DNA חזקים בידוד ובנייה ספריית רצף תפוקה גבוהה עבור דגימות עשבייה

* These authors contributed equally
Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

מאמר זה מדגים פרוטוקול מפורט DNA בידוד ובניה ספריית תפוקה גבוהה רצף מחומר עשבייה כולל חילוץ של ה-DNA בצורה יוצאת דופן באיכות ירודה.

Cite this Article

Copy Citation | Download Citations

Saeidi, S., McKain, M. R., Kellogg, E. A. Robust DNA Isolation and High-throughput Sequencing Library Construction for Herbarium Specimens. J. Vis. Exp. (133), e56837, doi:10.3791/56837 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Herbaria הם מקור יקר ערך של חומר צמחי יכול לשמש במגוון מחקרים ביולוגיים. השימוש של דגימות עשבייה מזוהה עם מספר אתגרים כולל איכות שימור הדגימה, DNA מפורק דגימה ההרסני של דגימות נדירות. על מנת להשתמש ביעילות רבה יותר חומר עשבייה בפרוייקטים גדולים רצף, דרושה שיטה מהימן ומדרגי הכנה בידוד וספריית הדי. מאמר זה מדגים פרוטוקול חזקות, ההתחלה-to-end לבנייה DNA בידוד, תפוקה גבוהה ספריה של דגימות עשבייה שאינה דורשת שינוי לקבלת דוגמאות בודדות. פרוטוקול זה המותאם במיוחד עבור איכות נמוכה מיובשים צמח חומר לוקח יתרון השיטות הקיימות על-ידי מיטוב רקמות שחיקה, שינוי בחירת גודל הספרייה, היכרות עם שלב reamplification אופציונלי עבור ספריות תשואה נמוכה. Reamplification של ספריות DNA תשואה נמוכה יכול להציל את דגימות נגזר דגימות עשבייה ללא תחליף, ערך פוטנציאלי, שלילת הצורך לדיגום הרסניים נוספים וללא היכרות עם רצף ניכרת הטיה על השכל יישומים פילוגנטי. הפרוטוקול נבדק על מאות מינים דשא, אך צפוי להיות להתאמה לשימוש אחר שושלות הצמח לאחר אימות. פרוטוקול זה יכול להיות מוגבל על ידי ה-DNA ביותר, שבו קטעים שלא קיימים בטווח הרצוי, ועל ידי מטבוליטים משניים נוכח חומר צמח המעכבות נקי בידוד ה-DNA. בסך הכל, פרוטוקול זה מציג שיטה מקיפה ומהירה המאפשרת בידוד ה-DNA והכנת ספריית דגימות 24 ב פחות מ 13 h, עם רק 8 שעות של זמן על הידיים פעילה עם שינויים מינימליים.

Introduction

עשבייה אוספים הם מקור ערך פוטנציאלי של מינים ושל גיוון גנומית ללימודי כולל פילוגנטיקה1,2,3, גנטיקה של אוכלוסיות4,5, שימור ביולוגיה6, מין פולש ביולוגיה7ותכונה האבולוציה8. היכולת לקבל מגוון רחב של מינים, אוכלוסיות, מיקומים גיאוגרפיים ונקודות זמן מדגיש את "אוצר"9 זה עשבייה. מבחינה היסטורית, מהות נגזר עשבייה DNA מפורק יש הפריע פרויקטים מבוססי ה-PCR, לעיתים קרובות להשכיב חוקרים באמצעות סמנים בלבד נמצאו ב העתק גבוהה, כגון אזורים של הגנום כלורופלסט או מרווח משועתקים פנימי (ITS) של ribosomal ה-RNA. האיכות של דגימות DNA להשתנות בהרחבה על השיטות לשימור9,10, עם הפסקות גדילי כפול, פיצול מהאש המשמשים בתהליך ייבוש הצורות הנפוצות ביותר של נזק, יצירת בסיס מה שנקרא 90% DNA שכלוא יש לתאר מחקרים מבוססי ה-PCR11. מלבד הפיצול, לסוגיה השנייה הכי נפוצה עשבייה גנומיקה היא זיהום, כגון זה נגזר פטריות endophytic13 או פטריות רכשה לאחר המוות לאחר אוסף אך לפני הרכבה עשבייה12, למרות זאת בעיה זו יכולה להיות bioinformatically פתור נתן את מסד הנתונים נכון פטרייתיים (ראו להלן). בעיה השלישי, פחות נפוץ, הוא שינוי רצף עד ציטוזין (C/G→T/א) דיאמינציה14, למרות מוערך יהיה נמוך (~ 0.03%) עשבייה דגימות11. עם כניסתו של תפוקה גבוהה רצף (HTS), סוגיית הפיצול ניתן להתגבר עם רצף עומק12,15, המאפשר רכישת נתונים ברמת גנומית של דגימות רבות עם איכות נמוכה של קריאות קצר ה-DNA, ואפילו לפעמים המתיר רצף הגנום כולו15.

עשבייה דגימות נעשה שימוש בתדירות גבוהה יותר, הם מרכיב גדול של פרויקטים פילוגנטי16. אתגר הנוכחי של משתמש עשבייה דגימות HTS היא בעקביות קבלת מספיק DNA נטושים כפול, תנאי הכרחי עבור רצפי פרוטוקולים, ממינים רבים מבעוד, ללא צורך לייעל שיטות עבור הפרט דגימות. בנייר זה, הוכח עבור הפקת דנ א והכנת ספריית דגימות עשבייה פרוטוקול זה מנצל שיטות קיימות ומשנה אותם כדי לאפשר תוצאות מהר ו לטבלה הניתנת לשכפול. שיטה זו מאפשרת להשלים עיבוד הדגימה לספריה של דגימות 24 h 13, עם הזמן על הידיים של 8 שעות, או ח 16, עם הזמן על הידיים 9 h, כאשר השלב reamplification אופציונלית נדרשת. עיבוד סימולטני של דגימות נוספות הוא בר השגה, אבל הגורם המגביל הוא יכולת צנטריפוגה, מיומנות טכנית. הפרוטוקול נועד דרוש רק טיפוסי ציוד מעבדה (thermocycler צנטריפוגה, דוכני מגנטי) במקום ציוד מיוחד, כגון מפוחים או sonicator, עבור הטיית ה-DNA.

איכות ה-DNA, פרגמנט גודל וכמות המגבילים את הגורמים לשימוש של עשבייה דגימות בניסויים רצף תפוקה גבוהה. שיטות נוספות לבודד דנ א עשבייה ויצירת רצף תפוקה גבוהה ספריות הראו את התועלת של שימוש רק 10 ng של הדנ א16; אולם הם דורשים השפעול קביעת המספר האופטימלי של PCR מחזורי הנדרש להכנה הספרייה. זה הופך מעשית כאשר להתמודד עם כמויות קטנות מאוד של קיימא כפול תקועים דנ א (dsDNA), כמו הדגימות עשבייה לייצר רק מספיק דנ א הכנה בספריה מסוימת. השיטה המוצגת כאן משתמש מספר בודד של מחזורים ללא קשר לאיכות הדגימה, כך אין דנ א הוא איבד ספריית אופטימיזציה שלבים. במקום זאת, צעד reamplification מופעל כאשר ספריות אינן עונות על הכמויות המינימליות לצורך עריכה ברצף. דוגמאות עשבייה רבים נדירים ושולט קצת חומר מקשה להצדיק את הדגימה הרסני במקרים רבים. כדי לשנות זאת, פרוטוקול הציג מאפשר dsDNA קלט מידות פחות מ 1.25 ng לתוך תהליך הכנה ספריה, הרחבת הטווח של דגימות קיימא עבור תפוקה גבוהה רצף וצמצום הצורך דגימה ההרסני של דגימות.

להלן כללי התנהגות יש כבר אופטימיזציה עבור עשבי, נוסה על מאות מינים שונים מדגימות עשבייה, אף אנו צופים כי ניתן להחיל את הפרוטוקול להרבה קבוצות אחרות של הצמח. הוא כולל שלב אופציונלי שחזור יכול לשמש כדי לחסוך באיכות נמוכה ו/או דגימות נדירות. בהתבסס על דגימות עשבייה מעל מאתיים נבדק, פרוטוקול זה פועל על דגימות עם קלט רקמות נמוכה ואיכות, המאפשר השימור של דגימות נדירות באמצעות דגימה הרסני מינימלי. הנה היא מופיעה בפרוטוקול זה יכול לספק ספריות באיכות גבוהה יכול להיות רציף לפרויקטים מבוססי phylogenomics.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. לפני להתחיל

  1. להפוך צטאריל טריים trimethylammonium ברומיד (CTAB) מאגר17 על-ידי הוספת 20 גר' CTAB, 10 גרם של פוליוינילפירולידון (PVP) 40, 100.0 mL 1 מ' טריס pH 8.0, 40 מ של 0.5 M ethylenediaminetetraacetic חומצה (EDTA) pH 8.0, 280.0 מ ל 5 M NaCl ולאחר 400.0 מיליליטר מים ריאגנט יחד, ולהביא הנפח הכולל באמצעות ריאגנט כיתה 1 ליטר מים. להתאים את ה-pH ל 8.0.
    הערה: ריאגנטים נוספים ניתן להוסיף CTAB בהתאם תרכובות משניות taxa בודדים. לראות את אלן. et al. 18 עבור רשימה מקיפה של ריאגנטים מוספים.
  2. להוסיף 10 µL של β-mercaptoethanol לכל 5 מ של מאגר CTAB.
    הערה: זה יכול להיות מוכן באצוות של 50 מ ל, לאחסן בטמפרטורת החדר במשך 3-4 שבועות.
    1. מחממים את הפתרון CTAB באמבט מים 65 ° C.
  3. מקררים מרגמות, בקווקז ב-20 ° C למשך 20 דקות לפחות.
  4. תווית 4 סטים של 2 x צינורות 2-mL n (כאשר n = מספר דוגמאות). לשים 1 סט של הצינורות עם תוויות על קרח.
  5. מקררים אלכוהול איזופרופיל על קרח או במקפיא-20 ° C.
  6. להסיר מעבדתי הפיך הנייח (אלוהים אדירים) חרוזים (ראה טבלה של חומרים) מהמקרר, לאפשר להם equilibrate לטמפרטורת החדר (לפחות 30 דקות).
  7. להכין את 80% אתנול.
  8. בחר עשבייה דגימות לחילוץ ולאחזר ~ 1 ס מ2או 10 מ ג, רקמת לכל הדגימה, רצוי עלים בחומר.

2. הפקת דנ א

  1. לטחון ~ 1 ס מ2 רקמת עשבייה שנבחרו מראש באמצעות מרגמות prechilled בקווקז. מוסיפים חנקן נוזלי וחול 30 – 50 מ ג מחוטא. לטחון עד רקמות הופך אבקה.
    הערה: 10 מ ג או יותר רקמות רצוי, אך פחות עבד גם במקרים מסוימים. ברגע החנקן הנוזלי מתאדה, להוסיף עוד לפי הצורך עד רקמות באופן מלא האדמה. שיטה נפוצה נוספת לשיבוש תאים ורקמות הוא השימוש של מכה חרוז. עם זאת, שיטה זו נמצאה לא פועלות היטב עבור דגימות בשימוש בניסויים אלה.
  2. להעביר את האבקה קפוא לתוך שני צינורות 2 מ"ל (להוסיף לא יותר ממחצית נפח של הצינור). להוסיף 600 µL של פתרון CTAB חמים כל שפופרת ומערבבים הצינורות ביסודיות על ידי היפוך ו vortexing.
    הערה: כיוון כמות ואיכות החומר עשבייה לעתים קרובות נמוכה, ביצוע בידוד ה-DNA של שתי חזרות מסייעת להשגת תשואות גבוהות.
  3. דגירה בדגימות באמבט מים 65 ° C עבור 1-1.5 h, vortexing כל 15 דקות.
  4. צנטריפוגה דגימות ב 10,000 g x עבור 5 דק. להעביר את תגובת שיקוע קבוצה חדשה של תוויות צינורות (~ 500 µL). להתעלם בגדר תוך שימוש בתהליך סילוק ללא כלור רגיל.
  5. להוסיף 4 µL של RNase-A (10 mg/mL) כל שפופרת ומערבבים על-ידי היפוך או pipetting. דגירה בדגימות ב 37 מעלות צלזיוס באמבט חום בלוק או מים למשך 15 דקות.
  6. להוסיף אמצעי שווה (~ 500 µL) של תערובת אלכוהול פנול: כלורופורם: isoamyl 25:24:1, ברגע הצינורות הגיעו בטמפרטורת החדר. מערבבים ביסודיות על ידי pipetting למעלה ולמטה ו/או עם היפוך. צנטריפוגה שהצינורות ב g 12,000 x במשך 15 דקות להעביר את השכבה המימית (השכבה העליונה) קבוצה חדשה של תוויות צינורות (~ 400 µL). למחוק את השכבה אורגניים לתוך מיכל פסולת למשפחה עם ילדים.
    הערה: שלב 2.6 ניתן לחזור אם כמויות גדולות של חומרים משני צפויים ב לשתול חומר.
  7. הוסף אמצעי שווה (~ 400 µL) של תערובת אלכוהול כלורופורם 24:1: isoamyl. מערבבים ביסודיות על ידי pipetting למעלה ולמטה ו/או עם היפוך. Centrifuge הצינורות ב g 12,000 x במשך 15 דקות העברה השכבה המימית (השכבה העליונה) על קבוצה חדשה של prechilled, שכותרתו צינורות (~ 300 µL). למחוק את השכבה אורגניים לתוך מיכל פסולת למשפחה עם ילדים.
  8. להוסיף אמצעי שווה (~ 300 µL) של אלכוהול איזופרופיל prechilled ו- µL 12 של 2.5 מטר סודיום אצטט כל שפופרת. דגירה בדגימות ב-20 מעלות צלזיוס למשך 30-60 דקות.
    הערה: הזמנים הדגירה ניתן להאריך (עד הדגירה לילה), אבל איכות דנ א יקטן ככל דגירה בדגימות.
  9. לקחת את הדוגמאות המקפיא ואת צנטריפוגה הצינורות ב g x 12,000 במשך 15 דקות להסיר ולמחוק את תגובת שיקוע בעדינות מבלי להפריע בגדר. לשטוף את צניפה מאת הבולם עם 70% טרי אתנול (כ 300 – 500 µL). עבור כל דגימה כפולים, לאחד את שני כדורי בודדים לתוך אחד עם ליווי אתנול.
    הערה: הדוגמאות צריך להיות מאוחד לתוך שפופרת אחת באמצעות אתנול תחילה ולאחר מכן המשך. אין צורך לשטוף כל דגימה עם אתנול בנפרד.
  10. Centrifuge הצינורות ב g x 12,000 במשך 10 דקות להסיר ולמחוק את תגובת שיקוע בעדינות מבלי להפריע בגדר. האוויר יבש כדורי.
    הערה: דוגמאות ניתן לייבש מהר יותר באמצעות גוש חום יבש (לא יעלה על 65 ° C). ודא כי הדגימות לא מתייבשים יתר על המידה, כמו זה יכול להקטין את התשואה הסופית של ה-DNA.
  11. להשעות את ה-DNA מבודדות ב- 50 µL של 1 x טה. מאחסנים במקפיא-20 ° C לאחסון לטווח ארוך או 4 ° C לשימוש בשבוע הבא.

3. בקרת איכות (QC)

  1. לרוץ עם ג'ל agarose לבדיקת איכות.
    1. להכין בופר טריס/בוראט/EDTA (TBE) 1 x על-ידי הוספת בסיס טריס 54 g 27.5 g פנמיות, 3.75 g EDTA ניתרן מלח, להביא את הנפח הכולל 5 L באמצעות ריאגנט כיתה מים.
    2. הכנת ג'ל agarose 1% על-ידי הוספת 1 g agarose 100 מ של 1 x TBE. מיקרוגל הפתרון עד agarose לא יהיה גלוי. להוסיף 0.01% חומצות גרעין ג'ל כתם (ראה טבלה של חומרים). ומצננים את הבקבוק עד שהיא חמה למגע. מערבבים היטב על ידי ערבוב. יוצקים agarose מגש ג'ל ולתת לו לשבת עד.
    3. מערבבים 3 µL מדגם µL 2 של ריאגנט כיתה מים, 1 µL של 6 x טוען לצבוע. לטעון את הדגימות המטריצה ג'ל, וציין את הסדר שלהם.
    4. להפעיל הדגימות 60-70 דקות ב- 60-70 (פ') התמונה הג'ל תחת אור UV עם חשיפה נכונה ונוחות.
      הערה: נוכחות של להקה משקל מולקולרי גבוהה היא סימן של ה-DNA באיכות גבוהה, בעוד מריחות מציינות בדרך כלל DNA השפלה. רוב דגימות עשבייה אתה יורד.
  2. להפעיל ניתוח כימות dsDNA (ראה טבלה של חומרים) כדי לקבוע את כמות כפולה תקועים הדנ א.
    1. השתמש µL 2 מדגם לניתוח.
      הערה: דילולים לא נדרשים עבור ניתוח כימות של חומר עשבייה כפי שהם נוטים להיות בכמויות מינימליות. ספריות מוצלחת נעשו מתוך מעט ככל 1.26 ng dsDNA הכולל של שלב זה.

4. DNA הטיה

הערה: זה הוא גרסה אופטימיזציה של fragmentase כפול גדילי מסחרי פרוטוקול (ראה טבלה של חומרים).

  1. המקום dsDNA פיצול האנזים על הקרח לאחר vortexing עבור 3 s.
  2. בשפופרת סטרילי 0.2 מ"ל פולימראז תגובת שרשרת (PCR), מיקס 1 – 16 µL מבודדים DNA עם 2 µL של המלווה פיצול תגובה מאגר. להביא את הנפח הכולל 18 µL על-ידי הוספת נוקלאז מים חינם. להוסיף 2 µL של אנזים פיצול dsDNA ו מערבולת התערובת 3 s.
    הערה: כמות הדנ א הדרוש משתנה בהתאם ריכוז ה-DNA (aim על סך 200 ng בצינור).
  3. דגירה בדגימות ב 37 מעלות צלזיוס למשך דקות 8.5. לאחר מכן להוסיף 5 µL של 0.5 M EDTA הצינורות.
    הערה: שלב זה צריך להתבצע ברגע תקופת הדגירה הוא מעל כדי לסיים את התגובה ולמנוע דגימות די אן איי יתר הטיה.

5. ניקיון חרוז

  1. Homogenize את החרוזים אלוהים אדירים על-ידי vortexing.
  2. להביא את הנפח הכולל של ה-DNA הוטו 50 µL על-ידי הוספת µL 25 של נוקלאז מים חינם. להוסיף µL 45 של חרוזים אלוהים אדירים בטמפרטורת החדר (90% נפח) µL 50 של הוטו DNA ו לערבב ביסודיות על ידי pipetting למעלה ולמטה.
    הערה: הוספת חרוזים על 90 אחוז נפח המדגם נעשית כדי להסיר הקטן ביותר של מקטעי דנ א, לעתים קרובות מתחת 200 בסיסי זוגות.
  3. תן הדגימות דגירה עבור 5 דק. לשים את הצינורות על צלחת מגנטית ולתת להם לשבת במשך 5 דק בזהירות להסיר ולמחוק את תגובת שיקוע.
    הערה: להיזהר שלא להפריע את החרוזים, כפי שהם מכילים את מטרות DNA הרצוי.
  4. להוסיף 200 µL טריים 80% אתנול השפופרות בעוד לדוכן מגנטי. דגירה בטמפרטורת החדר במשך 30 s ואז בזהירות להסיר, למחוק את תגובת שיקוע. חזור על שלב זה פעם אחת. האוויר יבש את החרוזים עבור 5 דקות ברכבת התחתית נמצאת על הדוכן מגנטי עם מכסה פתוח.
    הערה: למנוע ייבוש יתר על המידה את החרוזים. התוצאה יכולה להיות שחזור התחתון של ה-DNA.
  5. הסר את הצינורות של המגנט. Elute ה-DNA של החרוזים לתוך µL 55 של 0.1 x טה ומערבבים היטב על-ידי pipetting למעלה ולמטה. דגירה בטמפרטורת החדר במשך 5 דק צינורות המקום לדוכן מגנטי ונקה ולחכות הפתרון לפנות (~ 2 דקות).
  6. משוך את µL 52 של תגובת שיקוע. להפעיל ניתוח כימות הדנ א על הדגימות לבדיקת ההתאוששות וריכוז הראשוני שנכנס הספרייה במכינה.
    הערה: ספריות נעשו עם dsDNA הכולל מוערך פחות מ 1.25 ng, למרות כל reamplification במקרה היה נדרש.

6. ספריית הכנה

הערה: זה הוא גרסה מותאמת של ערכת ספריית זמינים מסחרית (ראו פרוטוקול שולחן של חומרים ).

  1. בסוף ההכנה
    1. הוסף 3 µL endonuclease, פוספט עוקב אנזימים µL 7 ללוות התגובה המאגר כדי µL 50 מהדנ א נקי, הוטו. לערבב ביסודיות על ידי pipetting למעלה ולמטה. לסובב את הצינורות כדי להסיר בועות.
      הערה: לנפח הכללי צריך להיות 60 µL.
    2. הכנס את הדגימות thermocycler עם התוכנית הבאה: 30 דקות ב- 20 ° C, 30 דקות ב- 65 ° C, אז להחזיק ב 4 º C.
      הערה: המכסה מחוממת הוגדר ≥75 ° C
  2. מתאם מצדו
    1. לדלל המתאם קיפול 25 – 50 (עובד מתאם ריכוז של 0.6-0.3 מיקרומטר). להוסיף 30 µL של מיקס מאסטר מצדו, µL 1 של מצדו משפר ו- 2.5 µL של מתאם עבור תפוקה גבוהה רצף קריאה קצרה הצינורות.
      הערה: לנפח הכללי צריך להיות 93.5 µL.
    2. לערבב ביסודיות על ידי pipetting למעלה ולמטה. לסובב את הצינורות כדי להסיר בועות. דגירה הצינורות ב 20 מעלות צלזיוס למשך 15 דקות.
    3. להוסיף 3 µL של תערובת מסחרית של אורציל דנ א glycosylase (UDG) ו השמיני Endonuclease של דנ א glycosylase-lyase (ראה טבלה של חומרים) את הצינורות. ודא כי אמצעי האחסון הכולל 96.5 µL. לערבב ביסודיות, דגירה ב 37 מעלות צלזיוס למשך 15 דקות באמצעות של thermocycler.
      הערה: המכסה צריך להיות מוגדר ≥47 מעלות צלזיוס. הגירסה המקורית של פרוטוקול מסחרי יש מבחר גודל לאחר השלב מצדו מתאם, ואחריו ניקיון חרוז כשלב הסופי. פרוטוקול זה, אשר משיג תשואות גבוהות, בוררים את סדר השלבים ומיישם שאוסף המידות כשלב הסופי.
  3. ' ניקוי ' כדי להסיר אנזימים רסיסים קטנים
    1. Homogenize beads מגנטי על-ידי vortexing.
    2. להוסיף µL 78 של אלוהים אדירים beads מגנטי (80% נפח) ולערבב היטב על-ידי pipetting למעלה ולמטה.
      הערה: הוספת חרוזים ב 80% נפח המדגם נעשית כדי להסיר שברי DNA הקטן ביותר, שלעיתים קרובות קצר יותר 250 בסיסים. הסרת מחמירים יותר קטן שברי DNA היא (i) להסיר מתאמים עודפים (ii) להדגיש הגברה של שברים גדולים יותר בשלבים הבאים.
    3. תן שהדגימות תקופת דגירה של 5 דק לשים הצינורות על צלחת מגנטי עבור 5 דק בזהירות להסיר ולמחוק את תגובת שיקוע המכיל את ה-DNA מחוץ לטווח יגיע לגודל הרצוי.
      הערה: תיזהר שלא להפריע את החרוזים שמכילים את מטרות DNA הרצוי.
    4. להוסיף 200 µL טריים 80% אתנול השפופרות בעוד לדוכן מגנטי. דגירה בטמפרטורת החדר במשך 30 s ואז בזהירות להסיר, למחוק את תגובת שיקוע. חזור על שלב זה פעם אחת. האוויר יבש את החרוזים עבור 5 דקות ברכבת התחתית נמצאת על הדוכן מגנטי עם מכסה פתוח.
      הערה: להימנע על ייבוש החרוזים. התוצאה יכולה להיות שחזור התחתון של ה-DNA.
    5. הסר את הצינורות של המגנט. Elute המטרה הדנ א של החרוזים על-ידי הוספת µL 17 של 0.1 x טה ומערבבים היטב על-ידי pipetting למעלה ולמטה.
    6. דגירה בטמפרטורת החדר במשך 5 דק צינורות המקום לדוכן מגנטי ונקה ולחכות הפתרון לפנות (~ 2 דקות).
    7. משוך את µL 15 של תגובת שיקוע.
  4. PCR-הגברה
    1. להוסיף 25 µL של דיוק גבוה PCR מיקס מאסטר, µL 5 של תפוקה גבוהה קריאה קצרה רצף ספריית ההכנה 5' תחל ו µL 5 של רצף קריאה קצרה תפוקה גבוהה ספריית הכנה 3' פריימר, 15 µL של ה-DNA נקי ובין אם-לא מתאם.
      הערה: הנפח הכולל צריך להיות 50 µL.
    2. מערבבים היטב בעזרת vortexing. למקם את הדגימות thermocycler באמצעות ההגדרות נמצאו טבלה 1: הגדרת הגברה Thermocycler.
      הערה: מספר גדול של מחזורי נדרש עקב כמות נמוכה של DNA קלט.
שלב מחזור Temp. זמן מחזורים
דנטורציה הראשונית 98 ° C 30 s 1
דנטורציה 98 ° C 10 s 12
חישול/הרחבה 65 ° C 75 s 12
סיומת הסופי 65 ° C 5 דקות 1
. תחזיק 4 ° C

טבלה 1: PCR פרוטוקול פעמים דנטורציה, חישול, וסיומת וטמפרטורות. טמפרטורה ושעות אופטימציה להצגה ריאגנטים הוצג פרוטוקול זה. אם שונו ריאגנטים, טמפרטורות ושעות צריך להיות מותאם שוב.

  1. בחירת גודל עבור גודל הספרייה הרצויה
    הערה: שלב זה חרוז יסיר שברי גם מעל וגם מתחת לטווח היעד.
    1. Homogenize אלוהים אדירים חרוזים מאת vortexing.
    2. להוסיף 25 µL (50% נפח) של beads מגנטי בטמפרטורת החדר, לערבב ביסודיות על ידי pipetting למעלה ולמטה. תן הדגימות דגירה עבור 5 דק. לשים את הצינורות על צלחת מגנטית ולתת להם לשבת במשך 5 דק בזהירות להסיר ולהעביר את תגובת שיקוע קבוצה חדשה של תוויות צינורות.
      הערה: אמצעי אחסון זה ניתן להתאים בהתבסס על גודל הספרייה הרצויה. תגובת שיקוע מכיל DNA שברי לגודל הרצוי. ב הדגירה חרוז הראשון, מחייבות החרוזים שברים ספריית גדולים יותר. אלה יוסרו להתמקד אלה בטווח זוג בסיסים של 400 – 600. תגובת שיקוע מכיל שברים קטנים יותר.
    3. להוסיף 6 µL של חרוזים אלוהים אדירים בטמפרטורת החדר תגובת שיקוע, לערבב ביסודיות על ידי pipetting למעלה ולמטה. תן שהדגימות דגירה עבור 5 דק. לשים את הצינורות על צלחת מגנטית ולתת להם לשבת במשך 5 דקות.
      הערה: אמצעי אחסון זה ניתן להתאים בהתבסס על גודל הספרייה הרצויה לפי שלב 6.5.2.
    4. בזהירות להסיר ולמחוק את תגובת שיקוע.
      הערה: תיזהר שלא להפריע את החרוזים המכילים את ה-DNA הרצוי. ב הדגירה חרוז השני, החרוזים הם מחייב את השברים עזב לאחר הסרת ה-DNA הגדול הראשונית שברים. קבוצה זו של שברי הוא בדרך כלל בטווח יגיע לגודל הרצוי.
    5. להוסיף 200 µL טריים 80% אתנול השפופרות בעוד לדוכן מגנטי. דגירה בטמפרטורת החדר במשך 30 s, ואז בזהירות להסיר, למחוק את תגובת שיקוע. חזור. האוויר יבש את החרוזים עבור 5 דקות ברכבת התחתית נמצאת על הדוכן מגנטי עם מכסה פתוח.
      הערה: למנוע ייבוש יתר על המידה את החרוזים. התוצאה יכולה להיות שחזור התחתון של ה-DNA.
    6. הסר את הצינורות של המגנט. Elute המטרה הדנ א של החרוזים לתוך µL 33 של 0.1 x טה ומערבבים היטב על-ידי pipetting למעלה ולמטה.
    7. דגירה בטמפרטורת החדר במשך 5 דק צינורות המקום לדוכן מגנטי ונקה ולחכות הפתרון לפנות (~ 2 דקות). משוך את 30 µL של תגובת שיקוע, העברה ל 2 mL צינורות (ראה טבלה של חומרים) עבור אחסון.
      הערה: ניתן לשמור את הספריות ב-20 הלעפה תרוטרפמט לאחסון לטווח ארוך.
  2. בקרת איכות
    1. להפעיל מבחן בקרת איכות ספריות ה-DNA. עיין שלבים 3.1 ו- 3.2.
      הערה: עבור ספריות ה-DNA, הפעל את הג'ל ~ 45 דקות ב 96 V.
  3. ספריית reamplification: אופציונלי אם כמות ספריה אינה מספיקה.
    הערה: דוגמאות עם ספריית ריכוזים מתחת 10 ננומטר יכול להיות reamplified באמצעות השלבים הבאים. Reamplification של ספריות ריכוז נמוך יכול להשיג תוצאות מעשי רצף, אך reamplification עלולה לגרום שינוי צנוע הבסיס ההרכב המגוון, למרות אסף נתונים (טבלה 3) מציע כי זה זניח עבור מדדים מסוימים .
    1. לדלל את תחל reamplification אוניברסלי 10-fold באמצעות 0.1 x טה.
    2. להוסיף 25 µL של דיוק גבוה PCR מיקס מאסטר, µL 5 של פריימר reamplification אוניברסלי מדולל 1 (AATGATACGGCGACCACCGA) ו- 5 µL של reamplification אוניברסלי מדולל פריימר 2 (CAAGCAGAAGACGGCATACGA) 15 µL של ספריות ריכוז נמוך. הערה: הנפח הכולל צריך להיות 50 µL.
    3. מערבבים היטב בעזרת vortexing. למקם את הדגימות thermocycler באמצעות ההגדרות נמצאו טבלה 1: הגדרת הגברה Thermocycler
      הערה: המספר הגדול של מחזורי נדרש עקב כמות נמוכה של DNA קלט.
    4. ניקיון חרוז
    5. Homogenize אלוהים אדירים חרוזים מאת vortexing. להוסיף µL 45 של חרוזים אלוהים אדירים בטמפרטורת החדר (90% נפח) ולערבב היטב על-ידי pipetting למעלה ולמטה.
    6. תן את הדגימות תקופת דגירה של 5 דק. את הצינורות על צלחת מגנטית למשך 5 דקות.
    7. בזהירות להסיר ולמחוק את תגובת שיקוע המכיל את ה-DNA לא רצויים.
      הערה: תיזהר שלא להפריע את החרוזים שמכילים את מטרות DNA הרצוי.
    8. להוסיף 200 µL טריים 80% אתנול השפופרות בעוד לדוכן מגנטי. דגירה בטמפרטורת החדר במשך 30 s, ואז בזהירות להסיר, למחוק את תגובת שיקוע. חזור על שלב זה פעם אחת.
    9. האוויר יבש את החרוזים עבור 5 דקות ברכבת התחתית נמצאת על הדוכן מגנטי עם מכסה פתוח.
      הערה: למנוע ייבוש יתר על המידה את החרוזים. התוצאה יכולה להיות שחזור התחתון של היעד הדנ א.
    10. הסר את הצינורות של המגנט. Elute המטרה הדנ א של החרוזים לתוך µL 33 של 0.1 x טה ומערבבים היטב על-ידי pipetting למעלה ולמטה.
    11. דגירה בטמפרטורת החדר במשך 5 דק צינורות המקום לדוכן מגנטי ונקה ולחכות הפתרון לפנות (~ 2 דקות).
    12. משוך את 30 µL של תגובת שיקוע. ניתן לאחסן את הספריות ב-20 ° C לאחסון לטווח ארוך.
  4. בקרת איכות
    1. להפעיל מבחן בקרת איכות ספריות ה-DNA. עיין שלבים 3.1 ו- 3.2. עבור ספריות ה-DNA, הפעל את הג'ל ~ 45 דקות ב 96 V.
      הערה: אם להקה זוגי נתפסת הג'ל, זה ככל הנראה תוצאה של תשישות פריימר מהשלב reamplification. הלהקות ניתן להסיר על ידי חוזר 6.9, אלא באמצעות מחזור אחד בלבד בתוכנית ה-PCR מתוארים בטבלה1.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

בידוד ה-DNA ועם תשואה ספריית הסופי
במחקר זה, הדגימו את היעילות של הפרוטוקול עבור הבידוד של דנ א עשבייה ושחזור של ספריות רצף באיכות גבוהה באמצעות כחמישים דוגמאות שונות עם הבכור משנת 1920 הצעיר ביותר מ-2012 (טבלה 2). עבור כל דגימה, כ 10 מ ג של רקמת העלה שימש עבור בידוד של דנ א. רקמת העלה ירוק יותר היה המועדף אם היא זמינה, אין רקמות עם זיהום פטרייתי ברור נבחר. ומשום מוצלח יכול להתבצע באמצעות רקמות צהוב או חום, למרות התשואה אמור להיות צפוי להיות נמוך יותר. סך כפול תקועים דנ א (dsDNA) מן הבידוד הראשוני נע בין 3.56 נג ל 2,610 ng. כצפוי, המתקבל עשבייה דגימות DNA היה מושפל מאוד (איור 1A, המשלימים איור 1). חלק ומשום אלה שימשו אנזימטי הטיה (ng 1.26-464). למרות עשבייה DNA הוא לכסנתם כבר בתהליך שימור, אופטימיזציה של הפרוטוקול מחייבת הטיה נוספים כדי לשפר את התשואה הכוללת ספריה. התאוששות מוחלטת של dsDNA פוסט-הטיית נע בין < 1 51% dsDNA קלט, וכתוצאה מכך מינימום של פחות מ- 1.25 ng של התחלה DNA עבור ספריית והכנה היותר 328 ng. אובדן קיצוני של DNA ב דגימות ניתן לייחס את גודל מקטע קטן כבר הרבה של ה-DNA לפני אנזימטי ההטיה (איור 1A, משלימה איור 1). השימוש של ניקיון חרוז 90% נפח על ה-DNA הוטו הוסרו בכוונה הרסיסים הקטנים של דנ א כדי להעשיר לגדלים שבר גדול יותר, רצוי יותר. אלה קטעים קטנים במיוחד נראו בדגימות TK463, TK657, TK694, כפי מסומן על ידי אות עז-הסימן 100 זוג בסיסים (איור 1 א').

הכמות הכוללת של בחירת גודל הספרייה פוסט נע בין 1.425 ng כדי 942.5 ng (טבלה 2, משלימה טבלה 1). עבור 23 של הדגימות, הכנת מיצוי וספריית הראשונית לא נכנע כמות מספקת של הספרייה (< 10 ננומטר; טבלה 2, משלימה טבלה 1), כך הדוגמיות הללו עברו את השלבים reamplification ושחזור של הפרוטוקול, והתוצאה היא סימן x 14 – 680 לודיג הכולל ספריה (טבלה 2, משלימה טבלה 1). ספריות הסופי כתוצאה הלהקה בין 350 ו 500 זוגות בסיס (איור 1B, המשלימים איור 2). לעתים, נראתה להקת השני שהיה גדול גודל הספרייה הצפוי (איור 1B, המשלימים איור 2). זה אירע כאשר reamplification ה-PCR מותש תחל זמין והחל חישול ספריית מתאמים שברי DNA שאינם הומולוגיים. זה יוצר מולקולה איפה הקצוות (מתאמים) היו חישול כראוי, אבל תותב דנ א לא. מולקולה זו "מבעבע" הופיעו גדול על ג'ל, זה זז לאט יותר דרך המטריקס ג'ל. שגיאות מחזק אלה היו קבוע על-ידי הכנת התגובה reamplification אחר מהספריה reamplified כבר בודקים את זה עבור מחזור יחיד. מחזור יחיד זה מסופק תחל חישול נכונה, הגברה, הסרת הלהקה השנייה (משלימה איור 3).

Reamplification של ספריות הקל ספריית הסופי ריכוזים של פחות 10 ננומטר. ריכוזים אלה מותר ספריות לדלל את שווה molarity, במאגר של ייצוג שווה, עוזר כדי לשלול בעיות שהתעוררו עם איכות מדגם שוויוני, רצף ספריית התשואה. אם המטרה של פרוייקט הגנום כלורופלסט רצף, לאחר מכן הסכום הכולל של רצף הצורך ישתנו ככל שושלות שונות, רקמות שונות האחוזים הכולל של קריאות שמקורן כלורופלסט דנ א19. בדרך כלל, 50 – 100 x כיסוי המתוכננת של הגנום כלורופלסט מספיקה להרכבה, רצף הרצפים יכול להיות איחדו לכלול כ 70 אנשים בהתאם מינים שיטה.

בדיקות זיהום, הטיה של וריאציה נגרמת על ידי Reamplification
דאגה HTS רצף הבולטים הוא הקדמה של הטיה לתוך ספריות באמצעות PCR נרחב הגברה20. כדי לבחון את ההשפעה של reamplification ולזהות יישומים פוטנציאליים במשותף פילוגנטי הסטייה של חומר עשבייה, השווינו ספרייה בהצלחה ברצף (TK686) עם אותה ספריה מדולל 1:5, reamplified (איזור TK686-R). שני TK686 ו- TK686-R היו וסודרו על HiSeq4000 אילומינה מרכז ביוטכנולוגיה באוניברסיטת אילינוי קארבר ג'יי רועי, מישיגן סטייט אוניברסיטת טכנולוגיית תמיכה במתקן המחקר, בהתאמה, באמצעות זוג בסיסים 150 סוף לזווג קורא (ראה טבלה 3 לפרטים רצף). קריאות גולמי נצברים בחשבון ההזמנות NCBI (SRP128083). קריאות נוקו באמצעות Trimmomatic v.0.3621 כולל מתאם זמירה באמצעות נב מתאם רצף, איכות סינון עבור ציון phred ממוצע של 20 עבור צמד בסיס 10 הזזה לחלון, ולנתק מינימום גודל 40 בסיסי זוגות. כמו אחד הנושאים העיקריים עם דגימות עשבייה זיהום פטרייתי, זיהום הוערך על-ידי מיפוי קריאות נגד חלק JGI MycoCosm הגנום פטרייתי מסד הנתונים22 (312 הגנום הגרעיני ואת הגנום מיטוכונדריאלי 79) באמצעות bowtie2 v . 2.2.923 שימוש בערכת פרמטר "מאוד רגיש-מקומית". ספריות TK686 ו- TK686-R היו להבחין מגניחותיה לזיהום פטרייתי גרעינית (9.24% ו 9.68%, בהתאמה), זיהום פטרייתי מיטוכונדריאלי (0.94% ו- 0.8%) (טבלה 3). אבל זו רק דוגמה אחת, יש רמזים כי זיהום פטרייתי של דגימות עשבייה is not זניח ויש להסירם לפני שימוש בנתונים רצף נגזר עשבייה. ניתן למצוא את מסד הנתונים ואת הפקודות המשמשות כדי לזהות ולהסיר זיהום פטרייתי במאגר GitHub עשבייה גנומיקה24של McKain מ ר.

רצף הגנום כלורופלסט משמש בדרך כלל עבור ניתוח פילוגנטי, דגימות עשבייה משמשים יותר ויותר כמו גשמי מקור12. על מנת לבדוק את אמינות reamplification בהרכבה הגנום כלורופלסט, כלורופלסט הגנום הן TK686 והן TK686-R כונסו באמצעות מדד עניבת הפרפר מוגדר דגנאים מהיר-Plast v.1.2.525 תחת הגדרות ברירת המחדל. הגנום המלא כלורופלסט הושג עבור TK686-R, אך הגנום כלורופלסט TK686 הורכב לתוך contigs שבע עקב נמוך יותר עומק קריאה. Contigs TK686 רוכזו באופן ידני בעקבות McKain. et al. 26 כלורופלסט שהרכבתם הגנום היו מיושר לשני תוכנה מבוססת-GUI יישור (ראה טבלה של חומרים) וריאציה בין הרכבות היה להעריך. סכום כולל של 12 SNPs, ויאסין אחד זוהו בין הרכבות כלורופלסט עבור TK686 TK686-R. עבור כל משתנה, כיסוי הוערכה ערכות קריאה הן TK686 והן TK686-R. בכל המקרים, הגרסה הנפוצה ביותר היה זהה בין שתי הספריות. TK686 הפגינו T→C אחד G→A אחת, G→T אחד, אחד G→-, C→A אחד, T→A אחת, ארבע גרסאות C→A. חמש גרסאות אלה אירעה בתוך מחרוזת homopolymer, רומז שלהם שהשתלבה ההרכבה היה התוצאה של שגיאת רצף וכיסוי הכוללת נמוכה. ייתכן האחרים היה התוצאה של כלורופלסט haplotype וריאציה, רצף שגיאה, או ציטוזין דיאמינציה, או שילוב של גורמים אלה. TK686-R היו C→T אחת, G→T אחד A→G אחת. גרסאות C→T ו- G→T נמצאו homopolymer כמתואר לעיל. בסופו של דבר, כלורופלסט מלאה זהה הגנום אותרו שתי מערכות קריאה. גנום כלורופלסט יחיד של TK686 היה מבואר באמצעות מוריקים21 , לעומת שאר חברי השבט Andropogoneae. כל התכונות כלורופלסט רגיל היו מבואר: 8 rRNAs, 38 tRNAs ו- 84 גנים קידוד החלבון. הגנום השלם כלורופלסט זמין GenBank (MF170217) ו מוריקים27.

הטיה אפשרית מן reamplification של הספריות נקבע גם דרך הערכה של אחוז GC ותוכן הכולל transposon המשוער. GC אחוז הוערך באמצעות script מותאם אישית24. ההבדלים בתוכן GC בשתי הדגימות היו זניחים, עם GC 49.7% ב- TK686 ו- GC 51.2% ב- TK686-R. Transposon הרכב הוערך באמצעות Transposome28. עבור שתי הספריות, קריאות 100,000 היו subsampled באופן אקראי, קומפוזיציה transposon הוערך באמצעות זהות אחוז של 90, כיסוי שבר של 0.55, גודל האשכול של 100, ההפניה אני חוזר של דשא RepBase 21.10 להגדיר29. זה חזר על עצמו 100 פעמים כדי לבצע אתחול לפי הערכה transposon של אלה נתונים (datasets). אחוזי הגנום הכולל עבור subfamilies הגדולות של טרנספוזונים חולצו מתוך פלט Transposome, וסטיית אלה עבור 100 משכפל הוערך. כל קבצי ה-script המשמש ליצירת תפוקות אלה ניתן למצוא במאגר Github טרנספוזונים30של McKain מ ר, כל התוצאות נצברים בחשבון דריאדה (doi:10.5061/dryad.r8t2m). שימוש subfamilies transposon הנפוצות ביותר של שני אינדיקטורים (העתק וצועני מסוף זמן חוזר retrotransposons), התוצאות היו כמעט זהות עם העתק 33.52 ± 4.00% ו 31.68 ± 2.94%, צועני -24.83 ± 2.72% ל- 2.35% 24.00 ± TK686 ו- TK686-R, בהתאמה (טבלה 3). אלו תוצאות הבדיקה מראים כי השלב reamplification של פרוטוקול זה לא יצר רצף משמעות הסטייה עבור מדדים הגנום ברמה גבוהה. עם זאת, יצוין כי זו דוגמה יחידה לא ייתכן נציג באופן מלא כל הספריות reamplified. מבחן יחיד זה מדגים כי הצעד reamplification היה לא מטבעו ממתח הגנום מדדים ב TK686/TK686-R. הטיה הציג לא ישפיע על ההרכבה של הגנום כלורופלסט נותן כיסוי מספיק של רצף, אך מומלץ כי הניסויים, כפי שהוצג במחקר זה עם TK686/TK686-R, נערכות על שושלות היעד כדי לוודא bias לא המתרחשים במהלך לימודי חוקרים טרנספוזון גיוון.

Figure 1
איור 1: Agarose תמונות ג'ל של A) DNA בידוד וספריות רצף ב) הסופי של דגימות עשבייה עשר. במשך כל ליין, שימש µL 3 של ה-DNA או ספריה. דנ א (א) היה מושפל, ומשום עשבייה כל כפי שנראה את השמצות גנרל. ספריות רצף הסופי (B) מתארים להקה העיקרי של 300-500 בסיסים עם הפצה רחבה יותר של 200-1, 000 בסיסים אפשריים; האחרון הוא נפוץ יותר בספריות reamplified. נתיבים עבור שניהם (A) ו- (B) זוהו על ידי דגימה, ניתן להשוות תוצאות בטבלה מס ' 2. סולם גודל תוארה בזוגות בסיס (bp). אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 2
איור 2 : חלקה עגולה של Schizachyrium scoparium הגנום כלורופלסט (TK686) עם ביאור. הגנום שהרכבתם מן הרובה רצף ה-DNA נגזר עשבייה הציג באורך כולל של 139,296 בסיסי זוגות (bp), אזור גדול עותק בודד (ה-LSC) 81,401 bp, אזור חוזר הפוכה (IR) של 22,669 bp, אזור קטן עותק בודד (האס) 12,557 bp. כל הגנים חלבון-קידוד סטנדרטיים, tRNAs ו rRNAs עבור בני שבט Andropogoneae זוהו הביאור. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

בטבלה 2: תוצאות הדנ א החילוץ וספריית הכנה עבור עשר עשבייה דוגמיות וספריות reamplified 4. DNA נטושים זוגי הכולל שונים צעדים בפרוטוקול והפגינו באיכות משתנה? איך יכול להיות, במיוחד כאשר סינון של גודל. אנא לחץ כאן כדי להוריד את השולחן הזה.

טבלה 3: קביעת רצף נתונים סטטיסטיים TK686, את TK686R reamplified. Reamplification אינו משפיע על השכיחות הכוללת של זיהום פטרייתי הגנום, GC תוכן הערכה, הערכת הרכב transposon או היכולת להרכיב כלורופלסט כל הגנום. אנא לחץ כאן כדי להוריד את השולחן הזה.

משלימה טבלה 1: תוצאות הדנ א החילוץ וספריית הכנה עבור 40 דגימות עשבייה נוספים, כולל ספריות reamplified 20- DNA נטושים זוגי הכולל שונים צעדים בפרוטוקול והפגינו באיכות משתנה? איך יכול להיות, במיוחד כאשר סינון של גודל. אנא לחץ כאן כדי להוריד את השולחן הזה.

משלימה איור 1: Agarose תמונות ג'ל של ארבעים ומשום DNA נוספים של עשבייה דגימות. שני (A) ו- (B) מתארים את עשרים ומשום DNA נפרד ומדגימים השפלה האופיינית של DNA נגזר עשבייה. במשך כל ליין, שימש µL 3 של ה-DNA. נתיבים עבור שניהם (A) ו- (B) זוהו על ידי דגימה, ניתן להשוות תוצאות משלימה טבלה 1. סולם גודל מתואר בזוגות בסיס (bp). לבן כתמים על התמונה הן בשל חפצי אמנות םלצה ג'ל זה לא היתה אפשרות להסיר עם ניקוי. אנא לחץ כאן כדי להוריד את הדמות הזו.

משלימה איור 2: Agarose תמונות ג'ל של ספריות ארבעים רצף נוספים מ- DNA נגזר עשבייה. במשך כל ליין, שימש µL 3 של הספריה. רצף הסופי ספריות מצויים שני (A) ו- (B) עם גודל ממוצע של 300-500 בסיסים. להקות משני אצל כמה דגימות מוגבר מציע "מבעבעים" של ספריות. נתיבים עבור שניהם (A) ו- (B) מזוהים באמצעות דגימה, ניתן להשוות תוצאות משלימה טבלה 1. סולם גודל מתואר בזוגות בסיס (bp). אנא לחץ כאן כדי להוריד את הדמות הזו.

משלימה איור 3: Agarose ג'ל תמונה של הלהקה משני הסרת עם שלב ה-PCR מחזור יחיד נוספים- אנא לחץ כאן כדי להוריד את הדמות הזו.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

פרוטוקול המובאת כאן היא שיטה מקיפה וחזק עבור ספריית הכנה של צמחים מיובשים דגימות DNA בידוד וסדר. העקביות של השיטה, מינימלי צורך לשנות אותו מבוסס על יצירת איכות הדגימה זה מדרגי לפרויקטים גדולים מבוססי עשבייה רצף. ההכללה של שלב reamplification אופציונלי עבור ספריות תשואה נמוכה מאפשר הכללת באיכות נמוכה, כמות נמוכה, נדיר, או חשיבות היסטורית דגימות שאחרת לא היה מתאים רצף.

חשיבות התשואה DNA הראשונית
DNA נגזר עשבייה לעיתים קרובות יורד כתוצאה הדגימה הראשונית לשימור11, עם ה-DNA של דגימות פחות מ 300 שנה העתיקה היות מושפלת כמו DNA מבודד שרידי בעלי חיים שנמצאים כמה מאות אלפי בת31 , 32. כתוצאה מכך, אופטימיזציה של התשואה DNA הראשונית היא חיונית בהשגת מספיק dsDNA איכותיים להכנה ספריית רצף מוצלח. זני דשא, התשואה האופטימלית מושגת באמצעות שימוש משולב של חול מעוקר, חנקן נוזלי ב שהטחינה הראשונית צעד, מתן החורבן יסודית יותר של קירות התא ואת שחרורו של חומצות גרעין. גישה זו מגדילה dsDNA גדולה יותר רצוי וגם לא רצוי שברים קטנים יותר (איור 1, משלימה איור 1, בטבלה 2, משלימה טבלה 1). שלבי הניקוי חרוז עוקבות לבודד ולהעשיר על שברי בגודל מתאים על רצף (300 – 500 בסיסים), מאוד לצמצם שחזור אבל גם מועילות גם קטעים ארוכים (טבלה 2, משלימה טבלה 1). שינויים כדי השלבים הראשונים של בידוד ה-DNA, ייתכן שיהיה צורך בהתבסס על שושלת היוחסין להיות נדגמים כדי להפחית את ההשפעות של מטבוליטים משניים על עיבוד במורד הזרם18.

אופטימיזציה של ספריית מתאמים
הריכוז של מתאמים משמש מצדו יש השפעה ישירה על מידת המתאם דיימר בספריות המוגמר. מתאם הדימרים לנבוע מתאם מצדו עצמית כאשר דגימת אין די קיים, לזהם את רצף הרצפים33. DsDNA סה כ נמוך יחסית זמין מ דגימות עשבייה מצריך דילול של מתאמים לפני מצדו. יכול להיות מדולל מתאמים 50-fold מן הריכוז מניות של 15 מיקרומטר (ראו סעיף פרוטוקול) והקלה על תפוקה גבוהה ספריית הכנה ללא הצורך בנפרד למדוד ו לדלל מתאם עבור כל דגימה (בטבלה 2, טבלה משלימה 1). למרות הרוויה של מתאמים יכול עקרונית ירידה התשואה הכוללת ספריה, סביר להניח כי דגימות עשבייה תניב dsDNA כזה עודף של מתאם.

וריאציה של חרוז ניקוי צעדים על תשואות גבוהות
בחירת גודל בהכנה של רצף ספריות נעשית בדרך-כלל לאחר מתאם מצדו, המאפשרות הגברה של קטעים בעיקר בטווח הרצוי; פעולה זו מתבצעת על-ידי הסרת שברי כי הן גדולות יותר קטן יותר מהגודל היעד. הכמות הנמוכה של עשבייה, נגזר dsDNA להכנה הספרייה היא מתעצמת לאחר בחירת גודל בשלב זה, וכתוצאה מכך dsDNA סה כ unworkably נמוך, בסופו של דבר נמוך התשואה בספריה הסופי. על-ידי עריכת צעד חרוז לניקוי רגיל באמצעות 90% נפח חרוזים לאחר מצדו, dsDNA סה כ עוד נשאר העשרה שלב הגברה. שברי DNA קטן מאוד יוסרו מעדיפים שימוש 90% נפח חרוזים. בחירת גודל מבוצע בשלב האחרון על הספרייה מוגבר, אשר מבטיח העשרה בגדלים המקטע הרצוי. יכול להיות מותאם נפחים של חרוזים כדי לבחור את הטווח הרצוי, למרות אמצעי האחסון שני שלבים של 25 µL ו µL 6 של חרוזים המותאמים בצורה מיטבית כדי לאחזר ספריות של 400-500 מוסיף זוג בסיסים בתוך פרוטוקול זה (איור 1B, משלים איור 2).

חילוץ דגימת Reamplification של ספריות
למרות מומלצות ב DNA בידוד והכנת ספריית, ריכוזים הסופי של רצף ספריות עלול להיות למחקר נוסף רצף. הטבע ההרסני של חומר מתכלה מדגם ומוגבל לעיתים קרובות עשבייה דגימות לא תמיד מאפשר חוזרות בידוד ה-DNA. על ידי reamplifying הספריה עד 12 מחזורי PCR נוספים, ספריות עניים מופלגים אפילו יכולים להיגאל. זוג פריימר רגיל משמש עבור הגברה, אשר תואמת או פרוטוקולים ספריה באינדקס כפול או בודד. הדאגה העיקרית של reamplification היא המבוא של הטיה, לעתים קרובות דרך הפחתת בחלקים GC-עשיר של הגנום20. באמצעות פולימראז של אמינות גבוהה (ראה טבלה של חומרים), הטיות אפשריות אלה הם נמנעו באופן פוטנציאלי. הוכח באמצעות וריאציית מינימלי של GC תוכן של הספריות ברצף TK686 ו- TK686-R (טבלה 3). כמו אימות השני, התוכן transposon של TK686 ו- TK686-R היה מוערך, אין כמעט הבדל ניכר (טבלה 3). לבסוף, הגנום כולו כלורופלסט של הצטרפות זו הורכבה TK686 ו- TK686-R, אשר הביא רצפים זהים שלאחר בדיקה מקרוב של וריאציה הסנ פ בין ההרכבות שני (איור 2, טבלה 3). בדיקות אלה מראים מדדים גנומית, תקן זה כמו תוכן GC transposon הרכב, ואת היכולת להרכיב הגנום השלם כלורופלסט, עשוי לא להיות מושפע reamplification. זה פותח את האפשרות של שילוב עשבייה דגימות חשב גם להיות מושפלת או חסר חומר phylogenomic במחקרים ללא חשש להטיה הציג דרך ה-PCR. ספריות אלה reamplified יכול לשמש גם עבור רצף לכידת34, למרות שזה יהיה צורך לבדוק אם הייעוד הסנ פ מגמתיות. מומלץ כי בדיקות בקנה מידה קטן של הטיה להתנהל עם כל פרוייקט כדי לוודא כי הטיה לא מוחדרים רצף ספריות.

מגבלות ושינויים אפשריים
אף-על-פי פרוטוקול זה עבד על מאות דגימות עשבייה, גרוע לשימור רקמות עשויה להיכשל עדיין בשלב כלשהו. היא, לעומת זאת, ונדירה ביותר עבור ספריות להיכשל רקמות עם עקירות הדי מוצלחת, במיוחד אחרי ספריית הצלה דרך reamplification. ניתן לשנות את הצעדים בחירת גודל למטרה שברים בגדלים שונים או להקטין את המגוון הרחב של קטעים ראיתי כמה ספריות הסופי. כמו עם כל הפרוטוקולים המבוסס על צמח חילוץ, צעדים עשוי להיות נחוץ כדי להסיר חומרים משני שושלת היוחסין הספציפי יכול לעכב את פרוטוקול הכולל. כפי שהוצג, פרוטוקול זה מספק שיטה סטנדרטית להכנה DNA בידוד, תפוקה גבוהה ספריית דגימות עשבייה דשא, דרך אימות וניסוי צפוי להיות amendable כדי שושלות צמחים אחרים.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

המחברים מצהירים שיש להם אין אינטרסים מתחרים.

Acknowledgments

אנו מודים טיילור AuBuchon-אלדר, ירדן Teisher, קריסטינה Zudock לעזרה בארגון דגימה עשבייה דגימות, ואת הגן הבוטני מיזורי לגישה עשבייה דגימות לדיגום הרסני. עבודה זו הייתה תמיכה על ידי מענק של הקרן הלאומית למדע (דב-1457748).

Materials

Name Company Catalog Number Comments
Veriti Thermal Cycler Applied Biosystems 4452300 96 well 
Gel Imaging System Azure Biosystems c300
Microfuge 20 Series Beckman Coulter B30137
Digital Dry Bath Benchmark Scientific BSH1001
Electrophoresis System EasyCast B2
PURELAB flex 2 (Ultra pure water) ELGA  89204-092
DNA LoBind Tube  Eppendorf 30108078 2 ml
Mini centrifuge Fisher Scientific 12-006-901
Vortex-Genie 2 Fisher Scientific 12-812
Mortar Fisher Scientific S02591 porcelain
Pestle fisher Scientific S02595 porcelain
Centrifuge tubes fisher Scientific 21-403-161
Microwave Kenmore 405.7309231
Qubit Assay Tubes Invitrogen Q32856
0.2 ml Strip tube and Cap for PCR VWR 20170-004
Qubit 2.0 Fluorometer Invitrogen Q32866
Balance Mettler Toledo PM2000
Liquid Nitrogen Short-term Storage Nalgene F9401
Magnetic-Ring Stand  ThermoFisher Scientific  AM10050 96 well 
Water Bath VWR 89032-210
Hot Plate Stirrers VWR 97042-754
Liquid Nitrogen Airgas UN1977
1 X TE Buffer Ambion AM9849 pH 8.0
CTAB AMRESCO 0833-500G
2-MERCAPTOETHANOL AMRESCO 0482-200ML
Ribonuclease A AMRESCO E866-5ML 10 mg/ml solution
Agencourt AMPure XP Beckman Coulter A63882
Sodium Chloride bio WORLD 705744
Isopropyl Alcohol bio WORLD 40970004-1
Nuclease Free water bio WORLD 42300012-2
Isoamyl Alcohol Fisher Scientific A393-500
Sodium Acetate Trihydrate Fisher Scientific s608-500
LE Agarose GeneMate E-3120-500
100bp PLUS DNA Ladder Gold Biotechnology D003-500
EDTA, Disodium Salt IBI Scientific IB70182
Qubit dsDNA HS Assay Kit Life Technologies Q32854
TRIS MP Biomedicals 103133 ultra pure
Gel Loading Dye Purple (6 X) New England BioLabs B7024S
NEBNext dsDNA Fragmentase New England BioLabs M0348L
NEBNext Ultra II DNA Library Prep Kit for Illumina  New England BioLabs E7645L
NEBNext Multiplex Oligos for Illumina New England BioLabs E7600S Dual Index Primers Set 1
NEBNext Q5 Hot Start HiFi PCR Master Mix New England BioLabs M0543L
Mag-Bind RXNPure Plus Omega bio-tek M1386-02
GelRed 10000 X Pheonix Research 41003-1
Phenol solution SIGMA Life Science P4557-400ml
PVP40 SIGMA-Aldrich PVP40-50G
Chloroform VWR EM8.22265.2500
Ethanol Koptec V1016 200 Proof
Silica sand VWR 14808-60-7
Reamplification primers Integrated DNA Technologies see text
Sequencher v.5.0.1 GeneCodes

DOWNLOAD MATERIALS LIST

References

  1. Savolainen, V., Cuénoud, P., Spichiger, R., Martinez, M. D. P., Crèvecoeur, M., Manen, J. F. The use of herbarium specimens in DNA phylogenetics: Evaluation and improvement. Plant Syst Evo. 197, (1-4), 87-98 (1995).
  2. Zedane, L., Hong-Wa, C., Murienne, J., Jeziorski, C., Baldwin, B. G., Besnard, G. Museomics illuminate the history of an extinct, paleoendemic plant lineage (Hesperelaea, Oleaceae) known from an 1875 collection from Guadalupe Island, Mexico. Bio J Linn Soc. 117, (1), 44-57 (2016).
  3. Teisher, J. K., McKain, M. R., Schaal, B. A., Kellogg, E. A. Polyphyly of Arundinoideae (Poaceae) and Evolution of the Twisted Geniculate Lemma Awn. Ann Bot. (2017).
  4. Cozzolino, S., Cafasso, D., Pellegrino, G., Musacchio, A., Widmer, A. Genetic variation in time and space: the use of herbarium specimens to reconstruct patterns of genetic variation in the endangered orchid Anacamptis palustris. Conserv Gen. 8, (3), 629-639 (2007).
  5. Wandeler, P., Hoeck, P. E. A., Keller, L. F. Back to the future: museum specimens in population genetics. Tre Eco & Evo. 22, (12), 634-642 (2007).
  6. Rivers, M. C., Taylor, L., Brummitt, N. A., Meagher, T. R., Roberts, D. L., Lughadha, E. N. How many herbarium specimens are needed to detect threatened species? Bio Conserv. 144, (10), 2541-2547 (2011).
  7. Saltonstall, K. Cryptic invasion by a non-native genotype of the common reed, Phragmites australis, into North America. PNAS USA. 99, (4), 2445-2449 (2002).
  8. Besnard, G., et al. From museums to genomics: old herbarium specimens shed light on a C3 to C4 transition. J Exp Bot. 65, (22), 6711-6721 (2014).
  9. Särkinen, T., Staats, M., Richardson, J. E., Cowan, R. S., Bakker, F. T. How to open the treasure chest? Optimising DNA extraction from herbarium specimens. PLoS ONE. 7, (8), e43808 (2012).
  10. Harris, S. A. DNA analysis of tropical plant species: An assessment of different drying methods. Plant Syst Evo. 188, (1-2), 57-64 (1994).
  11. Staats, M., et al. DNA damage in plant herbarium tissue. PLoS ONE. 6, (12), e28448 (2011).
  12. Bakker, F. T., et al. Herbarium genomics: plastome sequence assembly from a range of herbarium specimens using an Iterative Organelle Genome Assembly pipeline. Bio J of the Linn Soc. 117, (1), 33-43 (2016).
  13. Camacho, F. J., Gernandt, D. S., Liston, A., Stone, J. K., Klein, A. S. Endophytic fungal DNA, the source of contamination in spruce needle DNA. Mol Eco. 6, (10), 983-987 (1997).
  14. Hofreiter, M., Jaenicke, V., Serre, D., Von Haeseler, A., Pääbo, S. DNA sequences from multiple amplifications reveal artifacts induced by cytosine deamination in ancient DNA. Nucl Acids Res. 29, (23), 4793-4799 (2001).
  15. Staats, M., et al. Genomic treasure troves: Complete genome sequencing of herbarium and insect museum specimens. PLoS ONE. 8, (7), e69189 (2013).
  16. Bakker, F. T. Herbarium genomics: skimming and plastomics from archival specimens. Webbia. 72, (1), 35-45 (2017).
  17. Doyle, J. J., Doyle, J. L. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem Bul. 19, 11-15 (1987).
  18. Allen, G. C., Flores-Vergara, M. A., Krasynanski, S., Kumar, S., Thompson, W. F. A modified protocol for rapid DNA isolation from plant tissue using cetryltrimethylammonium bromide. Nat Prot. 1, 2320-2325 (2006).
  19. Twyford, A. D., Ness, R. D. Strategies for complete plastid genome seqeuncing. Mol Eco Resour. (2016).
  20. Aird, D., et al. Analyzing and minimizing PCR amplification bias in Illumina sequencing libraries. Genome Bio. 12, (2), R18 (2011).
  21. Bolger, A. M., Lohse, M., Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinf. 30, 2114-2120 (2014).
  22. Grigoriev, I. V., et al. MycoCosm portal: gearing up for 1000 fungal genomes. Nucl Acids Res. 42, (1), D699-D704 (2014).
  23. Langmead, B., Salzberg, S. L. Fast gapped-read alignment with Bowtie 2. Nat Meth. 9, (4), 357-359 (2012).
  24. McKain, M. R. Herbarium Genomics. Github Repository https://github.com/mrmckain/ (2017).
  25. McKain, M. R., Wilson, M. A. Fast-Plast: Rapid de novo assembly and finishing for whole chloroplast genomes. Github Repository https://github.com/mrmckain/ (2017).
  26. McKain, M. R., McNeal, J. R., Kellar, P. R., Eguiarte, L. E., Pires, J. C., Leebens-Mack, J. Timing of rapid diversification and convergent origins of active pollination within Agavoideae (Asparagaceae). Am J Bot. 103, (10), 1717-1729 (2016).
  27. McKain, M. R., Hartsock, R. H., Wohl, M. M., Kellogg, E. A. Verdant: automated annotation, alignment, and phylogenetic analysis of whole chloroplast genomes. Bioinf. (2016).
  28. Staton, S. E., Burke, J. M. Transposome: A toolkit for annotation of transposable element families from unassembled sequence reads. Bioinf. 31, (11), 1827-1829 (2015).
  29. Bao, W., Kojima, K. K., Kohany, O. Repbase Update, a database of repetitive elements in eukaryotic genomes. Mobile DNA. 6, (1), 11 (2015).
  30. McKain, M. R. Transposons. Github Repository https://github.com/mrmckain/ (2017).
  31. Weiß, C. L., et al. Temporal patterns of damage and decay kinetics of DNA retrieved from plant herbarium specimens. Royal Soc Open Sci. 3, (6), 160239 (2016).
  32. Sawyer, S., Krause, J., Guschanski, K., Savolainen, V., Pääbo, S. Temporal patterns of nucleotide misincorporations and DNA fragmentation in ancient DNA. PLoS ONE. 7, (3), e34131 (2012).
  33. Head, S. R., et al. Library construction for next-generation sequencing: overviews and challenges. BioTechniques. 56, (2), 61-64 (2014).
  34. Grover, C. E., Salmon, A., Wendel, J. F. Targeted sequence capture as a powerful tool for evolutionary analysis. Am J Bot. 99, 312-319 (2012).

Comments

1 Comment

  1. Thanks for this video!

    Reply
    Posted by: Anony m.
    August 25, 2018 - 10:13 AM

Post a Question / Comment / Request

You must be signed in to post a comment. Please or create an account.

Usage Statistics