Generazione del primo cuore campo-come progenitori cardiaci e ventricolare-come cardiomiociti da cellule staminali pluripotenti umane

* These authors contributed equally
Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Qui descriviamo un metodo scalabile, usando una semplice combinazione di activina A e Id1-sovraespressione di lentivirus-mediata, per generare il primo cuore campo-come progenitori cardiaci e ventricolare-come cardiomiociti da cellule staminali pluripotenti umane.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Yu, M. S., Spiering, S., Colas, A. R. Generation of First Heart Field-like Cardiac Progenitors and Ventricular-like Cardiomyocytes from Human Pluripotent Stem Cells. J. Vis. Exp. (136), e57688, doi:10.3791/57688 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

La generazione di grandi quantità di funzionale pluripotenti umane derivate da cellule staminali cardiache progenitori e cardiomiociti di origine campo definito cuore è un pre-requisito per la modellazione di malattia e di terapie basate su cellule cardiache. Abbiamo recentemente dimostrato che i geni di Id sono necessario e sufficiente per specificare i primi progenitori di campo cuore durante lo sviluppo dei vertebrati. Questo protocollo di differenziazione sfrutta questi risultati e utilizza Id1 sovraespressione in combinazione con activina A come potente specificando spunti per produrre prima dei progenitori (FHF-L) campo-come di cuore. D'importanza, progenitori risultanti differenziano in modo efficiente (~ 70 – 90%) in cardiomiociti ventricolari-come. Qui descriviamo un metodo dettagliato per 1) generare Id1-overexpressing hPSCs e 2) differenziare scalabile quantitativi di cryopreservable FHF-L progenitori e ventricolare-come cardiomiociti.

Introduction

Produzione su larga scala di cellule staminali pluripotenti umane (hPSCs)-derivati progenitori cardiaci e nei cardiomyocytes è un pre-requisito per terapie basate sulle cellule staminali1, modellazione2,3 e la caratterizzazione rapida di malattia nuove vie che regolano il differenziamento cardiaco4,5,6 e fisiologia7,8. Sebbene un certo numero di studi9,10,11,12,13,14,15 precedentemente sono descritti altamente efficiente protocolli di differenziazione cardiache da hPSCs, nessuno ha affrontato l'origine del campo di cuore di cardiomiociti risultanti, nonostante l'identificazione delle differenze significative molecolare tra sinistra (primo campo del cuore) e destra (secondo campo del cuore) cardiomyocytes ventricolari16 e l'esistenza di malattie di cuore congenite cuore specifici del settore; cioè, cuore sinistro ipoplasico sindrome17 o aritmogena displasia ventricolare destra18. Così, la generazione dei progenitori cardiaci e cardiomiociti di origine campo cuore definito da hPSCs sta diventando una necessità al fine di aumentare la loro rilevanza come terapeutico e malattia strumenti di modellazione.

Questo protocollo si basa sulla sovraespressione costitutiva di Id1, recentemente identificato5 primo cuore campo specificando spunto che in combinazione con activina A, è necessario e sufficiente per avviare cardiogenesis in hPSCs. In particolare, Cunningham et al. (2017) 5 Visualizza che indotta da Id1 progenitori express specificamente primo campo del cuore (HCN4, TBX5) ma non secondo marcatori di campo di cuore (SIX2, ISL1) come subiscono differenziazione cardiaca. Inoltre, gli autori mostrano anche che gli embrioni di topo transgenico manca l'intera famiglia di Id dei geni (Id1-4), sviluppare senza formare prima cuore campo cardiaco dei progenitori, mentre più mediale e posteriore progenitori cardiaci ( secondo campo del cuore) può ancora formare, suggerendo così che Id proteine sono essenziali per avviare primo cuore cardiogenesis campo in vivo. Convenientemente, progenitori Id1-indotta possono essere crioconservati e spontaneamente differenziare in cardiomiociti visualizzazione ventricolare-come le caratteristiche, compreso l'espressione di marcatori specifici ventricolare (IRX4, MYL2) e ventricolare-come i potenziali di azione.

Qui descriviamo un metodo semplice e scalabile per generare il primo cuore campo-come (FHF-L) cardiaci progenitori e ventricolare-come cardiomiociti da hPSCs overesprimenti Id1. Una caratteristica importante di questo protocollo è la possibilità di disaccoppiare la generazione di cellule progenitrici cardiache da produzione del cardiomyocyte successive utilizzando un passaggio di crioconservazione conveniente. In sintesi, questo protocollo vengono illustrate le operazioni necessarie (1) generare Id1-overexpressing hPSCs, (2) generare progenitori cardiaci FHF-L da hPSCs, (3) crioconservare progenitori risultanti, e (4) riprendere la differenziazione di cellule progenitrici cardiache FHF-L e generare altamente arricchito (> 70 – 90%) battendo ventricolare-come cardiomiociti.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. infezione e preparazione di Virus Id1

  1. Generare il lentivirus overesprimenti Id1 co-trasfettando pCMVDR8.74, pMD2.G e pCDH-EF1-Id1-PGK-PuroR (Addgene: plasmide #107735) nelle cellule HEK293T. Raccogliere le particelle virali, filtrato, purificare dal surnatante e conservare a-80 ° C come Kitamura et al. (2003) 19. in alternativa, produrre Id1 lentivirus commercialmente inviando pCDH-EF1-Id1-PGK-PuroR a un fornitore di produttori di lentivirus.
    Attenzione: Si prega di seguire norme di sicurezza lentivirali e protocolli standard di funzionamento.
    Nota: Importante: titolo del virus ottimale dovrebbe essere almeno 108 109 Transducing unità/mL (TU/mL).
  2. Prima dell'infezione, cappotto un pozzetto di una piastra ben 96 con 50 µ l di reagente di rivestimento, in genere una miscela di proteine gelatinosa secreta dalle cellule di sarcoma di topo Engelbreth-Holm-Swarm (Vedi Tabella materiali).
  3. Dissociare un pozzetto di cellule staminali pluripotenti coltivate in un piatto ben 6 aggiungendo 1 mL di PBS senza Ca2 + e Mg2 + e con 0,5 mM EDTA.
    Nota: Tempo di dissociazione varia da 3 – 10 min. Quando più dell'80% delle cellule sono staccate dal fondo della piastra, procedere al passaggio successivo.
  4. Raccogliere sospensione cellulare con pipetta sterile in provetta plastica centrifuga da 15 mL.
  5. Neutralizzare il reagente di dissociazione con 5 mL di PBS contenente Ca2 + e Mg2 +.
  6. Cellule di pellet per centrifugazione (200 x g per 3 min).
  7. Rimuovere il surnatante e flick delicatamente il tubo per sloggiare il pellet.
  8. Risospendere le cellule in 1 mL di media delle cellule staminali.
  9. Contare le celle utilizzando un contatore di cellule automatizzato seguendo le istruzioni del fornitore.
  10. Cellule vitali piastra 20.000 per rivestito di pozzo (piastra a 96 pozzetti) in 50 µ l di cellule staminali media completati con inibitore di via di 2 µM RHO/ROCK (Vedi tabelle 1 e 2).
  11. Dopo 24 h, monitorare per adesione cellulare e sostituire il supporto con 100 µ l della cellula formativa media completati con 2 inibitore di via di µM RHO/ROCK e 6 ng/mL di bromuro di hexadimethrine (Vedi tabelle 1 e 2), uno h prima dell'infezione lentivirale.
    Nota: Le cellule dovrebbero essere ben fissate alla parte inferiore della piastra.
  12. Scongelare Id1-lentivirus su ghiaccio.
  13. 3 µ l di lentivirus purificato per pozzetto (titolo del virus dovrebbe essere tra 108 109 TU/mL) e poi trasferire la placca incubatrice di coltura cellulare (37 ° C, 5% CO2, 20% O2).
  14. infezione post-virale 24h, aggiungere 100 µ l di media fresco delle cellule staminali in cellule infettate.
  15. infezione post-lentivirali di 48h, Sostituisci virus contenente file multimediali con 200 µ l di cellule staminali fresche media completati con 1 con puromicina µ g/mL.
  16. Aggiornamento media al giorno con 200 µ l di cellule staminali media completati con 1 con puromicina µ g/mL.
  17. Quando culture raggiungono 80% confluency, dissociare le cellule utilizzando 200 µ l di PBS senza Ca2 + e Mg2 + + 0,5 mM EDTA (per un pozzetto di una piastra a 96 pozzetti).
  18. Raccolta di sospensione cellulare in una provetta da centrifuga.
  19. Neutralizzare il reagente di dissociazione con 5 mL di PBS contenente Ca2 + e Mg2 +.
  20. Cellule di pellet per centrifugazione (200 x g per 3 min).
  21. Rimuovere il surnatante e flick delicatamente il tubo per sloggiare il pellet.
  22. Risospendere le cellule in 1 mL di cellule staminali media completati con inibitore di via di 2 µM RHO/ROCK.
  23. Trasferire tutte le celle (1 mL) di un bene di una piastra 12-pozzetti rivestiti.
  24. Dopo 24 h, monitor per il collegamento delle cellule ai media bene e sostituire con 1 mL di cellule staminali media completati con inibitore di via di RHO/ROCK 2 µM e bromuro di hexadimethrine 6 ng/mL, una h prima della trasduzione.
  25. Scongelare Id1-lentivirus su ghiaccio.
  26. Aggiungere 5 µ l di virus purificato per pozzetto (12-pozzetti).
  27. infezione post-lentivirali di 24 h, Sostituisci virus contenente media con 1 mL di cellule staminali fresche media completati con 3 con puromicina µ g/mL.
  28. 48h post infezione lentivirale, sostituire virus contenente media con 1 mL di cellule staminali fresche media completati con 6 con puromicina µ g/mL.
  29. Quando culture raggiungono 80% confluency, dissociare le cellule con 500 µ l di PBS senza Ca2 + e Mg2 + e con 0,5 mM EDTA (per un pozzetto di una piastra 12-pozzetti).
  30. Trasferire la metà (250 µ l) della sospensione cellulare in un pozzetto di un reagente di rivestimento rivestito piastra a 6 pozzetti contenenti 2 mL di cellule staminali media completati con inibitore di via di 2 µM RHO/ROCK.
  31. Utilizzare l'altra metà (250 µ l) del campione per l'estrazione di RNA e qRT-PCR al fine di determinare lentivirali-mediata Id1 i livelli di espressione, come Colas et al. (2012) 4.
    Nota: Importante: se i livelli di espressione di mRNA Id1 sono inferiori a 0,005 piega dei livelli di espressione di GAPDH (vedere tabella 3 per primer qRT-PCR), ripetere il processo di infezione come descritto sopra, fino a quando i livelli di espressione di Id1 superano il soglia.

2. hPSCsId1 manutenzione

  1. Cultura hPSCsId1 a 6 pozzetti-piastre e crescere in 3 mL per pozzetto di cellule staminali media completati con 6 con puromicina µ g/mL.
  2. Quando hPSCsId1 raggiunge 80% confluency, cellule di passaggio come aggregati (rapporto di divisione 1:6) utilizzando il reagente privo di enzima dissociazione seguendo linee guida fornitore e crescere in 3 mL per pozzetto di cellule staminali media completati con 6 con puromicina µ g/mL.

3. preparazione di hPSCsId1 per differenziazione

  1. Ricoprire una piastra 12-pozzetti con 500 µ l di reagente di rivestimento.
  2. Quando hPSCsId1 raggiungere 90% confluency dissociare le cellule aggiungendo 1 mL di PBS senza Ca2 + e Mg2 + e con 0,5 mM EDTA per pozzetto per 5 – 10 minuti controllare il processo di dissociazione ogni minuto, e una volta 80% delle cellule sono dissociate dalla piastra , procedere al passaggio successivo.
  3. Raccolta di sospensione cellulare in una provetta da centrifuga.
  4. Neutralizzare il reagente di dissociazione con 5 mL di PBS contenente Ca2 + e Mg2 +.
  5. Cellule di pellet per centrifugazione (200 x g per 3 min).
  6. Rimuovere il surnatante e flick delicatamente il tubo per sloggiare il pellet.
  7. Risospendere le cellule in 2 mL di cellule staminali media completati con inibitore di via di 2 µM RHO/ROCK.
  8. Contare le celle utilizzando un contatore di cellule automatizzato.
  9. Cellule di piastra 300.000 per pozzetto in 1 mL di cellule staminali media supplementato con inibitore di via di 2 µM RHO/ROCK con puromicina. 6 µ g/mL e piastra di trasferimento incubatore di coltura del tessuto.
  10. Aggiornamento media giornalmente con 2 mL di cellule staminali media completati con 6 con puromicina µ g/mL, fino a raggiungono culture confluency di 90%. A questo punto, avviare differenziazione cardiaca (passo successivo).

4. differenziazione di hPSCsId1 in primo cuore campo-come progenitori cardiaci (FHF-L CPs)

  1. Per il formato 12-pozzetti, avvia differenziazione (giorno 0) sostituendo media delle cellule staminali con 1,5 mL di terreno di induzione (tabella 1) completati con activina A (100 ng/mL) (Vedi tabella 2 per consigliato volumi e activina A concentrazioni per piastra diversi formati).
  2. Il giorno 1 (24 h dopo l'inizio del differenziamento), sostituire il supporto con 2 mL di media di induzione senza activina A (per pozzetto di una piastra 12-pozzetti).
  3. Il giorno 3, sostituzione supporti con 2 mL di media di induzione senza activina A (per pozzetto di una piastra 12-pozzetti).
  4. Il giorno 5, raccogliere FHF-L CPs per la crioconservazione (passo successivo).
    Nota: Importante: crioconservazione è preferito a questo punto, in quanto consente di sganciare la generazione di cellule progenitrici cardiache da successive del cardiomyocyte produzione e biobanca grandi lotti di cellule. Nota che in alternativa, giorno 5 CPs FHF-L può essere passato a un piatto appena rivestito per continuare la differenziazione, fare riferimento ai punti 5.1-5.5 a CPs passFHF-L e quindi procedere a passo 6.5 per differenziazione.

5. Crioconservazione di FHF-L CPs

  1. Aspirare tutti i media da pozzetti contenenti giorno 5 CPs FHF-L e rapidamente aggiungere 1 mL di caldo (37 ° C) 1 x contenenti enzimi reagente di dissociazione (Vedi Tabella materiali). Posizionare la piastra nell'incubatore coltura del tessuto.
  2. Dopo 1 min, agitare la piastra lateralmente nell'incubatrice.
  3. Dopo 2 minuti (tempo totale), rimuovere la piastra dall'incubatrice e aggiungere 1 mL di media di 10% FBS.
  4. Delicatamente dispensare le celle su e giù con una pipetta da 5 mL per facilitare il distacco delle cellule dalla piastra.
  5. Raccogliere la sospensione cellulare delle cellule del tubo e della pallina una centrifuga mediante centrifugazione a 200 x g per 3 min
  6. Risospendere il pellet cellulare in 2 mL di reagente di crioconservazione.
  7. Contare le celle utilizzando un contatore di cellule automatizzato.
  8. Aggiungere il reagente di crioconservazione (Vedi Tabella materiali) ad un volume sufficiente di crioconservare celle a concentrazione desiderata (in genere 5-10 x 106 cellule/mL).
  9. Trasferire le cellule a fiale di crioconservazione e posizionare fiale nel dispositivo (1 ° C/min) di raffreddamento e posizionare il dispositivo di raffreddamento in congelatore a-80 ° C durante la notte.
  10. Dopo 24 h, trasferire flaconcini congelati in azoto liquido per stoccaggio a lungo termine.
    Nota: Il protocollo può essere messo in pausa qui.

6. FHF-L CP differenziazione in cardiomiociti ventricolari-come

  1. Trasferimento fiale FHF-L CPs congelati giorno 5 da deposito di azoto liquido nel contenitore di ghiaccio secco.
  2. Posizionare le fiale in bagnomaria a 37 ° C per 2 o 3 min, fino a sospensione cellulare è sciolto completamente.
    Nota: Importante: il processo di scongelamento è tempo-sensibile. Esponendo le cellule ai media crioconservazione per una quantità eccessiva di tempo (cioè, 10 min) farà diminuire la vitalità cellulare.
  3. Trasferire le cellule a 15 o 50 mL Centrifuga tubo, a seconda del numero di flaconcini scongelati.
  4. Versare goccia a goccia (5 gocce ogni 30 secondi) pre-riscaldata (37 ° C) cardiogeno media (tabella 1) alla soluzione di cella. Continuare questo processo fino a una media di crioconservazione di 1:3: rapporto media cardiogeno è raggiunto. A questo punto, aumentare il tasso di aggiunta di supporti cardiogeno fino a 01:10 media di crioconservazione: cardiogeno media rapporto è raggiunto.
    Nota: Importante: variazioni di osmolarità rapido aumenterà la morte delle cellule durante il processo di scongelamento; Pertanto, aggiunta goccia a goccia di cardiogeno media come descritto sopra è altamente raccomandato.
  5. Centrifugare a pellet e sospensione delle cellule mediante centrifugazione (200 x g per 3 min).
  6. Rimuovere il surnatante e delicatamente flick provetta da centrifuga per sloggiare il pellet cellulare.
  7. Risospendere le cellule con media cardiogeno completati con inibitore di via di 2 µM RHO/ROCK.
    Nota: La vitalità cellulare può variare da disgelo al disgelo e, in generale, > 65% redditività predice l'efficienza buona placcatura.
  8. Diluire concentrato sospensione cellulare con media cardiogeno completati con inibitore di via di 2 µM RHO/ROCK per ottenere la concentrazione di cella desiderata per la placcatura (Vedi tabella 2 per piastra diversi formati).
    Nota: Importante: si noti che l'efficienza cardiaca differenziazione può diminuire se le cellule sono seminate troppo scarsamente.
  9. Cellule di seme sulla piastra.
  10. Tenere la piastra nella coltura del tessuto cappa per 20 min prima di trasferirlo a incubatore di coltura del tessuto.
  11. Il giorno 6 di differenziazione, controllare il collegamento delle cellule.
    Nota: Progenitori cardiaci sono crioconservati il giorno 5 della differenziazione. 24 h dopo lo scongelamento le cellule sarebbe il giorno 6 della differenziazione.
    Nota: La presenza di cellule (morte) galleggiante è comune.
  12. Il giorno 7, aspirare il 50% dei mezzi di comunicazione e sostituire con una pari quantità di fresco cardiogeno media.
    Nota: L'aggiunta di inibitore di via di RHO/ROCK ai media cardiogeno non è necessaria dopo questo punto.
  13. Sostituire il 50% dei mezzi di comunicazione con i media cardiogeno ogni altro giorno.
  14. Nota battendo spontanea che viene visualizzata tra 11 e 13 giorno.
  15. Il giorno 15, quantificare l'efficienza cardiaca differenziazione dall'immunofluorescenza usando DAPI (macchia di nucleo) e gene: ACTC1 (marcatore pan-cardiaco).

7. l'approvazione e la manutenzione di cardiomiociti ventricolari-come

Nota: Di giorno 14 – 16, un monostrato di contrarre spontaneamente cardiomyocytes ventricolari-come dovrebbe essere ottenuto. A questo punto, si suggerisce di dissociare e ri-piastra cardiomyocytes al fine di omogeneizzare la cultura e impedire alle cellule di scollegamento dalla piastra.

  1. Aspirare tutti i media da pozzi e rapidamente aggiungere 1 mL di pre-riscaldata (37 ° C) 1 x contenenti enzimi reagente di dissociazione.
    Nota: 1 x enzima contenente volumi di reagente di dissociazione variano a seconda del formato del piatto, ma deve coprire completamente la parte inferiore della superficie del bene.
  2. Piatto del trasferimento in un incubatore di coltura del tessuto.
  3. Scuotere delicatamente piastra lato ogni 2 min all'interno dell'incubatrice per accelerare il processo di distacco.
  4. Dopo 5 – 15 min, quando 80% al 100% delle cellule sono staccato dal fondo della piastra, rimuovere la piastra dall'incubatrice e inibire enzimi contenenti attività di reagente di dissociazione: 1x aggiungendo un volume uguale di media di 10% FBS.
    Nota: Il tempo di incubazione con dissociazione di enzima-contenente 1 x per questo processo varia da lotto a lotto.
  5. Raccogliere sospensione cellulare in una provetta per centrifuga.
  6. Mescolare la sospensione cellulare con pipetta e conteggio celle utilizzando un contatore di cellule automatizzato.
  7. Diluire la sospensione cellulare alla concentrazione di cella desiderata (Vedi tabella 2 per piastra diversi formati) con mezzi di manutenzione completati con inibitore di via di 2 µM RHO/ROCK.
  8. Dopo la semina cardiomyocytes sulla piastra, distribuire uniformemente le cellule e permettono alle cellule di fissare per 10 – 20 min prima del trasferimento della piastra a incubatore di coltura del tessuto.
  9. 24 h dopo ri-placcatura, monitorare il recupero e collegamento delle cellule.
    Nota: La presenza di cellule (morte) galleggiante è comune. 48 – 72 h dopo ri-placcatura, cardiomyocyte dovrebbe riprendere la contrazione spontanea.
  10. Per mantenere la cultura dei cardiomiociti, sostituire il 50% dei mezzi di comunicazione con mezzi di manutenzione ogni altro giorno fino all'utilizzo di cardiomiociti ventricolari-come per esperimenti successivi.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Generazione di hPSCs ID1 linee
hPSCs sono infettati con un lentivirus che mediano la sovraespressione Id1 (Figura 1A). Una volta che vengono generati hPSCId1 , espressione del transgene è quantificata mediante qRT-PCR (Figura 1B). Solo le lineeId1 hPSC esprimendo Id1 mRNA a livelli superiori a 0,005 piega di quella di GAPDH devono essere utilizzate per differenziazione.

hPSCs ID1 Manutenzione e preparazione per D ifferentiation
Condizioni di coltura ottimale sono necessari e critiche per successo prima differenziazione di cellule progenitrici cardiache di tipo campo (Figura 2A) del cuore. hPSCId1 culture devono essere monitorate quotidianamente per manutenzione di morfologia di staminali e continua proliferazione. La differenziazione deve essere iniziata quando raggiungono le colonie delle cellule staminali strettamente imballate > confluency di 90% (Figura 2B). Se la differenziazione è iniziata prima della confluenza ottima, morte delle cellule è stata migliorata e l'efficienza differenziazione può rifiutare (Figura 2C). Allo stesso modo, invase culture si esibiranno male (Figura 2D).

Generazione del primo cuore campo-come cardiaco progenitori (FHF-L CPs) da hPSCs ID1
Il giorno 1 (iniziazione di differenziazione post 24 h), le cellule devono essere monitorate per osservare perdita della morfologia di staminali (cellule appaiono più piatta e più scuro di cellule staminali). Si noti che la morte delle cellule è comune durante il primo giorno di differenziazione, ma confluenza delle cellule deve essere mantenuto > 75% (Figura 2E). Se dopo 24 h di differenziazione, si perde il 50% o più della superficie coperta, le cellule devono essere eliminate.

Il giorno 3, differenziazione cellule dovrebbero rimanere in cluster e hanno riempito i vuoti creati durante l'iniziale periodo di tempo (Figura 2F) 24h. Piatte cellule crescono in modo indipendente sono indicative di condizioni non ottimali di differenziazione.

Il giorno 4, differenziazione ottimale dovrebbe mostrare in continua espansione e la copertura della piastra.

Il giorno 5, le cellule vengono raccolte e crioconservate. Differenziazioni ottimale dovrebbero risultare in aggregati di cellule strettamente connesso con l'apparenza di morfologia omogenea (Figura 2G). Si noti che i cluster di bassa densità di cellule piatte contrassegno un risultato di differenziazione non ottimali. Vedere la tabella 2 per il rendimento medio di giorno 5 progenitori cardiaci per pozzetto in vari formati della coltura.

Generazione di cardiomiociti ventricolari-come da CPs FHF-L
Giorno 5 FHF-L CPs sono scongelati alle densità di piastra formato-dipendente descritto in tabella 2, al fine di massimizzare il loro potenziale di differenziazione cardiache (Figura 3A e tabella 2). La vitalità dopo lo scongelamento deve essere monitorato. In generale, la redditività varia da 70 – 80%. Se la redditività è inferiore al 60%, è possibile che il rendimento dei cardiomiociti ne risentirebbe.

Il giorno 6 (24 h dopo la riattivazione di differenziazione), dovrebbe coprire CPs FHF-L > 90% del disponibile superficie e appaiono come un unico strato omogeneo delle cellule (Figura 3B). Basso confluenza il giorno 6 ridurrà la differenziazione di FHF-L CPs in cardiomiociti.

Cardiomyocytes risultante iniziare a battere di giorno 11 – 13 di differenziazione (Figura 3C e Movie 1). Durante il processo di replating di giorno 14 – 16, vedere la tabella 2 per il rendimento medio di cardiomiociti per pozzetto in vari formati di cultura. Efficienza di differenziazione è in genere valutata dall'immunofluorescenza per cardiaco (gene: ACTC1), del fibroblasto (TRANSGELIN) e gli indicatori endothelial vascolari (CDH5) e marcatori nucleari (DAPI). Quantificazione di lignaggio viene eseguita mediante quantificazione automatizzata di imaging e fluorescenza, come Cunningham et al. (2017) 5 (Figura 3D-E). Caratterizzazione di sottotipo di cardiomiociti risultanti viene eseguita da qRT-PCR (Figura 3F) e potenziale d'azione transitoria analisi mediante imaging cinetico e sonde (Figura 3G e Movie 2) di controllo di tensione. Quantificazione di fluorescenza per la sonda di tensione e la conseguente analisi di tracce di potenziale di azione (Figura 3H) viene eseguita come descritto in McKeithan et al. (2017) 7.

Figure 1
Figura 1: generazione di hPSCId1 linee. (A) rappresentazione schematica di hPSCsId1 protocollo di ultima generazione. (B) esempi di risultati di qRT-PCR mostrano livelli di mRNA di Id1 rappresentativo generati dall'espressione lentivirali-mediata da linee distinte di hPSCId1 comprendenti una linea di hESC e due linee di hPSC linee. Linea tratteggiata rappresenta la soglia di espressione Id1 , sotto cui hPSCId1 linee devono essere sottoposti a un ulteriore ciclo di infezione Id1-lentivirus. "p" indica il numero di passaggio. Il numero in parentesi indica il numero di giri dell'infezione Id1-lentivirali. Barre di errore rappresentano la deviazione standard di esperimenti condotti in triplicato. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 2
Figura 2: Generazione del primo cuore Field-Like cardiaco progenitori (FHF-L CPs) differenziazione da hPSCId1. (A) rappresentazione schematica del protocollo generazione FHF-L CP. Immagini di campo luminoso rappresentante di hPSCId1 (giorno 0) presso ottimale (B), Sub-confluenti (frecce gialle indicano le regioni sub tra cellule) densità (D) (C) e sovra-confluenti. Rappresentante campo chiaro immagini di differenziazione hPSCId1 al giorno 1, 3 e 5 rispettivamente (E), (F), (G). Barra della scala = 100 µm. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 3
Figura 3: generazione di cardiomiociti ventricolari-come da CPs FHF-L. (A) Rappresentazione schematica del protocollo del cardiomyocyte ventricolare-come generazione. Immagine di campo luminoso (B) delle cellule di differenziazione di giorno 6 (un giorno post-scongelamento). (C) immagine di campo luminoso di una cultura di pestaggio di giorno 12. (D) immagine rappresentativa di immunofluorescenza di 15 culture giorni (formato piastra 384 pozzetti). Gene: ACTC1 segna cardiomiociti, TRANSGELIN: muscolo di fibroblasti/liscio, CDH5: cellule endoteliali vascolari e DAPI: nuclei (mostrati nella rientranza). (E) quantificazione lignaggio di 15 culture giorni. Dati qRT-PCR (F) tempo espressione di corso dal giorno 5 al giorno 25 di marcatori ventricolare-specifici (IRX4 e MYL2) e pan-cardiaco marker (MYL7). (G) rappresentante potenziale d'azione traccia da cardiomiociti ventricolari-come nel giorno 25 di differenziazione. (H) misure durata potenziale di azione (APD50 e APD90) di cardiomiociti ventricolari-come risultante (n = 12). Barre di errore rappresentano la deviazione standard di esperimenti effettuati in quadruplice copia (se non specificato diversamente). Scala bar = 100 µm. RFU, unità di fluorescenza relativa. Clicca qui per visualizzare una versione più grande di questa figura.

Medio Base media Additivo
Media delle cellule staminali mTesR1 n/a
Media di induzione RPMI 1640 Medium B-27 supplemento Serum-Free senza insulina, 1x
Media di induzione RPMI 1640 Medium Con puromicina, 6 µ g/ml
Media di induzione RPMI 1640 Medium Penicillina-streptomicina, 1x
Cardiogeno Media RPMI 1640 Medium B-27 integratore privo di siero, 1 x
Cardiogeno Media RPMI 1640 Medium Penicillina-streptomicina, 1x
Mezzi di manutenzione RPMI 1640 Medium B-27 integratore privo di siero, 1 x
Mezzi di manutenzione RPMI 1640 Medium Sostituzione del siero di knockOut, 2%
Mezzi di manutenzione RPMI 1640 Medium Penicillina-streptomicina, 1x

Tabella 1: Componenti di Media (Vedi tabella materiali per media base e additivi).

384 ben ben 96 12 pozzetti ben 6 100 mm 150 mm
Volume di rivestimento (per pozzetto) 10 Μ l 50 Μ l 500 Μ l 1 mL 5 mL 10 mL
Volume medio
(per pozzetto)
100 Μ l 300 Μ l 2 mL 5 mL 12 mL 30 mL
Differenziazione giorno 0 activin una concentrazione (ng/mL) 100 100 100 300
Progenitrici cardiache
resa di giorno 5
(cellule/pozzetto)
1.0 – 1.2 x 105 2.5 – 3.0 x 105 1.0-1.5 x 107 2,0 – 3,0 x 107
Progenitrici cardiache giorno 5 ricromatura o lo scongelamento di densità (cellule/pozzetto) 2.0 x 104 7,5 x 105 4,5 x 106 8.0 x 106 2.2 x 107
Cardiomiocita ventricolare-come
resa di giorno 14 – 16
(cellule/pozzetto)
2.0 – 5,0 x 104 0.8-1.2 x 106 3.5 – 5,0 x 106 0.8-1.2 x 107 1,8-2,5 x 107
Cardiomiocita ventricolare-come ricromatura densità
(cellule/pozzetto)
2,5 x 104 1.0 x 106 4,5 x 106 1.0 x 107 2.2 x 107

Tabella 2: Parametri di differenziazione scalabile (rivestimento volume, medio volume, concentrazione di activina A, rendimenti, ricromatura densità).

Nome del gene Banca del germoplasma adesione Sequenza
GAPDH NM_001256799 F: GGAGCGAGATCCCTCCAAAAT
R: GGCTGTTGTCATACTTCTCATGG
mouse Id1 NM_010495 F: CCTAGCTGTTCGCTGAAGGC
R: CTCCGACAGACCAAGTACCAC
IRX4 NM_016358 F: GGCTCCCCAGTTCTTGATGG
R: TAGACCGGGCAGTAGACCG
MYL2 NM_000432 F: TTGGGCGAGTGAACGTGAAAA
R: CCGAACGTAATCAGCCTTCAG
MYL7 NM_021223 F: GCCCAACGTGGTTCTTCCAA
R: CTCCTCCTCTGGGACACTC

Tabella 3: sequenze dell'iniettore qRT-PCR.

Movie 1
Movie 1: registrazione di campo luminoso (100 fotogrammi/s) di cardiomiociti giorno 15 dove si possono osservare le contrazioni spontanee. Per favore clicca qui per vedere questo video. (Tasto destro per scaricare.)

Movie 2
Movie 2: Kinetic imaging (100 fotogrammi/s) di tensione-sensibili sonda fluorescente in giorno 25 indotta da id1 ventricolare-come cardiomiociti. Per favore clicca qui per vedere questo video. (Tasto destro per scaricare.)

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Per successo differenziazioni, assicurarsi di seguire attentamente le istruzioni elencate sopra. Inoltre, qui si evidenziano i parametri chiave che influenzano fortemente i risultati di differenziazione. Prima di iniziare una differenziazione, dovrebbero essere osservati i seguenti tre parametri morfologici: una morfologia di staminali di hPSCsId1, un'ad alta compattazione cellulare e una confluenza alta (> 90%) della cultura al giorno 0. A tale proposito, meglio si creano condizioni di differenziazione ottimale di placcatura dissociata hPSCsId1 come cellule singole e consentendo loro di forma strettamente cluster monostrati che crescono alla confluenza del ~ 90% durante il corso di 2-3 giorni. Al contrario, se hPSCId1 culture mostrano povera cella e morfologia di Colonia, Colonia bassa compattazione e la presenza di vaste aree di differenziazione all'interno della cultura, successo differenziazione FHF-L CP sono improbabili.

Volume dei supporti e le concentrazioni di activina A sono parametri critici di FHF-L CP differenziazione e piastra formato-dipendente (vedere tabella 2). Anche notare che concentrazioni ottimali di activina A possono variare a seconda della linea hPSC usati e possono richiedere ottimizzazione di concentrazione.

I livelli di mRNA di ID1 in hPSCs sono cruciali per promuovere in modo efficiente FHF-L CP. suboptimale Id1 livelli riuscirà a produrre robusta differenziazione FHF-L CP e morte massiccia delle cellule di giorno 1 di differenziazione sarà osservata. Il rapporto di espressione relativa Id1- a -GAPDH deve superare 0,005 per promuovere la differenziazione efficiente. Selezione continua utilizzando dosi più elevate di con puromicina (6 – 10 µ g/mL) è consigliato al fine di mantenere elevati livelli di espressione di Id1 lentivirali-mediata. Una valutazione dei livelli di mRNA di Id1 è consigliato ogni 10 passaggi.

Densità del giorno 5 di placcatura FHF-L CPsis anche un parametro critico per l'efficienza cardiaca differenziazione. Se giorno 5 CPs FHF-L sono placcati a densità bassa, il relativo rendimento cardiaco diminuirà. Densità ottimale placcatura sono elencati nella tabella 2 e sono piastra formato-dipendente.

Il limite principale per questo protocollo è l'utilizzo di vettori lentivirali-mediata Id1 sovraespressione alla differenziazione di CP promoteFHF-L che può limitare l'uso terapeutico dei progenitori risultanti e cardiomiociti ventricolari-come. Inoltre, poiché lentivirus potrebbe integrare in siti che poteva potenzialmente influenzare hPSC manutenzione e/o potenziale inerente allo sviluppo, staminalità di hPSCsId1 colonie dovrebbe essere monitorata valutando gambo espressione genica e osservando i segni morfologici di differenziazione. Nota che overexpressing Id1 utilizzando vettori non integranti consentirebbe di superare questa limitazione ed è attualmente oggetto di indagine nel nostro laboratorio.

Una comoda funzione di questo metodo è la semplicità del protocollo differenziazione in quanto richiede solo una citochina, activina A, per generare FHF-L CPs da hPSCsId1. In confronto, altri protocolli 9,10,11,12,13,14,15 richiedono complesse sequenze di combinazioni di citochine e/o piccole molecole al fine di promuovere e mantenere la differenziazione cardiaca. Inoltre, questo protocollo descrive in modo univoco un passo di crioconservazione conveniente che consente a disgiungere la generazione di FHF-L CP dalla produzione del cardiomyocyte successive. Questa funzionalità consente a biobank grandi lotti di FHF-L CPs e di generare rapidamente i cardiomiociti da progenitori congelati, come differenziazione cardiaca riprende dal giorno 5 dopo lo scongelamento. Questa strategia consente di ottenere 1 o 2 settimane di tempo rispetto a partire di differenziazione cardiaca da hPSCs. Inoltre e soprattutto, questo protocollo è il primo protocollo di data per generare progenitori cardiaci di origine campo definito cuore, mentre altri protocolli9,10,11,12 ,13,14,15 rimangono indefiniti in proposito.

In sintesi, questo protocollo viene delineato un metodo affidabile e scalabile per produrre grandi quantità (> 108– 109) inerente allo sviluppo rilevanti FHF-L CPs e ventricolare-come cardiomiociti. A sua volta, le cellule risultante possono essere utilizzate per identificare nuove vie regolarici controllo cardiaca differenziazione e fisiologia e per rigenerativa e malattia ai fini della modellazione.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori non hanno nulla a rivelare.

Acknowledgments

Ringraziamo i membri del laboratorio Colas per utili discussioni e recensioni critiche del manoscritto. Questo studio è stato sostenuto dalla NIH/NIEHS R44ES023521-02 e CIRM DISC2-10110 concede a Dr. Colas.

Materials

Name Company Catalog Number Comments
ACTC1 antibody Sigma A7811
Activin A Stem Cell Technologies Hu Recom Activin A
Antibiotic Antimycotic (Anti-Anti) Thermo Fisher Scientific 15240062
B27 supplement Thermo Fisher Scientific 17504044
B27 supplement w/o - insulin Thermo Fisher Scientific A1895601
B27 supplement w/o - vitamin A Thermo Fisher Scientific 12587001
CDH5 antibody R&D Systems AF938
CryoStor CS10 Stem Cell Technologies 7930 Cryopreservation reagent
DMEM high Glucose Mediatech 10-013-CV 
DPBS w/ Ca & Mg Corning 21-030-CV
EDTA Thermo Fisher Scientific 15575-038
FBS VWR 89510-186
FluoVolt membrane potential kit   Thermo Fisher Scientific F10488 For optical action potential acquisition, please refer to McKeithan et al. 2017
KnockOut Serum Replacement Gibco 10828010
Matrigel, Growth Factor Reduced Corning 356231 Coating reagent
mTeSR1 media kit Stem Cell Technologies 5850
PBS w/o Ca & Mg Corning 21-040-CV
Penicillin-Streptomycin Gibco
Puromycin  Acros 227422500
ReLeSR Stem Cell Technologies 5872 Enzyme-free dissociation reagent
RPMI 1640 Thermo Fisher Scientific 11875-093
TAGLN antibody Abcam ab14106
Thiazovivin Stem Cell Technologies 72254 RHO/ROCK pathway inhibitor
TrypLE Express Thermo Fisher Scientific 12605 -010 1X enzyme-containing dissociation reagent
Tyrodes solution mix packets   Sigma T2145-10X1L (For optical action potential acquisition, please refer to McKeithan et al. 2017)

DOWNLOAD MATERIALS LIST

References

  1. Chong, J. J., et al. Human embryonic-stem-cell-derived cardiomyocytes regenerate non-human primate hearts. Nature. 510, 273-277 (2014).
  2. Kodo, K., et al. iPSC-derived cardiomyocytes reveal abnormal TGF-beta signalling in left ventricular non-compaction cardiomyopathy. Nature cell biology. 18, 1031-1042 (2016).
  3. Kim, C., et al. Studying arrhythmogenic right ventricular dysplasia with patient-specific iPSCs. Nature. 494, 105-110 (2013).
  4. Colas, A. R., et al. Whole-genome microRNA screening identifies let-7 and mir-18 as regulators of germ layer formation during early embryogenesis. Genes & development. 26, 2567-2579 (2012).
  5. Cunningham, T. J., et al. Id genes are essential for early heart formation. Genes & development. (2017).
  6. McKeithan, W. L., Colas, A. R., Bushway, P. J., Ray, S., Mercola, M. Serum-free generation of multipotent mesoderm (Kdr+) progenitor cells in mouse embryonic stem cells for functional genomics screening. Current protocols in stem cell biology. Chapter 1, Unit 1F 13 (2012).
  7. McKeithan, W. L., et al. An automated platform for assessment of congenital and drug-induced arrhythmia with hipsc-derived cardiomyocytes. Frontiers in physiology. 8, 766 (2017).
  8. Sharma, A., et al. High-throughput screening of tyrosine kinase inhibitor cardiotoxicity with human induced pluripotent stem cells. Science translational medicine. 9, (2017).
  9. Burridge, P. W., et al. Chemically defined generation of human cardiomyocytes. Nature methods. 11, 855-860 (2014).
  10. Kattman, S. J., et al. Stage-specific optimization of activin/nodal and BMP signaling promotes cardiac differentiation of mouse and human pluripotent stem cell lines. Cell stem cell. 8, 228-240 (2011).
  11. Laflamme, M. A., et al. Cardiomyocytes derived from human embryonic stem cells in pro-survival factors enhance function of infarcted rat hearts. Nature biotechnology. 25, 1015-1024 (2007).
  12. Lian, X., et al. Robust cardiomyocyte differentiation from human pluripotent stem cells via temporal modulation of canonical Wnt signaling. Proceedings of the National Academy of Sciences of the United States of America. 109, 1848-1857 (2012).
  13. Willems, E., et al. Small molecule-mediated TGF-beta type II receptor degradation promotes cardiomyogenesis in embryonic stem cells. Cell stem cell. 11, 242-252 (2012).
  14. Yang, L., et al. Human cardiovascular progenitor cells develop from a KDR+ embryonic-stem-cell-derived population. Nature. 453, 524-528 (2008).
  15. Palpant, N. J., et al. Generating high-purity cardiac and endothelial derivatives from patterned mesoderm using human pluripotent stem cells. Nature protocols. 12, 15-31 (2017).
  16. DeLaughter, D. M., et al. Single-cell resolution of temporal gene expression during heart development. Developmental cell. 39, 480-490 (2016).
  17. Liu, X., et al. The complex genetics of hypoplastic left heart syndrome. Nature genetics. 49, 1152-1159 (2017).
  18. Corrado, D., Link, M. S., Calkins, H. Arrhythmogenic right ventricular cardiomyopathy. New England journal of medicine. 376, 1489-1490 (2017).
  19. Kitamura, T., et al. Retrovirus-mediated gene transfer and expression cloning: powerful tools in functional genomics. Experimental hematology. 31, 1007-1014 (2003).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics