Détection d’une variante de transcription Rare CDH1 dans les tissus frais congelés de Cancer gastrique par puce numérique PCR

JoVE Journal
Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Le manuscrit décrit une puce numérique PCR pour détecter une variante rare du transcript CDH1 (CDH1a) en mode normal frais-congelé et tissus tumoraux obtenus de patients atteints de cancer gastrique.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Molinari, C., Abou Khouzam, R., Salvi, S., Rossi, T., Ranzani, G. N., Calistri, D. Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR. J. Vis. Exp. (132), e57066, doi:10.3791/57066 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

CDH1a, un relevé de notes non canoniques du gène CDH1 , s’est avéré être exprimée dans certaines lignées cellulaires de cancer de l’estomac (GC), considérant qu’il est absent dans la muqueuse gastrique normale. Récemment, nous avons détecté CDH1a variante de transcription dans les tissus frais congelés tumeur provenant de patients atteints de GC. L’expression de cette variante dans les échantillons de tissus a été étudiée par l’approche de la PCR (dPCR) en numérique de puce, présentée ici. dPCR offre le potentiel pour une mesure précise, robuste et hautement sensible d’acides nucléiques et est de plus en plus utilisé pour de nombreuses applications dans différents domaines. dPCR est capable de détecter des cibles rares ; en outre, dPCR offre la possibilité pour la quantification précise et absolue d’acides nucléiques sans nécessiter de calibrateurs et courbes d’étalonnage. En fait, la réaction de partitionnement enrichit la cible de l’arrière-plan, ce qui améliore l’efficacité de l’amplification et la tolérance aux inhibiteurs. Ces caractéristiques rendent dPCR un outil optimal pour la détection de la transcription de rares CDH1a .

Introduction

Le gène CDH1 code E-cadhérine, un facteur clé dans le maintien de l’épithélium gastrique normal grâce à la régulation de l’adhérence, la survie, la prolifération et la migration des cellules1. Perte de protéine E-cadhérine par suite de la lignée germinale délétère ou des altérations somatiques de CDH1 a été associées au développement de GC2,3. Non-canonical transcriptions résultant de l’intron 2 du gène ont également émis l’hypothèse pour jouer un rôle dans la cancérogenèse gastrique4,5. En particulier, une telle transcription, CDH1a, s’est avérée être exprimée dans les lignées cellulaires GC mais est absente de l' estomac normal4. Nous avons décelé récemment CDH1a dans des échantillons de tissus de GC de patients GC à l’aide de la puce dPCR5. dPCR a permis d’évaluer, pour la première fois, la présence de la transcription de gène de CDH1a en GC intestinal et dans les tissus normaux.

La méthode de l’étalon-or pour déterminer l’expression des gènes est PCR quantitative en temps réel (qPCR). Toutefois, les données qui en résulte peuvent parfois être variable et de mauvaise qualité, surtout quand le niveau de la cible dans l’échantillon est faible. Cette variabilité peut être causée par des contaminants, qui inhibent l’activité polymérase et apprêt recuit, conduisant à l’amplification non spécifique et compétitif côté réactions6.

Bien que les principes biochimiques de dPCR sont semblables à ceux de qPCR, dPCR montre certains avantages, permettant des mesures très précises de l’ADN génomique (ADNg) / complémentaires des molécules d’ADN (ARNC). En effet, dPCR est une réaction de point d’arrêt qui s’appuie sur le partitionnement calibrée d’un échantillon à des milliers de puits, afin que chacun contient bien zéro ou une molécule cible unique. Amplification puis se produit seulement dans les puits contenant une copie de la cible et est indiquée par un signal fluorescent. Le nombre absolu des molécules cibles dans l’échantillon initial peut ensuite être calculé en déterminant le rapport positif au totales partitions à l’aide de binomial Poisson statistiques7.

En outre, la technique dPCR élimine la nécessité d’une courbe d’étalonnage en cours d’exécution et, par conséquent, le biais associés et la variabilité, ce qui permet une quantification directe de cibles8,9; elle produit des résultats plus précis et reproductibles indépendamment de contaminants et d’efficacité en raison de sa grande tolérance aux inhibiteurs10; Il est plus sensible et plus spécifique que la qPCR et est donc une méthode fiable pour la détection d’une cible rare. Enfin, la répartition de l’échantillon dans plusieurs réactions réduit la compétition avec les molécules de fond et améliore la limite de détection de la cible, permettant l’amplification et de faciliter la détection des molécules simples de l’ADNg/ADNc6 . La détection et la quantification d’acides nucléiques par puce dPCR a été appliquée de plus en plus pour copier le numéro variation, fragments de quantification de l’ADN et analyse de mutation11,12,13, compte tenu de la précision et les matières radioactives faiblement exigence de la méthode d’entrée. En outre, dPCR a récemment été intégré dans l’analyse de ces deux microARN14 et gène transcriptions5,15.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Le protocole suit les directives de l’IRST Human Research Ethics Committee.

Remarque : Cette procédure est spécialement conçue pour la détection d’un faible nombre de molécules de cDNA dans les tissus humains frais congelé. Les sections de tissu ont été coupées sur la glace sèche, alors qu’il est encore gelé, précédemment validé patient dérivé de tumeur gastrique ou des échantillons de tissus normaux.

1. isolement et purification

  1. Extraction de l’ARN
    Remarque : ARN s’effectue sous le capot à l’aide d’un produit spécifique (voir la Table des matières). Cependant, une variété de kits d’isolation sont disponibles dans le commerce.
    1. Homogénéiser 50-100 mg d’échantillon de tissu de frais-congelé finement découpée dans un tube de 1,5 mL avec 1 mL du réactif d’isolement ARN et vortex vigoureusement pendant 15 s. Incuber les tubes à-80 ° C durant la nuit.
    2. Incuber le tube contenant l’échantillon à température ambiante pendant 5 min et mélanger au Vortex pendant 15 s.
    3. Maintenir le tube sur la glace, ajouter 200 µL de chloroforme et vortex vigoureusement pendant 15 s.
    4. Incuber les tubes à température ambiante pendant 60 s et centrifuger à 12 000 x g pendant 15 min à 4 ° C.
    5. Transférer la phase aqueuse dans un tube de 1,5 mL et ajouter 20 µg de glycogène.
      Remarque : Il est important de soigneusement éviter de transférer les interphase ou la couche organique afin de réduire la contamination.
    6. Ajouter 500 µL d’isopropanol, renversant le tube pour mélanger et incuber sur glace pendant 10 min.
    7. Centrifuger le tube à 12 000 g pendant 15 min à 4 ° C à précipiter la RNA.
      Remarque : Les ARN sera présent dans un culot de type gel sur le côté et le bas du tube, souvent invisible après centrifugation.
    8. Retirez le surnageant sans déranger le précipité et lavez-le avec 1 mL d’éthanol 75 % de pipetage.
    9. Centrifuger le tube à 7 500 g pendant 5 min à 4 ° C et retirer le surnageant sans déranger le culot.
    10. Laisser le diabolo sécher jusqu'à ce que le précipité devient transparent et dissoudre dans 50 µL d’eau exempte de RNase.
    11. Congeler les échantillons à-80 ° C au moins une nuit avant de quantification.
  2. Élimination de l’ADN génomique et purification de RNA
    Remarque : Une étape de digestion de DNase, suivie d’une purification de RNA basée sur les colonnes, est recommandée pour les analyses de faible abondance cibles afin de digérer l’ADN contaminant.
    1. Dissoudre la lyophilisé DNase I (1 500 unités de Kunitz) dans 550 µL de RNase-libre de l’eau à l’aide d’une seringue, mélanger doucement en retournant le flacon et diviser la solution reconstituée en aliquotes.
    2. Transférer dans un tube de 1,5 mL le volume calculé d’échantillon avec 15 µg d’ARN, 10 µL de DNase Digestion de la trousse (énumérées dans Table des matières), 2,5 µL de DNase I stock solution tampon et eau exempte de RNase à 100 µL. Incuber à température ambiante pendant 10 min.
    3. Ajouter 350 µL de tampon de lyse tissulaire (dans le kit, voir Table des matières) et de la composition de pipetage.
    4. Ajouter 250 µL d’éthanol à 100 % et mélanger en pipettant également.
    5. Transférer la totalité du volume (700 µL) dans une nouvelle colonne à centrifuger et centrifuger à 12 000 x g pendant 15 s.
    6. Transférer le filtre dans un nouveau tube de prélèvement, ajouter 500 µL d’éthanol à 80 % de la colonne et centrifuger à 12 000 x g pendant 2 min.
    7. Ouvrez le couvercle de la colonne et centrifuger à 12 000 x g pendant 5 min avec un nouveau tube de prélèvement pour sécher le filtre ; transférer ensuite le filtre dans un tube de 1,5 mL.
    8. Ajouter 14 µL d’eau exempte de RNase directement à la colonne de filtrage et centrifuger à 12 000 x g pendant 1 min.
    9. Conserver les échantillons sur la glace et procéder à une quantification à l’aide de 2 µL de l’échantillon sur un spectrophotomètre de table ou stocker l’ARN à-80 ° C jusqu'à l’utilisation.

2. synthèse de cDNA

  1. Place 1 000 ng d’ARN, 4 µL du mélange maître, 1 µL de la transcriptase inverse et RNase-libre de l’eau pour un volume final de 20 µL dans un tube stérile de la PCR. Mélanger doucement et tournez en bas.
  2. Incuber le mélange réactionnel dans un thermocycleur, appliquer les conditions suivantes : 5 min à 25 ° C, 30 min à 42 ° C, 5 min à 85 ° C.
  3. Centrifuger les tubes brièvement et procéder à l’analyse dPCR ou conserver à-20 ° C jusqu'à ce que nécessaire.

3. réaction de PCR numérique mis en place

  1. réaction de dPCR mélanger et préparation des échantillons
    1. Décongeler le master mix et le dosage à température ambiante pendant au moins 20 min.
    2. Diluer les échantillons de cDNA à une concentration de 300 ng dans 6 µL d’eau.
    3. Doucement vortex le capitaine mélanger et préparer le mélange dans un tube stérile avec 1,83 µL d’eau exempte de nucléase 8,7 µL du mélange maître et 0,87 µL de l’amorce de dosage conçu personnalisé CDH1a pour un volume final de 11,4 µL.
      Remarque : Pour plus de détails CDH1a personnalisé conçu Test amorce Voir la Table des matières.
    4. Transfert de 11,4 µL du mélange prêt à l’échantillon dilué cDNA, mélanger doucement et centrifuger brièvement.
      NOTE : Volumes comprennent les excès de 20 % pour compenser la perte de volume de pipetage. Préparer le mélange pour tous les échantillons et un contrôle sans modèle (NTC).
  2. Préparation de la puce
    Remarque : Pour des résultats optimaux charger les puces dès que possible.
    1. Branchez le chargeur de la puce et attendez que le voyant lumineux devient vert.
    2. Retirez le capuchon de la seringue de liquide d’immersion en tirant doucement le piston 1-2 mm et relâchez-le pour faciliter cette étape et le remplacer par un bout.
    3. Prenez une nouvelle puce et prenez note du code écrit sur le couvercle pour l’associer à l’échantillon.
    4. Tenez le couvercle avec soin à ses côtés, Décollez le film protecteur et placer le couvercle avec la face collante vers le haut dans le bon sens.
    5. Avec précaution, ramasser une puce, en prenant soin de ne pas pour toucher la partie interne et charger sur le nid de la puce dans la position correcte en appuyant sur le levier pour ouvrir la pince.
    6. Charger une nouvelle lame de charge sur le chargeur et le pousser doucement pour s’assurer qu’il est fermement en place.
    7. Transférer les 14,5 µL du mélange dPCR réaction sur la lame de chargement sans faire de bulles d’air ou dévier la lame, après qui presse le noir bouton pour distribuer le volume sur la puce de chargement.
    8. Utiliser la seringue de liquide d’immersion pour transférer environ 20 gouttes sur la surface de la puce prenant soin de ne pas pour toucher la surface avec la pointe.
      Remarque : Il est important de couvrir toute la surface sans renverser le liquide sur les bords.
    9. Tourner le bras de chargeur pour faire le couvercle entrent en contact avec la puce et appuyer sur pendant 15 s.
    10. Appuyez sur le bouton du couvercle pour libérer la puce et remettre le bras à sa position.
    11. Maintenez la puce Assemblée à un angle de 45° et soigneusement distribuer le liquide d’immersion avec la seringue dans l’orifice de remplissage, faire pivoter la puce légèrement pour s’assurer qu’aucune bulle d’air et enlever tout excès de liquide avec un chiffon stérile.
    12. Scellez le cas de la puce en douceur épluchant loin l’étiquette sur le dessus le couvercle de la puce et de la presse sur l’orifice de remplissage au moins 5 s.
    13. Stocker la puce dans l’obscurité jusqu’au moment de charger dans le thermocycleur.
      NOTE : Puces préparées doivent être utilisés dans les 2 h.
  3. réaction de dPCR
    1. Ouvrez le couvercle et installez les adaptateurs pour les deux blocs, même lorsqu’un seul bloc est utilisé.
    2. Placez les jetons sur le bloc de l’échantillon dans la position correcte.
      Remarque : L’orifice de remplissage doit être orienté vers l’avant le thermocycleur en position surélevée pour permettre les bulles d’air à flotteur vers le haut sans déranger la fenêtre de la puce. Puces vides permet d’équilibrer les deux blocs.
    3. Posez le pad thermique sur le bloc pour couvrir complètement les puces.
    4. Fermer le couvercle et commencer la PCR exécuter, appliquer les conditions suivantes : tenir à 96 ° C pendant 10 min ; 45 cycles de 60 ° C pendant 2 min et 98 ° C pendant 30 s ; tenir à 60 ° C pendant 2 min ; tenir à 4 ° C. Désactiver le thermocycleur et décongeler les puces à température ambiante pendant au moins 10 min.
      Remarque : Analyse de la puce doit être effectuée dans l’heure.
  4. Analyse de la puce
    1. Ouvrez le couvercle de l’instrument et retirer les protections thermiques, puis enlever les copeaux des adaptateurs.
      NOTE : Conserver les puces dans un endroit sombre et propre jusqu'à l’analyse.
    2. Nettoyer la surface de la puce avec l’alcool isopropylique et un chiffon stérile.
      Remarque : Vérifiez chaque puce de fuites ou de problèmes potentiels.
    3. Insérez la clé USB dans le système de détecteur pour enregistrer les données.
    4. Ouvrir le bac à confettis du système détecteur, charger la puce face vers le haut dans la position correcte et puis fermez le bac.
    5. Attendre 30 s à la transformation, puis retirer la puce et insérer celle qui suit.
    6. Attendez que l’analyse qui doit être rempli pour toutes les puces transformés puis insérer la clé USB dans l’ordinateur pour transférer les fichiers.
      Remarque : La durée totale de l’analyse est environ 2 à 3 min/puce.

4. interprétation et analyse des données

  1. Se connecter à la plate-forme de cloud computing logiciels nécessaire pour effectuer toutes les analyses en aval.
  2. Créez un projet et importer tous les fichiers de données des puces d’intérêt.
  3. Entrez le nom de l’échantillon ; Sélectionnez le colorant et le dosage utilisé dans l’onglet « Définir des jetons ».
  4. Déterminer si la puce est acceptable en visualisant l’il dans l’onglet « Données d’examen », vérifier comment soigneusement l’échantillon a été chargé sur la puce et les points de données combien sont évaluables.
    NOTE : Rejeter les jetons avec moins de 13 000 points de données évaluables.
  5. Aller le diagramme de dispersion de la puce sélectionnée sur le côté droit de l’écran ; appliquer un seuil de 6 000 pour les signaux de colorant fluorescéine amidite (FAM) journaliste (axe y) pour tous les jetons.
    Remarque : Le seuil mis en place peut-être varier selon les tests utilisés.
  6. Supprimer n’importe quel des signaux positifs douteux afin d’éviter des résultats faussement positifs en sélectionnant la place relative sur le scatter plot en utilisant l’outil lasso et en appuyant sur « indéterminée ». Toutes les places restantes de positifs indiquent la présence de copies de cDNA de la cible rare analysés.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

À l’aide de la procédure présentée ici, nous avons vérifié pour l’expression de la variante rare de transcription CDH1a dans les tissus frais congelés gastriques. L’analyse par dPCR a été réalisée sur des échantillons de tissu normal et le cancer 21 paires et dans 11 échantillons de tumeur supplémentaires. CDH1a a été détecté dans 15 des 32 (47 %) des tumeurs, alors qu’aucun échantillon de tissus normaux ont montré la présence de cette transcription rare5. Dans notre analyse, les jetons avec moins de 13 000 points de données ont été rejetées, comme jetons avec chargement non homogènes. La figure 1 montre une puce voir pour tant évaluables (Figure 1 a) et non évaluables (Figure 1 b, C) des échantillons. Dans ce dernier cas, la puce doit être ignorée en raison de la présence de multiples bulles (Figure 1 b), une seule Grosse bulle (Figure 1), ou en raison d’un nombre insuffisant de points de données au-dessus de seuil (Figure 1 b). Ces échantillons doivent être réexécutés pour obtenir des résultats interprétables. En ce qui concerne le diagramme de dispersion fourni par le logiciel (Figure 2), elle représente normalement les signaux émis par le colorant de journaliste FAM (axe y) des signaux parasites de la teinture de journaliste de VIC (propriétaire du fabricant) (axe x). Les points de données présentées sur le diagramme de dispersion sont codés par couleurs, et ici, nous avons visualisé les signaux de colorant de journaliste FAM en bleu (Figure 2 a), seulement indiquant les puits où la cible a été amplifiée. Ces signaux est situés plus près de l’axe y et plus éloigné de l’origine de l’intrigue. La deuxième couleur, vue sur le terrain est jaune et témoigne des puits où s’est produit aucune amplification. Un seuil de fiabilité pour les signaux positifs a été défini et appliqué à tous les jetons pour éviter les biais de l’appel. Ici, le seuil choisi était de 6.000 selon la gamme de signaux observés pour les puces différentes dans ces expériences. CDH1a exemplaires de cDNA (signaux bleus) ont été trouvés dans un certain nombre d’échantillons de tumeur, montrant une nette différence dans l’amplitude des signaux négatifs (Figure 2 a). À l’inverse, aucun signal au-dessus du seuil sélectionné ne trouvées dans les échantillons négatifs CDH1a transcription, c'est-à-dire, tous les échantillons de tissus normaux et quelques échantillons de tumeur (Figure 2 b). De même, aucun des signaux positifs ont été détectés dans le CNT dans lequel l’eau a été ajoutée au lieu de la cDNA, donc servir comme témoin négatif pour la réaction de dPCR (Figure 2).

Une analyse fine puce doivent être appliquées aux points de données de filtre la piètre qualité et éliminer le risque de résultats ambigus. Cela a été fait en affichant la puce afin de déterminer l’emplacement exact du signal positif correspondant : si le signal bleu est situé à la frontière même de la puce (Figure 3 a) ou autour de bulles (Figure 1 b), le signal est rejeté de l’analyse . Pour mieux prévenir le risque de faux positifs, signaux au-dessus de 6 000 pour le canal FAM et à l’extrême droite de l’intrigue sont considérés comme probablement aspécifique et étaient donc filtrées, même si elles ont été localisées dans la puce (Figure 3 b). De cette façon, un échantillon est considéré comme positif pour l’expression de la transcription rare, CDH1a, même si elle montre un signal amplification unique, aussi longtemps que ce signal conforme aux conditions précitées.

Figure 1
Figure 1 . Représentant puces évaluables et non évaluables. Les points bleus sont des puits dans lequel a été amplifiée la transcription de CDH1a ; les points jaunes sont les puits où s’est produit aucune amplification ; les points blancs sont des puits vides. Points de données au-dessus de seuil sont indiqués sous chaque puce. (A) une puce évaluable avec bleu signaux localisés bien au sein des frontières de la puce. (B) une puce non évaluables avec moins de 13 000 points de données au-dessus de seuil. (C) une puce non évaluables avec une grande bulle. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 2
Figure 2 . Représentation numérique PCR des intrigues de CDH1a expression. Parcelles représentent des signaux provenant de la teinture de journaliste FAM (axe y) des signaux parasites de la teinture de journaliste de VIC (axe x). Les points bleus sont des signaux positifs d’expression CDH1a , tandis que les points jaunes sont les signaux « Aucune amplification ». (A) CDH1a-échantillon positif. (B) CDH1a-échantillon négatif. (C) aucun contrôle de modèle (NTC) indiquant zéro expression CDH1a . S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 3
Figure 3 . Parcelles représentant analyse fine-puce de dispersion numérique de PCR. Sur la gauche est la vue de la puce avec les signaux d’intérêt zoomé dans un noir carré, tandis que sur la droite est le nuage de points correspondants. (A) un signal bleu localisé sur la fraction correcte de l’intrigue, mais à la frontière de la puce. (B) trois signaux bleus surlignés en gris, localisé à l’extrême droite de l’intrigue, mais au sein de la puce. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

dPCR a été initialement développé pour ADN moléculaire mesures10,11,12,13 et dans le temps, que cette technologie a été adaptée pour la quantification des microARN et RNA transcription5, 14,15. Dans ce protocole, nous avons étendu la liste des applications à inclure la détection des transcriptions rares provenant d’échantillons de tissus frais congelés. À cette fin, nous avons utilisé un montant assez élevé de l’ADNc (300 ng). Bien que ce montant n’est pas la valeur maximale qui peut être utilisée en dPCR, c’était suffisant pour mettre en place des conditions normalisées comparer tous nos échantillons. En définissant le seuil de signal de fluorescence à 6 000 et occupe l’emplacement des signaux positifs amplification sur la puce et le scatter plot, nous avons détecté avec succès cet objectif rare dans les échantillons de tissu de tumeur gastrique.

Par dPCR, nous ne pourrions absolument pas quantifier CDH1a, en raison d’une très faible quantité de la cible, mais nous pourrions évaluer avec fiabilité la présence/absence de cette transcription rare. En effet, la nature quantitative de cette technique est limitée par le nombre initial de cibles présentes dans les échantillons analysés7. De la pertinence, la technique elle-même reste à exiger beaucoup de temps et assez cher. Ainsi, lorsque l’analyse de nombreux échantillons et/ou de plusieurs cibles est requise, des techniques alternatives devraient être considérés7,8.

Cela étant dit, dPCR sans doute fournit la meilleure plateforme de mesure sensible et quantification des acides nucléiques, car il améliore la précision et la reproductibilité au sujet de qPCR7,8. En outre, on pourrait considérer comme la seule méthode disponible pour analyser l’expression des gènes des acides nucléiques basse-abondants que près de la limite de sensibilité de qPCR6.

Le protocole décrit ici peut être adapté à l’ARN de n’importe quel tissus, permettant la détection des cibles rares, comme dans notre étude. En outre, l’essai pourrait être étendu sur la quantification absolue des transcriptions. Dans ce cas, le nombre de copies/µL, rapporté par l’instrument pour un échantillon donné doit être simplement multiplié par le volume réactionnel chargé et divisé par le montant initial de l’ADNc. Pour pallier la variabilité produite par transcription inverse, calibrateurs de gène-spécifiques devraient être inclus, lorsque cela est possible6. Quant à l’avenir, dPCR détient un potentiel considérable pour devenir la plateforme de l’étalon-or, non seulement pour la détection de séquences rares, mais aussi de détection de mutations rares et copie précise de quantification numéro7. Ceci est particulièrement important dans un mosaïcisme génétique, ainsi que dans la recherche sur le cancer où l’hétérogénéité tumorale peut influer sur les résultats cliniques du patient et la réponse au traitement.

Point de vue pratique, lorsque vous configurez le protocole dPCR il y a plusieurs étapes cruciales qui doivent être mises en évidence. Tout d’abord, le mélange réactionnel contenant la quantité appropriée de l’ADNc basée sur le niveau d’expression cible prévu, doivent être transférées avec beaucoup de soin dans la lame chargement de manière à ne pas créer de bulles d’air, qui pourraient nuire à l’homogénéité de l’échantillon. En outre, la lame elle-même tout d’abord doit être positionnée de façon appropriée ; dans le cas contraire il pourrait entraîner une répartition de l’échantillon inégale. En outre, suffisamment enduit avec immersion fluide et précise d’étanchéité du couvercle doit toujours être effectuée. Au sujet de la puce traitement et l’analyse, il est important d’être conscient de la possibilité d’accumulation de condensation sur la puce ; dans un tel scénario, la puce doit être re-nettoyée avec de l’isopropanol et ré-analysée. En outre, comme dPCR est basé sur les statistiques de Poisson, un nombre minimum de données évaluables points (> 10 000) doit être présent sur la puce, sinon l’exemple doit être exécuté à nouveau. Enfin, pour des expériences de détection cible faible copie, un facteur de confusion critique pourrait être le rapport signal-bruit, mais un positionnement de seuil fiable peut aider à identifier les signaux réels positifs.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs ne rapportent aucun conflit d’intérêt pour ce travail.

Acknowledgments

Les auteurs tiennent à remercier Gráinne Tierney pour aide à la rédaction.

Materials

Name Company Catalog Number Comments
TRIazol Reagent Thermo Fisher Scientific 15596018
Glycogen 20 mg/ml ROCHE 10901393001
RNeasy MinElute Cleanup kit QIAGEN 74204
iScript cDNA Synthesis kit BioRad 1708891
QuantStudio 3D Digital PCR Master Mix v2 Thermo Fisher Scientific A26358
CDH1a IDT custom designed assay Integrated DNA Technologies (IDT) NA F) GCTGCAGTTTCACTTTTAGTG
(R) ACTTTGAATCGGGTGTCGAG
(P)/FAM/CGGTCGACAAAGGACAGCCTATT/TAMRA/
[dPCR optimized assay concentrations: 900 nM (F),        900 nM (R), 250 nM (P)]
QuantStudio 3D Digital PCR 20K Chip Kit v2 Thermo Fisher Scientific A26316
Heraeus Biofuge Fresco Thermo  Scientific 75002402
Thermocycler (Labcycler) Sensoquest 011-103
GeneAmp PCR System 9700 Thermo Fisher Scientific N805-0200
Dual Flat Block Sample Module Thermo Fisher Scientific 4425757
QuantStudio 3D Tilt Base for Dual Flat Block GeneAmp PCR System 9700 Thermo Fisher Scientific 4486414
QuantStudio 3D Digital PCR Chip Adapter Kit for Flat Block Thermal Cycler Thermo Fisher Scientific 4485513
QuantStudio 3D Digital PCR Chip Loader Thermo Fisher Scientific 4482592
QuantStudio 3D Digital PCR Instrument with power cord Thermo Fisher Scientific 4489084

DOWNLOAD MATERIALS LIST

References

  1. van Roy, F., Berx, G. The cell-cell adhesion molecule E-cadherin. Cell Mol Life Sci. 65, (23), 3756-3788 (2008).
  2. Carneiro, P., et al. E-cadherin dysfunction in gastric cancer: cellular consequences, clinical applications and open questions. FEBS Lett. 586, (18), 2981-2989 (2012).
  3. Corso, G., et al. Somatic mutations and deletions of the E-cadherin gene predict poor survival of patients with gastric cancer. J Clin Oncol. 31, (7), 868-875 (2013).
  4. Pinheiro, H., et al. Transcription initiation arising from E-cadherin/CDH1 intron2: a novel protein isoform that increases gastric cancer cell invasion and angiogenesis. Hum Mol Genet. 21, (19), 4253-4269 (2012).
  5. Abou Khouzam, R., et al. Digital PCR identifies changes in CDH1 (E-cadherin) transcription pattern in intestinal-type gastric cancer. Oncotarget. 8, (12), 18811-18820 (2017).
  6. Taylor, S. C., Laperriere, G., Germain, H. Droplet Digital PCR versus qPCR for gene expression analysis with low abundant targets: from variable nonsense to publication quality data. Sci Rep. 7, (1), (2017).
  7. Basu, A. S. Digital Assays Part I: Partitioning statistics and digital PCR. SLAS Technol. 22, (4), 369-386 (2017).
  8. Huggett, J. F., Whale, A. Digital PCR as a novel technology and its potential implications for molecular diagnostics. Clin Chem. 59, (12), 1691-1693 (2013).
  9. Alikian, M., et al. RT-qPCR and RT-Digital PCR: A comparison of different platforms for the evaluation of residual disease in chronic myeloid leukemia. Clin Chem. 63, (2), 525-531 (2017).
  10. Hoshino, T., Inagaki, F. Molecular quantification of environmental DNA using microfluidics and digital PCR. Syst Appl Microbiol. 35, (6), 390-395 (2012).
  11. Salvi, S., et al. Circulating AR copy number and outcome to enzalutamide in docetaxel-treated metastatic castration-resistant prostate cancer. Oncotarget. 7, (25), 37839-37845 (2016).
  12. Tessitore, M. V., et al. Detection of newly produced T and B lymphocytes by digital PCR in blood stored dry on nylon flocked swabs. J.Transl.Med. 15, (1), (2017).
  13. Sho, S., et al. Digital PCR Improves mutation analysis in pancreas fine needle aspiration biopsy specimens. PLoS One. 12, (1), e0170897 (2017).
  14. Conte, D., et al. Novel method to detect microRNAs using chip-based QuantStudio 3D digital PCR. BMC Genomics. 16, 849 (2015).
  15. Sanders, R., Mason, D. J., Foy, C. A., Huggett, J. F. Evaluation of digital PCR for absolute RNA quantification. PLoS One. 8, (9), e75296 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please sign in or create an account.

    Usage Statistics