Oppdagelsen av en CDH1 sjeldne transkripsjon Variant i fersk-frosne magekreft vev av Chip-baserte digitale PCR

JoVE Journal
Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Manuskriptet beskriver en chip-baserte digitale PCR-analysen for å oppdage en sjelden CDH1 transkripsjon variant (CDH1a) i fersk-frosne normal og tumor vev innhentes fra pasienter med magekreft.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Molinari, C., Abou Khouzam, R., Salvi, S., Rossi, T., Ranzani, G. N., Calistri, D. Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR. J. Vis. Exp. (132), e57066, doi:10.3791/57066 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

CDH1a, en ikke-kanoniske transkripsjon av CDH1 genet, har blitt funnet for å uttrykkes i noen magekreft (GC) linjer, mens det er fraværende i normal mage mucosa. Nylig oppdaget vi CDH1a transkripsjon variant i fersk-frosne tumor vev innhentes fra pasienter med GC. Uttrykket i denne varianten i vevsprøver ble undersøkt av chip-baserte digitale PCR (dPCR) tilnærming presenteres her. dPCR tilbyr muligheter for en nøyaktig, robust og svært følsom måling av nukleinsyrer og benyttes stadig for mange programmer i ulike felt. dPCR er i stand til å oppdage sjeldne mål; i tillegg tilbyr dPCR muligheten for absolutt og presis kvantifisering av nukleinsyrer uten behov for kalibratorer og standard kurver. Faktisk beriker reaksjon partisjonering målet fra bakgrunnen, som forbedrer forsterkning toleranse hemmere. Egenskaper gjør dPCR en optimal verktøy for deteksjon av CDH1a sjeldne transkripsjon.

Introduction

CDH1 genet koder for E-cadherin, en nøkkelfaktor som er involvert i vedlikehold av normal mage epitel gjennom regulering av celle vedheft, overlevelse, spredning og migrasjon1. Tap av E-cadherin protein som følge av skadelige germline eller somatiske endringer av CDH1 har vært knyttet til utviklingen av GC2,3. Ikke-kanoniske transkripsjoner fremkommer fra intron 2 av genet har også vært antatt spille en rolle i mage kreft4,5. Spesielt en slik transkripsjon, CDH1a, har vist seg å bli uttrykt i GC cellelinjer men er fraværende fra de normale mage4. Vi har nylig oppdaget CDH1a i GC vevsprøver fra GC pasienter bruker chip-baserte dPCR5. dPCR ble brukt til å vurdere, for første gang, tilstedeværelse av CDH1a genet transkripsjon intestinal GC og normalt vev.

Metoden gullstandarden å bestemme genuttrykk er sanntid kvantitative PCR (qPCR). Men resultatdataene kan være variabel og med dårlig kvalitet, spesielt når målet i utvalget er lav. Denne variasjonen kan være forårsaket av forurensning, som hemmer polymerase aktivitet og primer annealing, fører til ikke-spesifikk forsterkning og konkurrerende side reaksjoner6.

Selv om biokjemiske grunnprinsippene for dPCR er lik de i qPCR, dPCR viser noen fordeler, slik at for svært presise målinger av genomisk DNA (gDNA) / komplementære DNA (cDNA) molekyler. DPCR er faktisk en end-point reaksjon som kalibrert partisjonering av et utvalg i tusenvis av brønner, slik at hver også inneholder null eller et enkelt mål molekylet. Forsterkning så skjer kun i brønnene som inneholder en kopi av målet og er merket med et fluorescerende signal. Absolutte antallet målmolekyler i den opprinnelige prøven kan deretter beregnes ved å bestemme forholdet mellom positive til totalt partisjoner bruker binomiske Poisson statistikk7.

I tillegg dPCR teknikken eliminerer behovet for å kjøre en standard kurve, og derfor den tilknyttede partiskhet og variasjon, slik at for en direkte kvantifisering av mål8,9; Det gir mer presis og reproduserbar resultater uavhengig av forurensninger og effektivitet på grunn av dens høy toleranse hemmere10; Det er mer følsom og spesifikk enn qPCR, og er dermed en pålitelig metode for påvisning av en sjelden mål. Endelig partisjonering av prøven inn flere reaksjoner reduserer konkurransen med bakgrunn molekyler og forbedrer grensen på målgjenkjenning, gjør forsterkningen mulig og tilrettelegging påvisning av enkelt molekyler av gDNA/cDNA6 . Gjenkjennings- og kvantifisering av nukleinsyrer ved chip-baserte dPCR har blitt stadig mer brukt for å kopiere nummer variant kvantifisering av DNA fragmenter og mutasjon analyserer11,12,13, gitt den presisjon og lav materiale input kravet til metoden. I tillegg har dPCR nylig blitt integrert i analyse av begge microRNAs14 og gene transkripsjoner5,15.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Protokollen følger retningslinjene for etikk for første menneskelige forskning.

Merk: Denne fremgangsmåten er spesielt utformet for påvisning av et lavt antall cDNA molekyler i menneskelig frisk-frosne vev. Delene vev kuttet på tørris, mens fortsatt frosset, fra tidligere godkjente pasient-avledede mage svulst eller normal vevsprøver.

1. RNA isolasjon og rensing

  1. RNA utvinning
    Merk: RNA isolasjon utføres under panseret med et bestemt produkt (se Tabell for materiale). Men en rekke isolasjon kits er kommersielt tilgjengelig.
    1. Homogenize 50-100 mg av fint skåret frisk-frosne Vevsprøve i en 1,5 mL tube med 1 mL av RNA isolasjon reagens og vortex kraftig for 15 s. Incubate rør ved-80 ° C over natten.
    2. Inkuber røret som inneholder utvalget ved romtemperatur for 5 min og blanding av vortexing for 15 s.
    3. Holde røret på is, legge til 200 µL kloroform og vortex kraftig for 15 s.
    4. Inkuber rør ved romtemperatur for 60 s og sentrifuger 12.000 x g i 15 min på 4 ° C.
    5. Overføre den vandige fasen i en 1,5 mL tube og legge 20 µg av glykogen.
      Merk: Det er viktig å nøye unngå å overføre noen av interphase eller organisk lag for å redusere forurensning.
    6. Legg til 500 µL av isopropanol, invertere røret for å blande og ruge på is 10 min.
    7. Sentrifuge røret på 12.000 x g i 15 min på 4 ° C til å fremkalle RNA.
      Merk: RNA vil være tilstede i gel-lignende pellets på side og bunnen av røret, ofte usynlig etter sentrifugering.
    8. Fjerne nedbryting uten å forstyrre utløse og vask det med 1 mL av 75% etanol av pipettering.
    9. Sentrifuge røret 7500 x g i 5 min på 4 ° C og fjerne nedbryting uten å forstyrre pellet.
    10. La pellet tørke til bunnfall blir gjennomsiktige og oppløse den i 50 µL RNase uten vann.
    11. Fryse prøvene ved-80 ° C minst natten før kvantifisering.
  2. Genomic eliminering av DNA og RNA rensing
    Merk: En DNase fordøyelsen, etterfulgt av en kolonne-baserte RNA rensing, anbefales for analyser av lav-overflod mål for å fordøye forurensende DNA.
    1. Oppløse den lyofilisert DNase I (1500 Kunitz enheter) i 550 µL av RNase-gratis vann med en sprøyte, bland forsiktig ved å snu ampullen, og dele rekonstituert lager løsningen i dele.
    2. Overføre en 1,5 mL tube av beregnet antall utvalg med 15 µg av 10 µL DNase fordøyelsen buffer fra kit (oppført i Tabell for materiale), 2,5 µL av DNase jeg lagerløsning og RNase-gratis vann til 100 µL. Incubate ved romtemperatur for 10 min.
    3. Legge til 350 µL av vev lyseringsbuffer (fra settet, se Tabellen for materiale) og bland av pipettering.
    4. Legge til 250 µL av 100% etanol og blanding av pipettering.
    5. Overføre hele volumet (700 µL) til en ny spinn kolonne og sentrifuger 12.000 x g 15 s.
    6. Overføre filteret i en ny samling rør, legge 500 µL av 80% etanol til kolonnen og sentrifuger 12.000 x g i 2 minutter.
    7. Åpne lokket av spin kolonne og sentrifuger 12.000 x g i 5 min med en ny samling rør tørke filteret; deretter overføre filteret til en 1,5 mL tube.
    8. Legge til 14 µL av RNase-fritt vann direkte til filter kolonne og sentrifuge 12.000 x g for 1 min.
    9. Holde prøvene på is og videre til kvantifisering bruker 2 µL av utvalget på en benk toppen spektrofotometer eller lagre RNA ved-80 ° C før bruk.

2. cDNA syntese

  1. Sted 1000 ng av 4 µL av master mix, 1 µL revers transkriptase og RNase-fritt vann til et endelig antall 20 µL i et sterilt PCR-rør. Bland forsiktig og spinne ned.
  2. Inkuber reaksjonen blanding i en termisk cycler, bruk følgende: 5 min ved 25 ° C, 30 min ved 42 ° C, 5 min på 85 ° C.
  3. Sentrifuge rør kort og videre til dPCR analyse eller lagre på 20 ° C til nødvendig.

3. digital PCR reaksjon satt opp

  1. dPCR reaksjon bland og prøve forberedelse
    1. Tine master blandingen og analysen ved romtemperatur for minst 20 min.
    2. Fortynn cDNA prøvene å en konsentrasjon av 300 ng i 6 µL av vann.
    3. Forsiktig vortex master bland og klargjør blandingen i et sterilt rør med 8,7 µL av master mix, 0.87 µL av CDH1a tilpasset designet analysen primer og 1.83 µL av nuclease-fritt vann for en endelig mengde 11.4 µL.
      Merk: CDH1a tilpasset designet analysen primer informasjon se Tabellen for materiale.
    4. Overføre 11.4 µL av forberedt blandingen til utvannet cDNA prøven, bland forsiktig og kort sentrifuge.
      Merk: Inkluderer 20% overflødig å kompensere for volum tap fra pipettering. Klargjør blandingen for alle prøver og en ingen mal kontroll (NTC).
  2. Chip forberedelse
    Merk: For optimale resultater legge chips så snart som mulig.
    1. Koble chip loader og vente på indikatorlyset blir grønt.
    2. Fjerne hetten av nedsenking flytende ved å forsiktig trekke tilbake stempelet 1-2 mm og slippe for å rette dette trinnet, og erstatte den med et tips.
    3. Ta en ny chip og ta notat av koden på lokket å knytte den til prøven.
    4. Holde lokket nøye ved siden, skrelle bort den beskyttende filmen og plasser lokket med klebrig ansiktet opp i riktig retning.
    5. Nøye plukke opp en flis, ta vare ikke for å berøre den indre delen, og laste det inn chip reiret i riktig posisjon ved å trykke ned hendelen åpne klemmen.
    6. Laste inn en ny lasting blad på lasteren og skyv den forsiktig å sikre at den sitter godt på plass.
    7. Overføre 14,5 µL av dPCR reaksjonen blanding på lasting bladet uten luftbobler eller avlede bladet, etter hvilke trykk svart lasting for å distribuere volumet på chip.
    8. Bruke nedsenking væske sprøyten for å overføre ca 20 dråper på chip overflaten ta vare ikke for å berøre overflaten spissen.
      Merk: Det er viktig å dekke hele overflaten uten søl væske over kanten.
    9. Rotere loader armen for å gjøre lokket kommer i kontakt med chip og trykke ned 15 s.
    10. Trykk lokket å løslate chip og armen sin posisjon.
    11. Hold samlet chip i 45° vinkel og nøye nedsenking væsken dispensere sprøyten gjennom fyll port, rotere chip litt for å sikre at det er ingen luftbobler og fjerne overflødig væske med en bakteriefri tørke.
    12. Forsegle chip saken ved forsiktig peeling unna etiketten på chip lokket og trykk over fyll porten for minst 5 s.
    13. Lagre chip i mørket helt klar til å laste den termiske cycler.
      Merk: Forberedt chips bør brukes innen 2 t.
  3. dPCR reaksjon
    1. Åpne lokket og installere kortene til begge blokker, selv når en enkelt blokk brukes.
    2. Plass sjetongene på prøven blokken i riktig posisjon.
      Merk: Fyll porten må være orientert mot fronten av termisk cycler i en opphøyet posisjon slik at eventuelle luftbobler å flyte til toppen uten å forstyrre vinduet av chip. Bruk tomme sjetonger for å balansere de to blokkene.
    3. Lå varmeplate på prøven blokken til dekker chips.
    4. Lukk dekslet og starte PCR kjøre, bruk følgende: hold på 96 ° C i 10 min; 45 sykluser av 60 ° C i 2 minutter og 98 ° C for 30 s; Hold på 60 ° C i 2 minutter; Hold på 4 ° C. Slå av termisk cycler og tine chips ved romtemperatur for minst 10 min.
      Merk: Chip analyse må utføres innen én time.
  4. Chip analyse
    1. Åpne lokket på instrumentet fjerne thermal pads, og fjerne flisen fra kortene.
      Merk: Lagre chips i mørke, ren til analyse.
    2. Flaten chip med isopropanol og sterile tømming.
      Merk: Kontrollere hver brikke for lekkasjer eller potensielle problemer.
    3. Sett inn USB i detektor systemet å lagre dataene.
    4. Åpne chipsbrett av detektor, laste chip ansiktet-opp i riktig posisjon og lukk deretter skuffen.
    5. Vent 30 s for behandling, deretter Fjern chipen og sett neste.
    6. Vent til analyse for å fullføre for alle behandlet sjetongene og setter USB til en datamaskin overføre filer.
      Merk: Den totale tiden for analyse er 2 til 3 min/chip.

4. data analyse og fortolkning

  1. Koble til den skybaserte programvareplattform som kreves for å utføre alle nedstrøms analysene.
  2. Opprett et prosjekt og importere alle datafiler sjetongene rundt.
  3. Angi utvalg; Velg fargestoff og analysen brukes i kategorien "Definere Chips".
  4. Avgjøre om brikken er akseptabelt ved å visualisere det i kategorien "Gjennomgang Data" hvor grundig prøven ble lastet inn chip og hvor mange datapunkter er evaluable.
    Merk: Avviser chips med mindre enn 13 000 evaluable datapunkt.
  5. Videre spredningsdiagram av valgte chip på høyre side av skjermen. bruke en terskel på 6000 for fluorescein amidite (FAM) reporter fargestoff signalene (y-aksen) på alle sjetongene.
    Merk: Terskelen definere kan variere på grunnlag av analyser brukes.
  6. Fjern eventuelle tvilsomme positive signaler til å hindre falske positive resultater ved å velge den relative flekken på scatter tegne ved hjelp av lassoverktøyet og trykke på "Ukjent". Alle gjenværende positive flekker indikere tilstedeværelse av cDNA kopier av sjeldne målet analysert.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Ved hjelp av prosedyren som presenteres her, sjekket vi for uttrykket av den sjeldne transkripsjon varianten CDH1a i mage frisk-frosne vev. Analysen av dPCR ble utført på 21-sammenkoblet normal og kreft vevsprøver og i 11 flere svulst prøver. CDH1a var i 15 av 32 (47%) svulster, mens ikke normalt vev-prøver viste tilstedeværelse av denne sjeldne transkripsjon5. I vår analyse, ble chips med mindre enn 13 000 datapunktene avvist, var chips med ikke-homogene lasting. Figur 1 viser en chip Vis for både evaluable (figur 1A) og ikke-evaluable (figur 1B, C) prøver. Når det gjelder sistnevnte, må chip kasseres på grunn av tilstedeværelsen av flere bobler (figur 1B), en enkelt stor boble (figur 1 c), eller som følge av et lite antall datapunkt over terskelen (figur 1B). Disse prøvene må kjøres igjen for å oppnå interpretable resultater. Med hensyn til spredningsdiagram som tilbys av programvaren (figur 2), viser det normalt signalene fra FAM reporter fargestoff (y-aksen) mot signaler fra VIC (produsentens proprietære) reporter fargestoff (x-aksen). Datapunktene presentert på spredningsdiagram er fargekodet og her, vi bare visualisert FAM reporter fargestoff signaler i blått (figur 2A), som angir brønnene som målet ble forsterket. Disse signalene er plassert nærmere y-aksen og videre fra opprinnelsen til handlingen. Den andre fargen sett på tomten er gule og indikativ av der ingen forsterkning oppstod. En pålitelig terskel for positive signaler ble satt, og brukes til alle sjetongene å hindre samtale bias. Her var valgte terskelen 6000 basert på rekke signaler observert i ulike chips i disse eksperimentene. CDH1a cDNA kopier (blå signaler) ble funnet i en rekke svulst prøver, viser en klar forskjell i amplitude fra negative signaler (figur 2A). Derimot ble ingen signaler over valgte terskelen funnet i utvalg negativ for CDH1a avskrift, i.e., alle normale vevsprøver og eksempler svulst (figur 2B). Tilsvarende ble ingen positive signaler oppdaget i NTC som vann ble lagt i stedet for cDNA, dermed tjene som en negativ kontroll for dPCR reaksjonen (figur 2C).

En fin chip analyse må brukes til filteret på lav kvalitet datapunkt og eliminere risikoen for tvetydig resultater. Dette ble gjort ved å vise chip for å finne den nøyaktige plasseringen av det tilsvarende positivt signalet: Hvis blå signalet er plassert på selve grensene av chip (figur 3A) eller rundt bobler (figur 1B), signalet er avvist fra analyse . For å forhindre risikoen for falske positiver, signaler over 6000 FAM kanalen og på høyre side av handlingen ble ansett som sannsynligvis aspecific og var dermed filtrert ut, selv om de ble lokalisert godt innenfor chip (figur 3B). I denne måten som et utvalg positivt for uttrykket av sjeldne karakterutskriften, CDH1a, selv om den viser en enkelt forsterkning signal, så lenge at signal samsvarer med de nevnte vilkårene.

Figure 1
Figur 1 . Representant evaluable og ikke-evaluable chips. De blå prikkene er brønner som CDH1a transkripsjon ble forsterket; gule prikkene er brønner der ingen forsterkning oppstod; Det hvite prikkene er tom brønner. Datapunktene ovenfor terskelen angis under hver flis. (A) en evaluable chip med blå signaler lokalisert godt innenfor chip's grenser. (B) en ikke-evaluable brikke med mindre enn 13 000 datapunktene over terskelen. (C) en ikke-evaluable brikke med en stor boble. Klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2 . Representant digital PCR scatter tomter av CDH1a uttrykk. Tomter skildrer signaler fra FAM reporter fargestoff (y-aksen) mot signaler fra VIC reporter fargestoff (x-aksen). De blå prikkene er CDH1a positive uttrykk signaler, mens gule prikkene er "Ingen forsterkning" signaler. (A) CDH1a-positive eksempler. (B) CDH1a-negativ eksempel. (C) ingen mal kontroll (NTC) viser null CDH1a uttrykk. Klikk her for å se en større versjon av dette tallet.

Figure 3
Figur 3 . Representant fine-chip analyse av digitale PCR scatter tomter. Til venstre er visningen chip signaler om interesse zoomet inn i en svart firkant, mens på høyre er den tilsvarende spredningsdiagram. (A) en blå signal lokalisert på riktig brøkdel av tomten men på grensen av chip. (B) tre blå signaler markert i grått lokalisert på høyre side av tomten, men innenfor chip. Klikk her for å se en større versjon av dette tallet.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

dPCR ble opprinnelig utviklet for DNA, molekylær målinger,10,,11,,12,,13 og i tid denne teknologien ble tilpasset for kvantifisering av microRNAs og RNA transkripsjoner5, 14,15. Vi har utvidet listen over programmer med oppdagelsen av sjeldne transkripsjoner fra frisk-frosne vevsprøver i denne protokollen. Til dette formålet vi utnyttet en ganske stor mengde cDNA (300 ng). Selv om dette beløpet ikke maksimalt som kan brukes i dPCR, var det tilstrekkelig for å sette opp standardiserte forholdene sammenligne alle våre prøver. Ved å angi florescence signal terskelen på 6000 og minding plasseringen av positiv forsterkning signaler på både chip og scatter tomten, oppdaget vi ble dette sjeldne målet i mage svulst vevsprøver.

DPCR, vi kunne absolutt ikke tallfeste CDH1a, på grunn av en svært lav mengde målet, men vi kan sikkert vurdere tilstedeværelse/fravær av denne sjeldne kopi. Faktisk er kvantitative natur denne teknikken begrenset av det opprinnelige antallet mål i de analyserte prøver7. Relevans forblir teknikken seg for å være ganske dyrt og tid intensiv. Dermed når det kreves analyse av mange prøver og/eller flere mål, bør alternative teknikker vurderes7,8.

Som blir sagt, gir dPCR utvilsomt den ultimate plattformen for følsom måling og kvantifisering av nukleinsyrer, siden det forbedrer presisjon og reproduserbarhet med hensyn til qPCR7,8. Videre, det kan anses som den eneste metoden for å analysere genuttrykk av lav-rikelig nukleinsyrer som nær grensen på qPCR følsomhet6.

Protokollen beskrevet her kan tilpasses til RNAs fra alle vev, aktivere gjenkjenning av sjeldne mål, som vår studie. I tillegg kan analysen utvides til absolutt kvantifisering av transkripsjoner. I slike tilfeller må antall kopier/µL rapportert av instrumentet for et gitt utvalg bare multiplisert lastet reaksjon volumet og delt den innledende beløpet av cDNA. For å overvinne variasjon produsert av reverse-transkripsjon, gen-spesifikke kalibratorer skal tas, når mulig6. Ser fremover, har dPCR betydelig potensial i å bli gullstandarden plattformen, ikke bare for sjeldne sekvens oppdagelsen, men også sjelden mutasjon gjenkjenning og presis kopi nummer kvantifisering7. Dette er spesielt relevant i genetisk mosaicism, så vel som i kreftforskning hvor svulsten heterogenitet kan påvirke pasientens kliniske utfallet og respons på behandling.

Fra praktisk synspunkt, når du setter opp dPCR protokollen flere kritiske trinn som må være uthevet. Først av alt, reaksjonen blanding som inneholder riktig mengde cDNA basert på uttrykk målnivået forventet, skal overføres med stor forsiktighet i lasting bladet for ikke å opprette luftbobler, som kan forstyrre eksempel homogenitet. I tillegg bør bladet selv først bli plassert riktig; ellers kan det føre en ujevn eksempel distribusjon. Videre skal tilstrekkelig belegg med nedsenking væske og nøyaktig tetting av lokket alltid utføres. Angående brikke behandling og analyse er det viktig å være klar over muligheten for samler kondens på chip; i et slikt scenario, bør chip være nytt tørkes med isopropanol og re-analyseres. Videre dPCR er basert på Poisson statistikk, et minimum antall evaluable poeng (> 10 000) må være tilstede på chip, ellers utvalget skal kjøres igjen. Til slutt, for lav målet kopi oppdagelsen eksperimenter, en kritisk forvirrende faktor kan være signal-til-støy-forhold, men en pålitelig terskelen posisjonering kan hjelpe i å identifisere ekte positive signaler.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne rapporterer ingen konflikter av interesse for dette arbeidet.

Acknowledgments

Forfatterne ønsker å takke Gráinne Tierney for redaksjonell bistand.

Materials

Name Company Catalog Number Comments
TRIazol Reagent Thermo Fisher Scientific 15596018
Glycogen 20 mg/ml ROCHE 10901393001
RNeasy MinElute Cleanup kit QIAGEN 74204
iScript cDNA Synthesis kit BioRad 1708891
QuantStudio 3D Digital PCR Master Mix v2 Thermo Fisher Scientific A26358
CDH1a IDT custom designed assay Integrated DNA Technologies (IDT) NA F) GCTGCAGTTTCACTTTTAGTG
(R) ACTTTGAATCGGGTGTCGAG
(P)/FAM/CGGTCGACAAAGGACAGCCTATT/TAMRA/
[dPCR optimized assay concentrations: 900 nM (F),        900 nM (R), 250 nM (P)]
QuantStudio 3D Digital PCR 20K Chip Kit v2 Thermo Fisher Scientific A26316
Heraeus Biofuge Fresco Thermo  Scientific 75002402
Thermocycler (Labcycler) Sensoquest 011-103
GeneAmp PCR System 9700 Thermo Fisher Scientific N805-0200
Dual Flat Block Sample Module Thermo Fisher Scientific 4425757
QuantStudio 3D Tilt Base for Dual Flat Block GeneAmp PCR System 9700 Thermo Fisher Scientific 4486414
QuantStudio 3D Digital PCR Chip Adapter Kit for Flat Block Thermal Cycler Thermo Fisher Scientific 4485513
QuantStudio 3D Digital PCR Chip Loader Thermo Fisher Scientific 4482592
QuantStudio 3D Digital PCR Instrument with power cord Thermo Fisher Scientific 4489084

DOWNLOAD MATERIALS LIST

References

  1. van Roy, F., Berx, G. The cell-cell adhesion molecule E-cadherin. Cell Mol Life Sci. 65, (23), 3756-3788 (2008).
  2. Carneiro, P., et al. E-cadherin dysfunction in gastric cancer: cellular consequences, clinical applications and open questions. FEBS Lett. 586, (18), 2981-2989 (2012).
  3. Corso, G., et al. Somatic mutations and deletions of the E-cadherin gene predict poor survival of patients with gastric cancer. J Clin Oncol. 31, (7), 868-875 (2013).
  4. Pinheiro, H., et al. Transcription initiation arising from E-cadherin/CDH1 intron2: a novel protein isoform that increases gastric cancer cell invasion and angiogenesis. Hum Mol Genet. 21, (19), 4253-4269 (2012).
  5. Abou Khouzam, R., et al. Digital PCR identifies changes in CDH1 (E-cadherin) transcription pattern in intestinal-type gastric cancer. Oncotarget. 8, (12), 18811-18820 (2017).
  6. Taylor, S. C., Laperriere, G., Germain, H. Droplet Digital PCR versus qPCR for gene expression analysis with low abundant targets: from variable nonsense to publication quality data. Sci Rep. 7, (1), (2017).
  7. Basu, A. S. Digital Assays Part I: Partitioning statistics and digital PCR. SLAS Technol. 22, (4), 369-386 (2017).
  8. Huggett, J. F., Whale, A. Digital PCR as a novel technology and its potential implications for molecular diagnostics. Clin Chem. 59, (12), 1691-1693 (2013).
  9. Alikian, M., et al. RT-qPCR and RT-Digital PCR: A comparison of different platforms for the evaluation of residual disease in chronic myeloid leukemia. Clin Chem. 63, (2), 525-531 (2017).
  10. Hoshino, T., Inagaki, F. Molecular quantification of environmental DNA using microfluidics and digital PCR. Syst Appl Microbiol. 35, (6), 390-395 (2012).
  11. Salvi, S., et al. Circulating AR copy number and outcome to enzalutamide in docetaxel-treated metastatic castration-resistant prostate cancer. Oncotarget. 7, (25), 37839-37845 (2016).
  12. Tessitore, M. V., et al. Detection of newly produced T and B lymphocytes by digital PCR in blood stored dry on nylon flocked swabs. J.Transl.Med. 15, (1), (2017).
  13. Sho, S., et al. Digital PCR Improves mutation analysis in pancreas fine needle aspiration biopsy specimens. PLoS One. 12, (1), e0170897 (2017).
  14. Conte, D., et al. Novel method to detect microRNAs using chip-based QuantStudio 3D digital PCR. BMC Genomics. 16, 849 (2015).
  15. Sanders, R., Mason, D. J., Foy, C. A., Huggett, J. F. Evaluation of digital PCR for absolute RNA quantification. PLoS One. 8, (9), e75296 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please sign in or create an account.

    Usage Statistics