en el laboratorio.
    3. Subcultivo de una cepa de V. parahaemolyticus ATCC 17802 en TSB (3% NaCl). Determinar el nivel de células viables en el inóculo mediante placas de las diluciones apropiadas de TSB (3% NaCl) en CA con el fin de obtener un inóculo de 104 UFC mL-1 de V. parahaemolyticus. Lavar cada berberechos en agua destilada y limpiar suciedad antes de usar pinzas estériles en un gabinete de flujo laminar para extraer los tejidos de la cáscara.
    4. Homogeneizar unos 10 g de muestras de tejido de berberechos con un homogeneizador en 90 mL de TSB estéril (3% NaCl) para 60 s. agregar una cantidad conocida de V. parahaemolyticus a 9 mL de caldo de homogeneizado de la muestra para las muestras inoculadas. Utilice las muestras antes como control negativo. Estimar el recuento de V. parahaemolyticus añadió a las muestras de conchas por 0,1 mL de las muestras en CA de la galjanoplastia, y posteriormente, Pipetear 1 mL de las muestras en un tubo de microcentrífuga para ADN de la muestra extracción, para ser utilizado en el biosensor y análisis polimerización en cadena.
    5. Extraer el ADN genómico del V. parahaemolyticus las muestras inoculadas y antes tras un modificado hervida los lisis procedimiento36. Por último, determinar la concentración de ADN y la pureza con la medición del fotómetro de bio de absorción UV a una longitud de onda de 260 nm (como los ácidos nucleicos absorben la longitud de onda de la luz) y también en una longitud de onda de 280 nm (como las proteínas absorben la longitud de onda de la luz).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Formación de AuNPs fue revelada a través del cambio en el color de la solución acuosa con citrato de sodio presente. Esto causó que el color cambie de amarillo claro a un rojo rubí profundo. La generación de AuNPs PLA fue confirmada de los espectros UV-vis (figura 1) donde el crecimiento del pico de resonancia (SPR) de plasmón superficial se encontró a alrededor de 540 nm. La formación y existencia de AuNPs PLA fue indicada en las gamas de longitud de onda 500-600 nm, dependiendo del tamaño de partícula37. Los patrones de DRX de AuNPs y PLA-AuNPs se muestran en la figura 2. Se observaron todos los picos del cristalito en 2θ de 31,7, 38.2, 44.4, 64.7 y 77,7 °. Fueron atribuidos a (100) (111) (200) (220), y (311) planos cristalográficos de oro cubic-FCC (cúbica centrada en la cara) (metal) nanoestructuras (JCPDS archivo Nº-00-004-0783). Las intensidades de pico PLA-AuNPs cristalitos también aumentaron como un pico de difracción más amplio centrado en 31,7 °, lo que implica que las AuNPs fueron encajadas en el PLA y sugiriendo la formación de polifásico nanoestructuras de oro38. Además, los picos de difracción AuNP se indica en la PLA-AuNPs indican que las AuNPs tenía una estructura estable. El tamaño medio de PLA-AuNPs se calculó usando la ecuación de Scherrer (L = kλ/βcosθ), mediante la determinación de la anchura de la reflexión de Bragg (100). De la FWHM y espaciado d (tabla 2), se calculó el tamaño de cristalito de AuNPs PLA 27 nm.

Las dimensiones de las AuNPs PLA y su morfología más fueron investigadas usando TEM. De la curva de distribución de partícula temperatura e imágenes de AuNPs PLA, se ha observado que las nanopartículas de oro eran casi esféricas en forma (figura 3). El tamaño de las nanopartículas estaba en la gama de cerca de 37 nm, ligeramente más grande que obtiene de la fórmula de Scherrer, sugiriendo una naturaleza polycrystalline del como sintetizado nanopartículas39. Menor tamaño por DRX en contraste con la TEM también se ha observado en investigaciones anteriores, probablemente porque la estructura de la partícula es policristalino en la naturaleza debido a la importante cantidad de cristalitos que son más pequeños (partículas secundarias)40 . La figura 4 muestra la imagen FESEM de AuNPs de PLA como preparado en SPCE. Es evidente la FESEM imágenes y espectros EDX que SPCE/PLA-AuNPs tenía el mayor porcentaje de peso de oro, de mayor densidad y mayor superficie de cobertura de nanopartículas. Puede también ser observado, particularmente, que figura 4(a) muestra la imagen FESEM de un SPCE desnudo. La imagen FESEM en la figura 4(b) muestra PLA-AuNPs bien distribuidos. Para afirmar la composición química de la síntesis PLA-AuNPs EDX fue empleado para investigar la composición química de la PLA como producido-AuNPs, según figura 4(a)y 4(b). El espectro EDX confirmó que el PLA-AuNPs producido como fueron compuestos de oro (Au) sólo y no aparece otro elemento excepto el pico correspondiente al carbono (C) y oxígeno (O). La presencia del pico C fue por el electrodo de carbono al que la muestra fue fundido de gota.

El espectro EDX también demostrado la presencia de O indicando que oxígeno fue fijado por adsorción en el electrodo de carbono porque la película se expone al aire. Esto confirma que el oxígeno se adsorbe sobre nanotubos de carbono si se exponen al aire por un tiempo de41. Aunque hay varias moléculas de gas en el aire, oxígeno fue creído para ser el principal adsorbate en los expuestos al aire carbono nanotubos42, posiblemente debido a su absorción más rápida en comparación con otras moléculas43. Esto fue basado en encontrar que el oxígeno era el principal adsorbato en el electrodo de carbono durante la exposición al aire durante la noche en la preparación de la muestra y había reforzado la pureza química de las AuNPs PLA. La relación de pico anódica y catódica (yopa/ipc) fue de casi 1, que dio a potencial constante del pico como la exploración tasa mayor44. Por otra parte, los potenciales de pico anódica y catódica eran constantes a diferentes análisis tasas45 sugiriendo que la reacción electroquímica es reversible basado en separación de pico (figura 5). La superficie activa del electrodo modificado se calculó utilizando la ecuación de Randles Sevick (pc = (2.69 × 105) n3/2 anuncios1/2 Cv1/2. De la pendiente de la parcelapc versus v1/2 en la figura 5(a) y (b), se calculó la superficie de los electrodos como 0,26 cm2 y 0,41 cm2 para el pelado SPCE y PLA-AuNPs, respectivamente. Este resultado confirma que la mejora de AuNPs de PLA en la superficie activa fue relativamente más alto comparada con SPCE desnudo. El resultado derivado fue comparable a la de oro incrustado de polímero nanopartículas (matriz β-CD-EDAS(N-[3-(trimethoxysilyl)propyl]ethylene-diamine encapsulado nanopartículas de oro), que revelaron que una alta superficie activa mejora el proceso de transferencia de electrones y por lo tanto dio lugar a mejor sensibilidad46.

La reacción electroquímica de SPCE modificada en un proceso de difusión controlada, demostrada por una reducción en el K3[Fe(CN)6]3 -/4 - pico de corriente, que a su vez se basó en la corriente de la raíz de cuadrada de frecuencia de exploración (v 1/2). Para obtener una mejor vista de las propiedades del electrodo modificado, se realizó un estudio de impedancia electroquímica (EIS) la espectroscopia para correlacionar con el rendimiento del electrodo modificado presentado en términos de mediciones de la CV. La sección semicircular vista en alta frecuencias correlacionados con el proceso de limitación de la transferencia de electrones en la mia. Se midió la resistencia de transferencia de carga (Rct) directamente como el diámetro del semicírculo. Este resultado se corresponde con el valor de Rct de la SPCE desnudo, que era Ω de 1932 y en la modificación de SPCE/PLA-AuNPs disminuyó a 1444 Ω (figura 6). La disminución del valor dect R de SPCE/PLA-AuNPs pudieron haber resultado de una disminución en la constante dieléctrica local o un incremento en el espesor de la doble eléctrico capa47, sugiriendo eso K3[Fe(CN)6]3 - /4 - función por adsorción en la interfase metal/solución. Estas salidas se conformó con los derivados de las mediciones de la CV (figura 7). Las corrientes de pico aumentaron progresivamente con la modificación de los SPCEs utilizando PLA-AuNPs, que demostró que una mayor sensibilidad fue la inversa de la menor Rct48. Así, el aumento en el valor de CV de los electrodos modificados y la disminución en los valores dect R pueden haber sido debido al reemplazo gradual de las moléculas de agua (el volumen de las moléculas de agua es 27.19 Å3) por la adsorción de K3 [Fe(CN)6] 3 -/4 - en la superficie del metal, disminuyendo el grado de la reacción de disolución49.

Tabla 3 indica la desviación estándar relativa (RSD) de la repetibilidad y la reproducibilidad del electrodo modificado. Grabación de CV rutina de K3[Fe(CN)6]3-4 - fue hecha para que seis juegos consecutivos investigar el repetibilidad de los electrodos modificados. El RSD de SPCE/PLA-AuNPs fue derivado como el 4.26%. El electrodo con modificación de AuNPs PLA dio RSD mejor después de varias mediciones. Por otra parte, utilizando el mismo procedimiento, seis electrodos modificados fueron independientemente fabricados, que dio valores RSD de 4.05% para SPCE-PLA-AuNPs, indicando mejor reproducibilidad de la fabricación de electrodos para AuNPs PLA. El sustrato modificado según PLA-AuNPs se mantuvo a 37 ° C durante un tiempo prolongado. También fue utilizado para el registro de 20 ciclos y una disminución de 18% en la calidad de la señal. Con el fin de lograr el máximo de la salida del biosensor, período de inmovilización, temperatura, junto con concentración de ssDNA y criterios de hibridación fueron examinados. Estas condiciones necesarias para ser optimizado, como influyen en la corriente de pico de la DPV. Para optimizar la concentración de ssDNA, SPCE/PLA-AuNPs se pipetea con diferentes concentraciones (0.2, 0.4, 0.6, 0.8, 1.0, 1.2 y 1.4 μm) de ssDNA de 60 minutos por lo que se determinó la concentración óptima de ssDNA. Basado en la figura 8, la corriente máxima DPV aumenta como altas concentraciones de ADN fueron utilizadas. El estudio también encontró que la concentración optimizada de la DNA ssDNA μm 1,2.

Para optimizar el período de inmovilización con el ADN en PLA/SPCE-AuNPs, 25 μl de ssDNA (1,2 μm) fueron probadas sobre diferentes tiempos (30, 60, 90, 120, 150, 180 y 210 minutos). En la figura 9, los resultados muestran un incremento en el período de inmovilización, lo que resulta en el aumento continuo de la corriente máxima DPV. Así, el tiempo óptimo de inmovilización de la ssDNA fue seleccionado como 180 min. Para optimizar la temperatura de la inmovilización, la SPCE/PLA-AuNPs se pipetea con ssDNA (1,2 μm) en varias temperaturas (75, 65, 55, 45, 35 y 25 ° C) durante 180 minutos. Encontramos que cuando la temperatura de la inmovilización fue aumentada a 55 ° C, la corriente de pico DPV extendió inicialmente seguido por una depreciación posterior (figura 10); así, 55 ° C fue seleccionado como la temperatura de inmovilización optimizado para ser utilizado en posteriores experimentos. Separación de ssDNA de lo inmóvil de las superficies de la incapacidad de electrodo e hibridación fue causada por el aumento de las temperaturas. Ha habido otros informes con resultados similares50. Dividir más rápido y degeneración del ADN de las superficies de nanopartículas de oro se produjeron en mayores temperaturas51. Investigación llevada a cabo recientemente divulgado que el vínculo entre oro y tiol oxida degrada rápidamente y simplemente en una situación ambiental, por ejemplo cuando expuesto a agua, aire y luz52,53,54. El efecto del tiempo de hibridación fue también investigado en este estudio.

La SPCE/PLA-AuNPs/ssDNA fabricado fue fundido a gota con una solución de ADN diana (0,2 μm) en la hibridación diferentes épocas (5, 10, 15, 20, 25 y 30 minutos). La respuesta de la DPV rosa obviamente, con un aumento de 5 minutos en el tiempo de incubación (de 5 a 10 minutos) (figura 11). Una vez que se obtuvo este valor, se observó un patrón descendente de 10 a 30 min. para que el tiempo deseado para la hibridación fue elegido como 10 min. La eficiencia de hibridación aumentó con un aumento de temperatura de 25 ° C a 35 ° C (figura 12). La alta corriente fue vista disminuir lentamente a una temperatura superior a 35 ° C. La razón de esto fue atribuida a la desnaturalización de la estructura de sándwich reduciendo la señal de detección. Por lo tanto, la temperatura de hibridación óptima seleccionada fue de 35 ° C. El proceso que hemos utilizado en la detección de que v. parahaemolyticus compuesto AuNPs para aumentar la superficie activa del electrodo de trabajo, PLA para mediar la modificación superficial y el redox complejo, MB, que redujo a LB. El resultado de este proceso de oxidación fue una mejor afinidad entre ssDNA y MB55. La DPV actual fue disminuida debido al menor número de moléculas MB adjuntos durante la hibridación de ssDNA con su secuencia complementaria.

Llevamos a cabo más investigaciones sobre el funcionamiento del biosensor desarrollado. Los resultados de la DPV en la figura 13 muestran que era capaz de distinguir selectivamente sonda ADN, ADN complementario, ADN no coinciden uno base, 3 bases ADN no coinciden y no complementario DNA en presencia de MB como la detección etiqueta56, 57. la corriente máxima más baja (0,73 μA) fue exhibida por ADN complementario, que aumentaron lentamente una base ADN no coinciden (0.94 μA), tres bases Lencería desconjunta ADN (1.05 μA), ADN no complementarios (3.25 μA) y sonda de DNA (4.79 μA). El ADN diana actual era la más pequeña de todas las corrientes de las secuencias del oligonucleótido permitiendo nuestro biosensor discriminar entre las secuencias de oligonucleótidos, sensible y específica. MB atado fuertemente con ssDNA de inmovilizados sonda ADN produciendo un pico grande de DPV actual. SPCE/PLA-AuNPs/no-ADN complementario reducido el ADN sonda inmovilizados actual casi la mitad como sólo una pequeña cantidad de MB sobre la superficie de SPCE/PLA-AuNPs/dsDNA. Esto es probablemente debido a interacciones inaccesibles entre guanina y bases. Los modos de interacción del ADN y MB son fuertemente dependientes en tales condiciones experimentales como pH, temperatura, concentración de ADN, fuerza iónica y tipo de buffer58,59. MB enlaces comúnmente a dsDNA por surco y modos mediante, resultando en acumulación de MB en dsDNA superficie60. La exposición de nuestra sonda de captura de ADN a ADN no coinciden una base y 3 bases ADN no coinciden consistentemente reduce las corrientes de pico DPV y el ADN complementario objetivo continuó esta tendencia. La tabla 4 muestra el porcentaje de tasa de selectividad para MB máximo actual. Nuestra conclusión general fue que hibridación del biosensor de ADN construido altamente selectivo vía ADN sonda inmovilizada en la superficie de la SPCE/PLA-AuNPs.

La sensibilidad del biosensor de ADN desarrollado fue investigada más a fondo con diferentes concentraciones de oligonucleótido complementario objetivo. Figura 14 muestra el agotamiento gradual de la corriente de pico DPV de MB en el SPCE/PLA-AuNPs como la concentración de ADN complementario aumenta. Figura 15 exhibe un coeficiente de regresión lineal de 0.96 que se generó entre el registro de corriente máxima reducida de MB y el registro de varios concentración de ADN (12:02 a 0,02 mM) Diana. Un gráfico de los cambios corriente de pico (ΔP) fue trazado mediante la fórmula de 3σ/m (σ es la desviación estándar de la solución en blanco y m es la pendiente de la curva lineal)61,62,63. Se calculó el límite de detección del biosensor de ADN fabricado que 16:43 que era mayor que el más pequeño mide muestra. Este resultado fue de acuerdo con el hecho de que ΔP para 12:02 y 14:00 (2,65 × 10-6 A y 2.81 × 10-6 A) con una desviación típica de 1.19 × 10-7 A y 1.06 × 10-7 A, respectivamente, comprometidos.

Para calcular el LOQ para el biosensor de ADN fabricado, utilizamos la fórmula 10σ/m en el que (σ es la desviación de estándar de la solución en blanco y m es la pendiente de la curva lineal) y el resultado ser una ganancia de 14:08. Repetida la desnaturalización de la DNA complementaria se realizó para evaluar el biosensor de ADN en cuanto a su capacidad de regeneración. Hicimos esto incubación complementaria ADN modificado electrodo de 0.2 μm en agua caliente a 86 ° C durante 8 min para desnaturalizar el ADN de doble hebra, seguido de un enfriamiento rápido en un baño de hielo para mantener la desnaturalizada de ADN monocatenario64.

La actividad de hibridación se mantuvo en 91% de la respuesta inicial después de 8 esfuerzos de regeneración (n = 5, RSD = 4.05%). El biosensor de ADN basado en método de SAM para inmovilización de la sonda de ADN a SPCE/PLA-AuNPs era muy estable, logrando una buena respuesta en la detección de ADN complementario después de procesos repetidos de desnaturalización. La estabilidad de nuestro biosensor de ADN sobre calor fue explorada. Para ello, almacena el electrodo PLA-AuNPs/SPCE/ssDNA a temperaturas de 4 ° C, 25 ° C y 45 ° C en una bolsa de aluminio sellada que contienen geles de silicona. Al final de 6 meses, evaluó el ADN complementario y calcula el porcentaje de recuperación de la producción de la señal. Figura 16 muestra que la sonda SPCE/PLA-AuNPs/ssDNA fue altamente estable con más de 80% de la señal inicial todavía recuperable después de almacenaje de 6 meses. La fuerte reacción entre PLA-AuNPs y ssDNA fue encontrada para tener estabilidad a largo plazo a una temperatura inferior a 45 ° C.

Nueve especies diferentes de bacterias (B. cereus, L. monocytogenes, C. jejuni, e. coli O157: H7, V. alginolyticus, S. typhimurium, S. enteritis, neumonía K. y V. parahaemolyticus) fueron defendidos por la detección de PCR. Los productos de amplificación de PCR para la detección específica de V. parahaemolyticus desde la cultura de las bacterias se muestran en la figura 17. El gen toxR de V. parahaemolyticus se utilizó como cartilla PCR para la identificación debido a su presencia en cepas patógenas de V. parahaemolyticus . Desde el análisis PCR, V. parahaemolyticus mostró resultados positivos debido a la especificidad de la cartilla PCR del gen toxR hacia V. parahaemolyticus. No hay productos PCR de otras cepas bacterianas fueron detectados. La DPV corriente máxima obtenida después de una evaluación de la reactividad cruzada demostró muy clara detección de V. parahaemolyticus en comparación con otras especies de bacterias, como se muestra en la figura 18. Disminución de la señal DPV aumentada como el número de pares de bases, debido a la mayor cantidad de moléculas de MB a las sondas. V. parahaemolyticus fueron claramente capaces de ser discriminados de los patógenos de transmisión alimentaria que mímico el ambiente de la muestra de alimento.

Berberechos fueron seleccionados como muestras reales para la validación de biosensores de ADN en este estudio ya que son ingredientes populares en varios tipos de comida local. Es bien sabido que los berberechos crudos llevan a menudo patógeno V. parahaemolyticus y puede transmitir las bacterias a los seres humanos, especialmente si ellos son inadecuadamente refrigerados durante el almacenamiento después de la cosecha65. El grupo tratado de muestras de conchas fue almacenado a-20 ° C durante 24 h y expuesto a la luz UV a 20 ° C durante 4 horas antes de la extracción de ADN durante el paso de tratamiento previo. Figura 19 muestra que el análisis PCR encontró V. parahaemolyticus en las muestras (con picos) tratadas y no tratadas. Esto se muestra en el carril 7, 8, 9, 10, 11 y 12 la correlación con la Colonia cuenta en la discusión anterior. No V. parahaemolyticus aparece en las muestras tratadas y sin tratadas (antes), como se muestra en el carril 1, 2, 3, 4, 5 y 6 en los resultados PCR aunque el recuento de colonias indican su presencia en las muestras. Una razón posible de esto es la presencia de contaminantes metabolitos tales como proteínas en el ADN extraído66.

Figura 20 resume los resultados de detección con el biosensor de ADN desarrollado, que determinó con éxito la presencia de V. parahaemolyticus en el grupo tratado consisten en muestras con picos y antes. Estos resultados se correlacionan positivamente con los resultados PCR previamente discutidos. Todas las muestras de la PCR que mostró resultados positivos fue descubierta usando la técnica de biosensor electroquímico estabilizado de PLA, que se basa en AuNP, y el área de pico DPV correspondió claramente con las bandas de intensidad de polimerización en cadena resultantes (figura 19 y Figura 20). Estos resultados indican que el sensor electroquímico basados en nanopartículas sugerido en este estudio detectó V. parahaemolyticus con éxito en las muestras reales, así demostrando que es superior a la PCR con ningún efecto sobre la autenticidad de los resultados.

Figure 1
Figura 1 : Absorbancia de AuNPs PLA Haga clic aquí para ver una versión más grande de esta figura.

Figure 2
Figura 2 : Espectro de difracción de rayos x de AuNPs PLA. Adaptado con permiso de ref. [30]. Copyright (2016) Sociedade Brasileira de Química. Haga clic aquí para ver una versión más grande de esta figura.

Figure 3
Figura 3 : Distribución de diámetro de frecuencia TEM y las imágenes de AuNPs PLA en una medición de la escala de 50 nm. Reimpreso con permiso de ref. [30]. Copyright (2016) Sociedade Brasileira de Química. Haga clic aquí para ver una versión más grande de esta figura.

Figure 4
Figura 4 : EDX espectros e imágenes FESEM de (a) pelado SPCE y (b) SPCE/PLA-AuNPs. Reimpreso con permiso de ref. [30]. Copyright (2016) Sociedade Brasileira de Química. Haga clic aquí para ver una versión más grande de esta figura.

Figure 5
Figura 5 : La trama de la oxidación actual pico contra la raíz cuadrada de exploración tasa y voltamperogramas cíclicos: (a) pelado SPCE y (b) SPCE/PLA-AuNPs en 1,0 mmol L-1 K3[Fe(CN)6] (pH 7). Las tasas de exploración fueron 300, 250, 200, 150, 100 y 50 mV s1. Adaptado con permiso de ref. [30]. Copyright (2016) Sociedade Brasileira de Química. Haga clic aquí para ver una versión más grande de esta figura.

Figure 6
Figura 6 : Espectros de impedancia de electrodos modificados en 1,0 mmol L-1 K 3 [Fe(CN)6] (pH 7). Amplitud: 5 mV y la gama de frecuencia: 0.1-105 Hz. adaptado con permiso de ref. [22]. Copyright Elsevier (2016). Haga clic aquí para ver una versión más grande de esta figura.

Figure 7
Figura 7 : Corriente pico anódica de electrodos en 1,0 mmol L-1 modificados K 3 [Fe(CN)6] (pH 7) a una velocidad de lectura de 0,1 V s -1 usando la medida de voltametría cíclica Haga clic aquí para ver una versión más grande de esta figura.

Figure 8
Figura 8 : Efecto de la concentración de ssDNA de inmovilización en PLA/SPCE-AuNPs en 0,1 mol L-1 PBS (pH 7) en el análisis las tasas de 0.1 V s -1 después de la incubación de 30 min en μm 20 MB usando voltametría de pulso diferencial Haga clic aquí para ver una versión más grande de esta figura.

Figure 9
Figura 9 : Efecto del tiempo de inmovilización de ssDNA en SPCE/PLA-AuNPs en 0,1 mol L -1 PBS (pH 7) a una velocidad de lectura de 0,1 V s -1 después de la incubación de 30 min en μm 20 MB usando voltametría de pulso diferencial Haga clic aquí para ver una versión más grande de esta figura.

Figure 10
Figura 10 : Efecto de la temperatura de inmovilización de ssDNA en SPCE/PLA-AuNPs a una velocidad de lectura de 0,1 V s -1 en 0,1 mol L -1 PBS (pH 7) después de un período de incubación de 30 min de 20 μm de MB mediante voltametría de pulso diferencial Haga clic aquí para ver una versión más grande de esta figura.

Figure 11
Figura 11 : Efecto del tiempo de hibridación en SPCE/PLA-AuNPs/ssDNA en 0,1 mol L -1 PBS (pH 7) a una velocidad de lectura de 0,1 V s -1 después de la incubación de 30 min en μm 20 MB usando voltametría de pulso diferencial Haga clic aquí para ver una versión más grande de esta figura.

Figure 12
Figura 12 : Efecto de la temperatura de hibridación de SPCE/PLA-AuNPs/ssDNA en 0,1 mol L -1 PBS (pH 7) a una velocidad de lectura de 0,1 V s -1 después de la incubación de 30 min en μm 20 MB usando voltametría de pulso diferencial. Reimpreso con permiso de ref. [22]. Copyright Elsevier (2016). Haga clic aquí para ver una versión más grande de esta figura.

Figure 13
Figura 13 : Histograma del pico de reducción MB actual utilizando diferentes tipos de ADN en 0,1 mol L 1 PBS (pH 7) a una velocidad de lectura de 0,1 V s -1 después de la incubación de 30 min en μm 20 MB. El recuadro muestra voltagramas de pulso diferencial en las mismas condiciones. Reimpreso con permiso de ref. [22]. Copyright Elsevier (2016). Haga clic aquí para ver una versión más grande de esta figura.

Figure 14
Figura 14 : Histograma del pico de reducción MB actual utilizando diferentes concentración de ADN en 0,1 mol L 1 PBS (pH 7) a una velocidad de lectura de 0,1 V s -1 después de la incubación de 30 min en μm 20 MB usando voltametría de pulso diferencial. Reimpreso con permiso de ref. [22]. Copyright Elsevier (2016). Haga clic aquí para ver una versión más grande de esta figura.

Figure 15
Figura 15 : Una trama lineal de la reducción de pico actual de MB contra el registro de la concentración de ADN diferentes en 0,1 mol L -1 PBS (pH 7) a una velocidad de lectura de 0,1 V s -1 después de la incubación de 30 min en μm 20 MB usando voltametría de pulso diferencial. Reimpreso con permiso de ref. [22]. Copyright Elsevier (2016). Haga clic aquí para ver una versión más grande de esta figura.

Figure 16
Figura 16 : Efecto de las temperaturas de hibridación diferentes en SPCE/PLA-AuNPs/ssDNA a los 6 meses de intervalo de almacenamiento (n = 3). Las medidas fueron hechas en 0,1 mol L-1 PBS (pH 7) a una velocidad de lectura de 0,1 V s-1 después de la incubación de 30 min en μm 20 MB usando voltametría de pulso diferencial. Reimpreso con permiso de ref. [22]. Copyright Elsevier (2016). Haga clic aquí para ver una versión más grande de esta figura.

Figure 17
Figura 17 : Amplificación de PCR de electroforesis de gel de agarosa usando productos de secuenciación 16S rRNA gene de las bacterias de cultivo de bacterias. Carril M: escalera de DNA de 1 kb, C− Lane: control (agua destilada estéril), c + carril negativo: control positivo (ADN extraído de e. coli se utiliza como plantilla), Lane CE: e. coli O157: H7, Lane CJ: jejuni de la C. , Carril de la a. C.: B. cereus, Lane KP: neumonía K., Lane ST: S. typhimurium, Lane LM: L. monocytogenes, Lane SE: enteritis por S., VP de Lane: V. parahaemolyticus y Lane VV: V. alginolyticus haga clic aquí para ver una versión más grande de esta figura.

Figure 18
Figura 18 : Histograma del pico de reducción MB actual para el estudio de la reactividad cruzada de los biosensores de ADN contra diversos agentes patógenos de transmisión alimentaria en 0,1 mol L -1 PBS (pH 7) a una velocidad de lectura de 0,1 V s -1 después de la incubación de 30 min en μm 20 MB usando voltametría de pulso diferencial. Reimpreso con permiso de ref. [23]. Copyright Springer (2017). Haga clic aquí para ver una versión más grande de esta figura.

Figure 19
Figura 19 : Productos de amplificación de PCR electroforesis agarosa gel de V. parahaemolyticus de muestras de berberechos frescos. Carril M: 2ul de 100 escalera de DNA de bp, carriles 1-3: sin tratar antes las muestras, carril 4-6: tratados antes muestras, carril 7-9: no se trata de muestras con picos, Lane 10-12: Tratado muestras inoculadas, Lane c +: control positivo (V. parahaemolyticus ATCC 17802 de ), Carril C-: control (agua destilada estéril) negativo. Reimpreso con permiso de ref. [23]. Copyright Springer (2017). Haga clic aquí para ver una versión más grande de esta figura.

Figure 20
Figura 20 : Histograma del actual para la detección de pico de reducción de MB V. parahaemolyticus en muestras de berberechos frescos con el biosensor de ADN en 0,1 mol L-1 de PBS (pH 7) a una velocidad de lectura de 0,1 V s-1 después de la incubación de 30 min en μm 20 MB usando voltametría de pulso diferencial. Reimpreso con permiso de ref. [23]. Copyright Springer (2017). Haga clic aquí para ver una versión más grande de esta figura.

Composición del electrodo Tiempo de incubación (h) Temperatura (° C) Medios de cultivo
Campylobacter jejuni 48 42 BA / BB
Listeria monocytogenes 48 30 TSA / TSB
Salmonella typhimurium 24 37 TSA / TSB
Salmonella enteritidis 24 37 TSA / TSB
Klebsiella pneumoniae 24 37 EMBA / TSB
Escherichia coli O157: H7 24 37 MA / TSB
Bacilo cirio 24 37 MYPA / TSB
Vibrio alginolyticus 24 37 TSA + 3% NaCl/TSB+3% NaCl
Vibrio parahemolítico 24 37 CA/TSA+3% NaCl/TSB+3% NaCl

Tabla 1: Condiciones de bacterias seleccionadas de la cultura.

Muestra Pos [° 2.] FWHM [° 2.] d-spacing [Å] Tamaño de cristalito (nm)
PLA-AuNPs 31.682 0.3149 2.8243 27

Tabla 2: El tamaño de los cristalitos PLA-AuNP. Adaptado con permiso de ref. [30]. Copyright (2016) Sociedade Brasileira de Química.

Electrodos modificados % RSD (n = 6) Reducción de la señal (%) (n = 20)
Capacidad de repetición Reproducibilidad
SPCE/PLA-AuNPs 4.26 4.05 18

Tabla 3: propiedades de los electrodos modificados relativos a modificación de AuNPs y PLA-AuNPs en K 3 [Fe(CN)6] con 1,0 mmol L -1 concentración en una velocidad de lectura de 0,1 V s -1 . Adaptado con permiso de ref. [30]. Copyright (2016) Sociedade Brasileira de Química.

Composición del electrodo yopa (μA) Epa Índice de selectividad (%)
(n = 3) (V)
SPCE PLA-AuNP/punta de prueba ADN 4.79 ± 0.10 -0,46 -
SPCE/PLA-AuNP/no-ADN complementario 3.25 ± 0,12 -0.44 67.85
SPCE/PLA-AuNP/3-bases de ADN no coinciden 1.05 ± 0.11 -0.45 21.92
SPCE PLA-AuNP/1-base del ADN no coinciden 0.94 ± 0,12 -0,46 19.62
DNA SPCE/PLA-AuNP/complementaria 0,73 ± 0.10 -0.45 15.24

Tabla 4: selectividad de la DPV de MB máximo actual en 0,1 mol L -1 PBS (pH 7) a una velocidad de lectura de 0,1 V s -1 después de la incubación de 30 min en μm 20 MB

Composición de los electrodos Método de detección Rango lineal (M) Límite de detección (M) Referencias
AuNPs 3D DPV 1,5 × 10-6 - 7.0 × 10-9 2.0 × 10-10 69
(+) AuNPs DPV 1.0 × 10-9 - 1,5 × 10-12 2.6 × 10-12 70
AuNPs/GR DPV 1.3 × 10-9 - 2.5 × 10-11 8.3 × 10-12 71
AuNPs-ADH-GSs DPV 5.0 × 10-8 - 3.0 × 10-13  3.0 × 10-13 72
AuNPs MPTS DPV 5.0 × 10-9 - 1.0 × 10-11  5.0 × 10-11 73
AuNPs – ir DPV 1.0 × 10-9 - 1.0 × 10-14 3.5 × 10-15 74
CoS / AuNPs DPV 1.0 × 10-9 - 1.0 × 10-12 7.0 × 10-13 75
PLA-AuNPs DPV 2.0 × 10-8 - 2.0 × 10-13 5.3 × 10-12 Este trabajo

Tabla 5: Comparación de algunas de las recientemente desarrollado nanosensores de ADN electroquímico. Reimpreso con permiso de ref. [22]. Copyright Elsevier (2016).

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Los pasos críticos en un marco para el desarrollo exitoso de este tipo de biosensor electroquímico son selección de elementos de reconocimiento biológico apropiado para el transductor (ácido nucleico o ADN aquí); enfoque de química para la construcción de la capa de detección del transductor; material de transducción de señales; optimización de inmovilización del DNA e hibridación; y validación del biosensor desarrollado con muestras reales.

Base para el desarrollo de un biosensor electroquímico sensible y selectivo de la ADN, es la optimización de la condición de inmovilización y la hibridación. En este trabajo, utilizamos MB como el complejo redox. Hay varios principios de las interacciones DNA MB: (i) por interacción electrostática de la carga catiónica de MB con la carga aniónica de la columna vertebral fosfato de ssDNA y dsDNA; (ii) por intercalación de MB a través de la inserción exitosa de MB entre alternando pares de bases de G-C en dsDNA; (iii) por enlace covalente al extremo de la ssDNA de blanco, que produce una densidad de etiqueta bajo (uno o dos MB moléculas por filamento de la DNA); y (iv) por las interacciones de MB con una guanina base en ssDNA. Aplicamos el principio cuarto, que identifique con exactitud V. parahaemolyticus de Cruz reactividad de bacterias y de berberechos frescos. Después de la oxidación de particular interés, había una afinidad más fuerte entre MB y ssDNA. Hibridación de ssDNA con su secuencia complementaria sustituye las moléculas de MB de servidumbre y así reduce la señal.

La serie de resultados experimentales presentado arriba se centra en el desarrollo de un método rápido de detectar V. parahaemolyticus con alta selectividad y sensibilidad usando los principios de hibridación de ADN. El primer paso es la síntesis y caracterización de poliláctico estabilizado con ácido nanopartículas de oro (AuNPs de PLA) para la modificación del electrodo (figuras 1-6 y tabla 2). Se evaluó la calidad de las nanopartículas de oro mediante Espectroscopia ultravioleta-visible (UV-Vis), difracción de rayos x (DRX), microscopía electrónica de análisis de emisión de campo (FESEM), microscopia electrónica de transmisión (TEM), voltametría cíclica (CV) y Análisis de la impedancia. La segunda parte del desarrollo implicó una caracterización electroquímica del electrodo modificado (figuras 7-12 y tabla 3-4) lo que determina el mejoramiento exitoso del electrodo modificado en relación con el electrodo desnudo en condiciones de detectar el evento de hibridación.

El tercer paso del desarrollo de biosensores de ADN basado en se basó en la optimización de las condiciones experimentales de los eventos de hibridación y la aplicación de los biosensores desarrollados para la detección del patógeno real (figuras 13-20). El evento de hibridación que determina el éxito de la detección del patógeno se evaluó mediante voltametría de pulso diferencial (DPV). La existencia positiva del patógeno específico fue indicada a través de la reducción de la corriente. La sensibilidad del biosensor desarrollado se evaluó a través de la construcción de un diagrama de calibración y el cálculo de LOD (figura 15). El biosensor fabricado fue capaz de distinguir específicamente V. parahaemolyticus de otros patógenos basados en los diferentes niveles de reducción actual (figuras 17 y 18). La evaluación de la viabilidad de los biosensores desarrollados para detección de V. parahaemolyticus en muestras de comida se presenta en las figuras 19 y 20 y la existencia positiva del patógeno específico se indica por la reducción de la corriente . El desarrollo de biosensores basados en ADN es altamente dependiente en la selección de sonda de ADN, mejora del electrodo modificado, así como la optimización de las condiciones experimentales. La sonda de ADN aquí ha sido adaptada de la obra anterior de Nakano67. Mejora de los electrodos modificados se realizó mediante el uso de nanopartículas de oro estabilizadas con ácido poliláctico para permitir la normalización de la nanosize. La función de nanopartículas de oro como electro material catalítico68 y actuar para aumentar la tasa de transferencia del electrón y también proporcionan una superficie en la que para la fijación de la sonda de ADN. Se optimizaron los parámetros experimentales en términos de tiempo de incubación y la temperatura es muy importante para ADN a formar dos caras. La temperatura de hibridación afecta a la separación entre la adsorción no específica y este aumenta la selectividad del sensor. Tiempo de incubación de la hibridación aumenta las posibilidades de la formación del duplex. El procedimiento de inmovilización debe ser optimizado para asegurarse de que la sonda de ADN estará en adecuada orientación para la formación de dos caras a la forma.

Tabla 5 compara una muestra de recientemente desarrollado electroquímico ADN biosensores69,70,71,72,73,74,75 ,. Biosensores basados en ADN es un método prometedor para la sustitución de técnicas moleculares en base aunque hay algunas limitaciones que deben ser abordados antes de que el método puede ser lo suficientemente portátil para uso en el sitio. La principal limitación es la extracción de ADN de los procesamiento de la muestra como la pureza y la cantidad de ADN extraído en el sitio no es probable que sea tan buena como la extraídos por el método estándar de laboratorio-basado. Es, sin embargo, una alternativa promisoria si el PCR y gel electroforesis pueden reemplazarse con sistema de pretratamiento de muestras como microfluidos.

Biosensores basados en ADN son potencialmente útiles para muchas aplicaciones incluyendo el diagnóstico médico, vigilancia ambiental y control de alimentos. Esta técnica permitirá el monitoreo en línea de procesos de control de calidad como punto de atención, seguimiento de los pacientes. La portabilidad del sistema sensor entero permitirá la descentralización de los procesos diagnóstico donde el consumidor puede utilizar el sistema de detección en la comodidad de su hogar.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores no tienen nada que revelar.

Acknowledgments

Los autores desean reconocer el apoyo de Universiti Putra Malasia.

Materials

Name Company Catalog Number Comments
Acetic acid Merck 100056
Chloroform Merck 102445
Diaminoethane tetraacetic acid Promega E5134
Dibasic sodium phosphate  Sigma-Aldrich S9763
Disodium hydrogen phosphate Sigma-Aldrich 255793
Ethanol  Sigma-Aldrich 16368
Gold (III) chloride trihydrate Sigma-Aldrich 520918
Hydrochloric acid Merck 100317
Methylene blue Sigma-Aldrich M44907
Monobasic sodium phosphate, monohydrate Sigma-Aldrich S3522
Phosphate-buffered saline Sigma-Aldrich P5119
Poly(lactic acid) resin, commercial grade 4042D NatureWorks 4042D
Potassium chloride R&M Chemicals 59435
Potassium dihydrogen phosphate Sigma-Aldrich P9791
Potassium hexacyanoferrate III R&M Chemicals 208019
Sodium acetate anhydrous salt Sigma-Aldrich S2889
Sodium chloride Sigma-Aldrich S9888
Trisodium citrate Sigma-Aldrich S1804
Tris(hydroxymethyl) aminomethane Fisher Scientific T395-100
Tris-Base Fisher Scientific BP152-500
2X PCR Master Mix with Dual-Dye Norgen Biotek 28240
Agarose gel Merck 101236
Bolton Agar Merck 100079
Bolton Broth Merck 100079
CHROMagar Vibrio CHROMagar VB910
dNTPs Promega U1511
Nuclease-free water Thermo Scientific R0581
Eosin methylene blue agar  Merck 101347
GelRed Biotium 41001
Glycerol Merck 104092
Go Taq Buffer Promega M7911
Loading dye 100 bp DNA ladder Promega G2101
Loading dye 1kb DNA ladder Promega G5711
Magnesium chloride Promega 91176
Mannitol egg yolk polymyxin agar Merck 105267
McConkey Agar Merck 105465
Nutrient Broth Merck 105443
Taq polymerase Merck 71003
Trypticase Soy Broth Merck 105459
Trypticase Soy Agar Merck 105458

DOWNLOAD MATERIALS LIST

References

  1. Gould, L. H., Rosenblum, I., Nicholas, D., Phan, Q., Jones, T. F. Contributing factors in restaurant-associated foodborne disease outbreaks, FoodNet sites, 2006 and 2007. Journal of Food Protection. 76, 1824-1828 (2013).
  2. Arvanitoyannis, I. S., Kotsanopoulos, K. V., Papadopoulou, A. Rapid detection of chemical hazards (toxins, dioxins, and PCBs) in seafood. Critical Reviews in Food Science and Nutrition. 54, 1473-1528 (2014).
  3. Robertson, L. J., Sprong, H., Ortega, Y. R., van der Giessen, J. W. B., Fayer, R. Impacts of globalisation on foodborne parasites. Trends in Parasitology. 30, 37-52 (2014).
  4. Sandilands, E. A., Bateman, D. N. The epidemiology of poisoning. Medicine. 44, 76-79 (2016).
  5. Boschi-Pinto, C., Velebit, L., Shibuya, K. Estimating child mortality due to diarrhoea in developing countries. Bulletin of the World Health Organization. 86, 710-717 (2008).
  6. Farthing, M. J. G. Diarrhoea: A Significant Worldwide Problem. International Journal of Antimicrobial Agents. 14, 65-69 (2000).
  7. World Health Organization. WHO estimates of the global burden of foodborne diseases: foodborne disease burden epidemiology reference group 2007-2015. 1-255 (2015).
  8. Yeung, M., Boor, K. Epidemiology, pathogenesis, and prevention of foodborne Vibrio parahaemolyticus infections. Foodborne Pathogens and Disease. 1, 74-88 (2004).
  9. Sakazaki, R. Foodborne Diseases. Cliver, D. O., Riemann, H. P. Academic Press. 127-136 (2002).
  10. Grochowsky, J., Odom, S. R., Akuthota, P., Stead, W. Primary Septicemia and Abdominal Compartment Syndrome From Vibrio parahaemolyticus Infection in a 40-Year-Old Patient With No Known Immunocompromise. Infectious Disease in Clinical Practice. 22, (2013).
  11. Raghunath, P. Roles of thermostable direct hemolysin (TDH) and TDH-related hemolysin (TRH) in Vibrio parahaemolyticus. Frontiers in Microbiology. 5, 805 (2014).
  12. Kalburge, S. S., Whitaker, W. B., Boyd, E. F. High-Salt Preadaptation of Vibrio parahaemolyticus Enhances Survival in Response to Lethal Environmental Stresses. Journal of Food Protection. 77, 246-253 (2014).
  13. Esteves, K., Hervio-Heath, D., Mosser, T., Rodier, C., Tournoud, M. G., Jumas-Bilak, E., Colwell, R. R., Monfort, P. Rapid proliferation of Vibrio parahaemolyticus, Vibrio vulnificus, and Vibrio cholerae during freshwater flash floods in French Mediterranean Coastal lagoons. Applied and Environmental Microbiology. 81, 7600-7609 (2015).
  14. Khandeparker, L., Anil, A. C., Naik, S. D., Gaonkar, C. C. Daily variations in pathogenic bacterial populations in a monsoon influenced tropical environment. Marine Pollution Bulletin. 96, 337-343 (2015).
  15. Caburlotto, G., Suffredini, E., Toson, M., Fasolato, L., Antonetti, P., Zambon, M., Manfrin, A. Occurrence and molecular characterization of Vibrio parahaemolyticus in crustaceans commercialised in Venice area, Italy. International Journal of Food Microbiology. 220, 39-49 (2016).
  16. Wong, H. C., Chen, M. C., Liu, S. H., Liu, D. P. Incidence of highly genetically diversified Vibrio parahaemolyticus in seafood imported from Asian countries. International Journal of Food Microbiology. 52, 181-188 (1999).
  17. Rosec, J. P., Causse, V., Cruz, B., Rauzier, J., Carnat, L. The international standard ISO/TS 21872-1 to study the occurence of total and pathogenic Vibrio parahaemolyticus and Vibrio cholerae in seafood: ITS improvement by use of a chromogenic medium and PCR. International Journal of Food Microbiology. 157, 189-194 (2012).
  18. Maniyankode, R. A., Kingston, J. J., Murali, H. S., Batra, H. V. Specific identification of vibrio parahaemolyticus employing monoclonal antibody based immunoassay. International Journal of Pharmacy and Biological Sciences. 4, (2), B156-B164 (2013).
  19. Suffredini, E., Lopez-Joven, C., Maddalena, L., Croci, L., Roque, A. Pulsed-field gel electrophoresis and PCR characterization of environmental Vibrio parahaemolyticus strains of different origins. Applied and Environmental Microbiology. 77, 6301-6304 (2011).
  20. Bhattacharyya, N., Hou, A. A pentaplex PCR assay for detection and characterization of Vibrio vulnificus and Vibrio parahaemolyticus isolates. Letters in Applied Microbiology. 57, 233-240 (2013).
  21. da Silva, E. T. S. G., et al. Electrochemical Biosensors in Point-of-Care Devices: Recent Advances and Future Trends. ChemElectroChem. 4, (4), 778-794 (2017).
  22. Nordin, N., Yusof, N. A., Abdullah, J., Radu, S., Hushiarian, R. Sensitive detection of multiple pathogens using a single DNA probe. Biosensors and Bioelectronics. 86, 398-405 (2016).
  23. Nordin, N., Yusof, N. A., Abdullah, J., Radu, S., Hushiarian, R. A simple, portable, electrochemical biosensor to screen shellfish for Vibrio parahaemolyticus. AMB Express. 7, (1), 41 (2017).
  24. Zhang, J., Li, Z., Zhang, H., Wang, J., Liu, Y., Chen, G. Rapid detection of several foodborne pathogens by F0F1-ATPase molecular motor biosensor. Journal of Microbiological Methods. 93, 37-41 (2013).
  25. Barsan, M. M., Ghica, E. M., Brett, C. M. A. Portable biosensing of food toxicants and environmental pollutants. Nikolelis, D. P., Varzakas , T., Erdem, A., Nikoleli, G. P. CRC Press, Taylor & Francis Group. Boca Raton. 33-69 (2014).
  26. Kwun, J., Yun, S., Park, L., Lee, J. H. Development of 1,1'-oxalyldiimidazole chemiluminescent biosensor using the combination of graphene oxide and hairpin aptamer and its application. Talanta. 119, 262-267 (2014).
  27. Thavanathan, J., Huang, N. M., Thong, K. L. Colorimetric biosensing of targeted gene sequence using dual nanoparticle platforms. International Journal of Nanomedicine. 10, 2711-2722 (2015).
  28. Hushiarian, R., Yusof, N. A., Abdullah, A. H., Ahmad, S. A. A., Dutse, S. W. Facilitating the indirect detection of genomic DNA in an electrochemical DNA biosensor using magnetic nanoparticles and DNA ligase. Analytical Chemistry Research. 6, 17-25 (2015).
  29. Dutse, S. W., Yusof, N. A., Ahmad, H., Hussein, M. Z., Zainal, Z., Hushiarian, R., Hajian, R. An Electrochemical Biosensor for the Determination of Ganoderma boninense Pathogen Based on a Novel Modified Gold Nanocomposite Film Electrode. Analytical Letters. 47, (5), 819-832 (2014).
  30. Nordin, N., Yusof, N. A., Abdullah, J., Radu, S., Hajian, R. Characterization of Polylactide-Stabilized Gold Nanoparticles and Its Application in the Fabrication of Electrochemical DNA Biosensors. Journal of the Brazilian Chemical Society. 27, (9), 1679-1686 (2016).
  31. Vongkamjan, K., Wang, S., Moreno Switt, A. I. Rapid detection of foodborne bacterial pathogens in seafood. Handbook of Seafood: Quality and Safety Maintenance and Applications. 247-257 (2016).
  32. Wang, F., Jiang, L., Yang, Q., Han, F., Chen, S., Pu, S., Vance, A., Ge, B. Prevalence and antimicrobial susceptibility of major foodborne pathogens in imported seafood. Journal of Food Protection. 74, (9), 1451-1461 (2011).
  33. Szermer-Olearnik, B., Sochocka, M., Zwolinska, K., Ciekot, J., Czarny, A., Szydzik, J., Kowalski, K., Boratynski, J. Comparison of microbiological and physicochemical methods for enumeration of microorganisms. Postepy Higieny i Medycyny Doswiadczalnej. 68, 1392-1396 (2014).
  34. Ivanov, I. G., Bachvarov, D. R. Determination of plasmid copy number by the "boiling" method. Analytical Biochemistry. 165, (1), 137-141 (1987).
  35. Gopireddy, V. R. Biochemical tests for the identification of bacteria. International Journal of Pharmacy and Technology. 3, (4), 1536-1555 (2011).
  36. Böhme, K., Fernández-No, I. C., Pazos, M., Gallardo, J. M., Barros-Velázquez, J., Cañas, B., Calo-Mata, P. Identification and classification of seafood-borne pathogenic and spoilage bacteria: 16S rRNA sequencing versus MALDI-TOF MS fingerprinting. Electrophoresis. 34, (6), 877-887 (2013).
  37. Seoudi, R., Fouda, A. A., Elmenshawy, D. A. Synthesis, characterization and vibrational spectroscopic studies of different particle size of gold nanoparticle capped with polyvinylpyrrolidone. Physica B: Condensed Matter. 405, 906-911 (2010).
  38. Mishra, A., Harper, S., Yun, S. I. Interaction of biosynthesized gold nanoparticles with genomic DNA isolated from E. coli and S. aureus. Nanotechnology (IEEE-NANO). 1745-1750 (2011).
  39. Sugimoto, T. Formation of modoispersed nano- and micro-particles controlled in size, shape, and internal structure. Chemical Engineering and Technology. 26, 313-321 (2003).
  40. Rath, C., Sahu, K. K., Kulkarni, S. D., Anand, S., Date, S. K., Das, R. P., Mishra, N. C. Microstructure-dependent coercivity in monodispersed hematite particles. Applied Physics Letters. 75, 4171-4173 (1999).
  41. Abbas, M., Wu, Z. Y., Zhong, J., Ibrahim, K., Fiori, A., Orlanducci, S., Sessa, V., Terranova, M. L., Davoli, I. X-ray absorption and photoelectron spectroscopy studies on graphite and single-walled carbon nanotubes: Oxygen effect. Applied Physics Letters. 87, (5), 051923 (2005).
  42. Lim, S. C., Choi, Y. C., Jeong, H. J., Shin, Y. M., An, K. H., Bae, D. J., Lee, Y. H., Lee, N. S., Kim, J. M. Effect of gas exposure on field emission properties of carbon nanotubes arrays. Advanced Materials. 13, 1563-1567 (2001).
  43. Kim, B. H., Kim, B. R., Seo, Y. G. A study on adsorption equilibrium for oxygen and nitrogen into carbon nanotubes. Adsorption. 11, 207-212 (2005).
  44. Bard, A. J., Faulkner, L. R. Electrochemical methods: Fundamentals and applications. John Wiley & Sons Inc. (2000).
  45. Tan, Q., Wang, L., Ma, L., Yu, H., Ding, J., Liu, Q., Xiao, A., Ren, G. Study on anion electrochemical recognition based on a novel ferrocenyl compound with multiple binding sites. Journal of Physical Chemistry B. 112, 11171-11176 (2008).
  46. Manivannan, S., Ramaraj, R. Polymer-embedded gold and gold/silver nanoparticle-modified electrodes and their applications in catalysis and sensors. Pure and Applied Chemistry. 83, 2041-2053 (2011).
  47. Benali, O., Larabi, L., Traisnel, M., Gengembre, L., Hareka, Y. Electrochemical, theoretical and XPS studies of 2-mercapto-1-methylimidazole adsorption on carbon steel in 1 M HClO4. Applied Surface Science. 253, 6130-6139 (2007).
  48. Shi, Y., Wen, L., Li, F., Cheng, H. M. Nanosized Li4Ti5O12/graphene hybrid materials with low polarization for high rate lithium ion batteries. Journal of Power Sources. 196, 8610-8617 (2011).
  49. Bentiss, F., Traisnel, M., Lagrenee, M. The substituted 1,3,4-oxadiazoles: a new class of corrosion inhibitors of mild steel in acidic media. Corrosion Science. 42, 127-146 (2000).
  50. Wang, M., Gong, W., Meng, Q., Zhang, Y. Electrochemical DNA impedance biosensor for the detection of DNA hybridization with polymeric film, single walled carbon nanotubes modified glassy carbon electrode. Russian Journal of Electrochemistry. 47, 1368-1373 (2011).
  51. Herdt, A. R., Drawz, S. M., Kang, Y., Taton, T. A. DNA dissociation and degradation at gold nanoparticle surfaces. Colloids and Surfaces B: Biointerfaces. 51, (2), 130-139 (2006).
  52. Bhatt, N., Huang, P. J. J., Dave, N., Liu, J. Dissociation and degradation of thiol-modified DNA on gold nanoparticles in aqueous and organic solvents. Langmuir. 27, 6132-6137 (2011).
  53. Liu, X., Jang, C. H., Zheng, F., Jürgensen, A., Denlinger, J. D., Dickson, K. A., Raines, R. T., Abbott, N. L., Himpsel, F. J. Characterization of protein immobilisation at silver surfaces by near edge X-ray absorption fine structure spectroscopy. Langmuir. 22, 7719-7725 (2006).
  54. Willey, T. M., Andrew, L., Vance, T., Buuren, V., Bostedt, C., Terminello, L. J., Fadley, C. S. Rapid degradation of alkanethiol-based self-assembled monolayers on gold in ambient laboratory conditions. Surface Science. 576, (1), 188-196 (2005).
  55. Farjami, E., Clima, L., Gothelf, K., Ferapontova, E. E. DNA interactions with a Methylene Blue redox indicator depend on the DNA length and are sequence specific. Analyst. 135, 1443-1448 (2010).
  56. Lin, X., Ni, Y., Kokot, S. An electrochemical DNA-sensor developed with the use of methylene blue as a redox indicator for the detection of DNA damage induced by endocrine-disrupting compounds. Analytica Chimica Acta. 867, 29-37 (2015).
  57. Zhang, F. T., Nie, J., Zhang, D. W., Chen, J. T., Zhou, Y. L., Zhang, X. X. Methylene Blue as a G-Quadruplex Binding Probe for Label-Free Homogeneous Electrochemical Biosensing. Analytical Chemistry. 86, 9489-9495 (2014).
  58. Ning, L., Li, X., Yang, D., Miao, P., Ye, Z., Li, G. Measurement of Intracellular pH Changes Based on DNA-Templated Capsid Protein Nanotubes. Analytical Chemistry. 86, 8042-8047 (2014).
  59. Sani, N. D. M., Heng, L. Y., Surif, S., Lazim, A. M., et al. AIP Conference Proceedings. Murad, A., et al. 1571, 636-640 (2013).
  60. Xu, P., Wang, J., Xu, Y., Chu, H., Shen, H., Zhang, D., Zhao, M., Liu, J., Li, G. Binding modes and interaction mechanism between different base pairs and methylene blue trihydrate: a quantum mechanics study. Advances in Experimental Medicine and Biology. 827, 187-203 (2015).
  61. Guo, Y., Chen, J., Chen, G. A label-free electrochemical biosensor for detection of HIV related gene based on interaction between DNA and protein. Sensors & Actuators, B: Chemical. 184, 113-117 (2013).
  62. Huang, K. J., Liu, Y. J., Wang, H. B., Wang, Y. Y., Liu, Y. M. Sub-femtomolar DNA detection based on layered molybdenum disulfide/multi-walled carbon nanotube composites, au nanoparticle and enzyme multiple signal amplification. Biosensors and Bioelectronics. 55, 195-202 (2014).
  63. Kong, R. M., Song, Z. L., Meng, H. M., Zhang, X. B., Shen, G. L., Yu, R. Q. A label-free electrochemical biosensor for highly sensitive and selective detection of DNA via a dual-amplified strategy. Biosensors and Bioelectronics. 54, 442-447 (2014).
  64. Rashid, J. I. A., Yusof, N. A., Abdullah, J., Hashim, U., Hajian, R. Novel Disposable Biosensor Based on SiNWs/AuNPs Modified-Screen Printed Electrode for Dengue Virus DNA Oligomer Detection. IEEE Sensors Journal. 15, 4420-4421 (2015).
  65. Yingkajorn, M., Sermwitayawong, N., Palittapongarnpimp, P., Nishibuchi, M., Robins, W. P., Mekalanos, J. J., Vuddhakul, V. Vibrio parahaemolyticus and its specific bacteriophages as an indicator in cockles (Anadara granosa) for the risk of V. parahaemolyticus infection in Southern Thailand. Microbial Ecology. 67, 849-856 (2014).
  66. Ahmad Ganaie, H., Ali, M. N. Short term protocol for the isolation and purification of DNA for molecular analysis. International Journal of Pharmaceutical Sciences Review and Research. 24, 266-270 (2014).
  67. Nakano, K., Kimura, T., Kitamura, Y., Ihara, T., Ishimatsu, R., Imato, T. Potentiometric DNA sensing platform using redox-active DNA probe pair for sandwich-type dual hybridization at indicator electrode surface. Journal of Electroanalytical Chemistry. 720-721, 71-75 (2014).
  68. Yang, J., Jim Yang, L., Heng-Phon, T., Gan-Moog, C. Inhibition of DNA hybridization by small metal nanoparticles. Biophysical Chemistry. 120, 87-95 (2006).
  69. Niu, L. M., Liu, F., Wang, W., Lian, K. Q., Ma, L., Shi, H. M., Kang, W. J. Electrochemical Behavior of Paraquat on a Highly Ordered Biosensor Based on an Unmodified DNA-3D Gold Nanoparticle Composite and Its Application. Electrochimica Acta. 153, 190-199 (2015).
  70. Li, Z., Miao, X., Xing, K., Zhu, A., Ling, L. Enhanced electrochemical recognition of double-stranded DNA by using hybridization chain reaction and positively charged gold nanoparticles. Biosensors and Bioelectronics. 74, 687-690 (2015).
  71. Niu, S., Sun, J., Nan, C., Lin, J. Sensitive DNA biosensor improved by 1,10-phenanthroline cobalt complex as indicator based on the electrode modified by gold nanoparticles and graphene. Sensors and Actuators B: Chemical. 176, 58-63 (2013).
  72. Yi, H., Xu, W., Yuan, Y., Bai, L., Wu, Y., Chai, Y., Yuan, R. A pseudo triple-enzyme cascade amplified aptasensor for thrombin detection based on hemin/G-quadruplex as signal label. Biosensors and Bioelectronics. 54, 415-420 (2014).
  73. Das, R., Sharma, M. K., Rao, V. K., Bhattacharya, B. K., Garg, I., Venkatesh, V., Upadhyay, S. An electrochemical genosensor for Salmonella typhi on gold nanoparticles-mercaptosilane modified screen printed electrode. Journal of Biotechnology. 188, 9-16 (2014).
  74. Han, X., Fang, X., Shi, A., Wang, J., Zhang, Y. An electrochemical DNA biosensor based on gold nanorods decorated graphene oxide sheets for sensing platform. Analytical Biochemistry. 443, (2), 117-123 (2013).
  75. Huang, K. J., Liu, Y. J., Zhang, J. Z., Cao, J. T., Liu, Y. M. Aptamer/Au nanoparticles/cobalt sulfide nanosheets biosensor for 17β-estradiol detection using a guanine-rich complementary DNA sequence for signal amplification. Biosensors and Bioelectronics. 67, 184-191 (2015).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics