Eine wirksame Strategie zur Erzeugung von gewebespezifischen binäre Transkription Systeme in Drosophila von Genom-Bearbeitung

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Hier präsentieren wir Ihnen eine Methode zur Erzeugung von gewebespezifischen binäre Transkription Systeme in Drosophila der erste kodierende Exon Gene durch Transkription Treiber ersetzen. CRISPR/Cas9-basierte Methode stellt eine transaktivator Sequenz der endogenen Verordnung eines Gens ersetzt und somit erleichtert Transctivator Ausdruck ausschließlich im Gen-spezifischen räumlich-zeitliche Muster.

Cite this Article

Copy Citation | Download Citations

Du, L., Zhou, A., Sohr, A., Roy, S. An Efficient Strategy for Generating Tissue-specific Binary Transcription Systems in Drosophila by Genome Editing. J. Vis. Exp. (139), e58268, doi:10.3791/58268 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Binäre Transkription Systeme sind genetische Werkzeuge zur Visualisierung und Manipulation Zelle Schicksal und Gen-Ausdruck in spezifischen Gruppen von Zellen oder Geweben in Modellorganismen weit verbreitet. Diese Systeme enthalten zwei Komponenten als separate transgene Linien. Eine Treiber-Linie drückt eine transcriptional Aktivator unter der Kontrolle der gewebespezifische Promotoren/Enhancer und ein Reporter/Effektor Linie Häfen ein Zielgen flussabwärts die Bindungsstelle des Aktivators Transkription platziert. Tiere beherbergen beide Komponenten induzieren gewebespezifischen werden von einem Ziel-Genexpression. Präzisen raumzeitlichen Expression des Gens in gezielte Geweben ist entscheidend für unvoreingenommene Auslegung der Zelle/Genaktivität. Daher ist es wichtig, ein Verfahren zur Erzeugung von exklusiven Zelle/Gewebe-spezifische Treiber Linien zu entwickeln. Hier präsentieren wir Ihnen eine Methode, um Gewebe hochspezifische gezielte Expressionssystems erzeugen durch den Einsatz einer "gruppierten regelmäßig Interspaced kurze palindromische Repeat/CRISPR-assoziierte" (CRISPR/Cas)-Genom Bearbeitung Technik basiert. Bei dieser Methode die Endonuklease, die Cas9 durch zwei Chimären ausgerichtet ist guide RNAs (gRNA) auf bestimmte Websites im ersten kodierenden Exon eines Gens im Genom Drosophila Doppel-strangbrüchen (DSB) zu erstellen. Anschließend ermöglicht die Verwendung eine exogene Spender Plasmid mit dem transaktivator-Sequenz, die Zelle-autonome Reparatur-Mechanismus unter der Regie von Homologie Reparatur (HDR) des DSB, was präzise löschen und durch die transaktivator zu ersetzen das exon Sequenz. Klopfte in transaktivator äußert sich ausschließlich in den Zellen wo der Cis-regulatorische Elemente des Gens ersetzt sind funktionsfähig. Das detaillierte Schritt für Schritt Protokoll hier vorgestellten zur Erzeugung von binären transkriptionelle Fahrer ausgedrückt in Drosophila Fgf/astlosen-produzierenden epithelialen/neuronalen Zellen für jedes Gen oder gewebespezifische Ausdruck angenommen werden kann.

Introduction

Die genetische Toolbox für gezielte Genexpression wurde gut in Drosophila, so dass es eines der besten Modellsysteme, die Funktion von Genen, die in einer Vielzahl zellulärer Prozesse zu untersuchen. Binäre Expressionssysteme wie Hefe Gal4/UAS (upstream Aktivierung Sequenz), wurde zuerst angenommen, für gewebespezifischen Enhancer Trapping und gen Misexpression in Drosophila genetischen Modell1 (Abbildung 1). Dieses System erleichtert die Entwicklung einer Vielzahl von Techniken wie räumlich-zeitliche Regelung der Überexpression des Gens, Misexpression, ko in ausgewählten Gruppen von Zellen als auch in Zelle Ablation, Zelle markieren, live Verfolgung der zellulären und molekularen Prozesse im Embryo und Gewebe, Linie nachzeichnen und Mosaik Analysen während der Entwicklung. Eine Reihe von binären Transkription System, z. B. bakterielle LexA/LexAOp -System (Abbildung 1) und Neurospora Q-System, sind genetische Werkzeuge, die jetzt häufig in Drosophila, zusätzlich zu das ursprüngliche Gal4/UAS-System für gezielte Gen Ausdruck1,2,3.

Hier präsentieren wir Ihnen eine Methode um hochzuverlässige gewebespezifischen binäre Expressionssystems zu erzeugen, durch den Einsatz einer Genom-Bearbeitung Technik. Die jüngsten Fortschritte in der CRISPR/Cas9 Genom Bearbeitung Technologie konnten nie da gewesene Möglichkeiten gerichtete Genom Änderungen in einer Vielzahl von Organismen. Im Vergleich zu den anderen verfügbaren Genom Schnitttechniken, ist das CRISPR/Cas9-System Kostengünstig, effizient und zuverlässig. Diese Technologie nutzt Komponenten des adaptiven Immunsystems bakterielle: ein Cas9 Endonuklease Streptococcus Pyogenes , die eine Doppel-Strang-Pause (DSB) erstellt und eine Chimäre Reiseführer RNA (gRNA), der die Cas9 führt zu einer bestimmten Genom-Website für gezielte DSB4. Die Zellen enthalten die Maschinen um die DSB über verschiedene Wege zu reparieren. Nicht-homologe Ende verbinden (NHEJ) führt zu kleinen Einfügungen oder Löschungen Genfunktion, zu stören, während unter der Regie von Homologie Reparatur (HDR) einen definierten gerichtet/wünschenswert genomischen Knock-in/Knock-out führt durch eine exogene HDR-Spender als Vorlage verwenden. Die HDR-basierte Strategie kann effizient genutzt werden, um eine äußerst zuverlässige gewebespezifischen binärer Ausdruck System zu erzeugen, die die Grenzen der traditionellen Enhancer-Trap-Methoden überwinden können. Wir beschreiben eine schrittweise Anleitung zur Nutzung der CRISPR/Cas9-basierte HDR Reparatur bei der Erzeugung einer binären Transkription Treiber-Linie, die unter der Kontrolle der endogenen transkriptionellen und posttranskriptionelle Verordnung von einem Drosophila ausgedrückt wird gen. In diesem Protokoll zeigen wir die Generation einer Fahrer-Linie speziell für astlosen (Bnl) Gen Kodierung eine Familie FGF-Protein, das verzweigte Morphogenese von trachealen Atemwege Epithel5regelt. In diesem Beispiel das erste kodierende Exon des Gens Bnl wurde ersetzt durch die Folge einer bakteriellen LexA transaktivator Sequenz unbeschadet einer endogenen Cis-regulatorischen Sequenzen des Bnl -Gens. Wir zeigen, dass die Strategie eine Bnl-LexA Fahrer Linie erzeugt, die raumzeitlich den Ausdruck ein Reportergen platziert hinter der LexAoperator (LexAop oder LexO) ausschließlich in Bnl steuert- mit dem Ausdruck epitheliale/Mesenchymale/neuronalen Zellen.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. entwerfen und konstruieren gRNA Expressionsvektor

  1. Um genau eine lange definierte Region ein Exon ersetzen, verwenden Sie eine doppelte gRNA Ansatz6, in denen jeder gRNA zwei Enden des ausgewählten Bereichs von Interesse gezielt kann. Um eine genaue Gen-spezifischen räumlich-zeitliche Ausdruck des Fahrers zu erhalten, wählen Sie zwei gRNA Ziel-Sites innerhalb der ersten kodierenden Exon des Gens.
  2. Wählen Sie für Drosophila Melanogasterdie gRNA Ziel-Sites mit dem FlyCRISPR optimalen Ziel-Finder-Tool (http://tools.flycrispr.molbio.wisc.edu/targetFinder/). Andere verfügbare CRISPR-Design-Tools verwendet werden, einschließlich der optimiert CRISPR-Design-Tool (http://crispr.mit.edu), FlyCas9 (https://shigen.nig.ac.jp/fly/nigfly/cas9), und E-CRISP (www.e-crisp.org/E-CRISP).
    Hinweis: Die folgenden Protokolle gRNA Design und Klonen wurde angenommen von Methoden zuvor beschriebenen6,7.
    1. Kopiere die tatsächliche Reihenfolge in das online-Tool zur Verfügung gestellt. Wählen Sie die zuletzt veröffentlichte Drosophila Melanogaster Genom Anmerkung Version, "r_6," im Dropdown-Menü "Select Genom." Geben Sie in das Feld "Select Führungslänge (nt)," "20." Wählen Sie "Alle CRISPR Ziele" zu finden und klicken Sie auf "Finden CRISPR Ziele".
    2. Bewerten Sie alle Kandidaten gRNA Ziele durch die Festlegung "Maximum" für "Strenge" und "NGG nur" für "PAM". Versuchen Sie die gRNA Websites ohne jede mögliche off-Ziele oder eine Mindestanzahl von off-Ziele möglich auszuwählen. Nutzung der Web-Tool beschrieben in Doench Et Al. 2014 8 um gRNAs mit einer potentiellen "gut" Aktivitätspunkte auszuwählen.
    3. Sicherzustellen Sie gleichzeitig, dass es kein Einzel-Nukleotid Polymorphie in gRNA Ziele im Genom der Ausgangslinie fliegen für Injektion (Z.B. Nein-Cas9 auf Chromosom X, BL # 54591) ausgewählt. Folgen Sie das Protokoll beschrieben in Gratz Et Al. 20157 , die genomische DNA aus der übergeordneten Fliegenschnur zu extrahieren. PCR zu verstärken, etwa 500 – 1.000 nt Regionen mit Grundierungen, die die Abfolge von Interesse und eine HiFi-DNA-Polymerase flankieren; Sequenz-überprüfen Sie die PCR verstärkt Produkte.
  3. Für die Erzeugung von einem Tandem gRNA Expressionsvektor, folgen einer Ligatur-unabhängige Klonen Protokoll6 um zwei Protospacer Sequenzen in einem pCFD4 RNA Expressionsvektor einzuführen. Beachten Sie, dass eine verbesserte Multi-gRNA Expressionsvektor (pCFD5) jetzt verfügbar ist, wo beide die SgRNAs von stark U6:3 Promotoren9 (https://www.crisprflydesign.org) ausgedrückt werden. Verwenden Sie eine DNA-Montage-Methode, um die gRNAs in den pCFD4-Vektor zu klonen.
    1. Gestalten und bestellen Sie die Forward- und reverse Primer für die Einführung von zwei Protospacer-Sequenzen in der RNA Ausdruck Vektor pCFD4 (Tabelle 1A). Wie zuvor beschrieben6enthält der forward Primer die erste Protospacer-Sequenz flankiert von Regionen entsprechend der U6-1-Promoter und gRNA Kern in pCFD4; die rückwärts-Primer enthält die umgekehrte Ergänzung Abfolge von der zweiten Protospacer, flankiert von Regionen entsprechend der gRNA Kern und U6-3 Promotor in pCDF4.
    2. Aufschwemmen Sie Primer an 100 μM mit DNase und RNase-freie doppelt destilliertem Wasser (DdH2O). Machen Sie eine 10 μM arbeiten Konzentration Grundierung. PCFD4 Plasmid als Vorlage verwenden und PCR-Reaktion mit einer High Fidelity Polymerase und empfohlenen Einstellungen für PCR Reaktion6eingerichtet.
    3. Um der verstärkten Produkt in pCFD4 zu klonen, verdauen pCFD4 Plasmid mit BbsI Enzym durch die Einrichtung der folgenden Reaktion: 2 – 5 μg pCFD4 Plasmids, 5 μL 10 x Verdauung Puffer, 1 μL der BbsI Enzym und DdH2O 50 μL Endvolumen bringen. Mischen Sie Reaktion von sanft durch Tippen auf das Rohr und sammeln die verstreuten Tröpfchen von der Wand des Rohres an der Unterseite durch eine kurze Spritztour. Inkubieren Sie die Reaktion Mischung bei 37 ° C für 2 h.
    4. Führen Sie das PCR-Produkt aus Schritt 2 und das verdaute Produkt aus Schritt 3 auf einem 1 % Agarose-Gel. Führen Sie die Elektrophorese für genug Zeit, um die DNA-Bänder vollständig zu trennen. Schnitt die richtige Größe DNA-Bänder unter einer UV-Trans-Illuminator vor der erwarteten Produkte mit Gel Elution Spalte nach Anweisungen des Herstellers zu reinigen (siehe Tabelle der Materialien). Das PCR-Produkt sollte 600 bp und die linearisierte pCFD4 Plasmid sollte ~6.4 kb 6sein.
    5. Richten Sie die DNA Montage Reaktion in einem PCR-Röhrchen pro Anweisungen des Herstellers (siehe Tabelle der Materialien).
    6. Zuständigen Bakterien (DH5α oder ähnliche Stämme mit ΔrecA1, ΔendA1) 2 μL des Produktes Montage verwandeln, Platte auf Ampicillin (100 μg/mL) mit LB (LB/Amp) Agarplatten und über Nacht bei 37 ° C inkubieren. Beachten Sie, dass die DNA Montage Mischung möglicherweise giftig für bestimmte Bakterienstämme, aber verdünnen den Versammlung Mix die Toxizität reduziert.
    7. Wählen Sie 3 – 4 Ampicillin-resistente Kolonien von der Platte über Nacht inkubiert, impfen Sie die Kolonie in 3 mL LB mit 100 μg/mL Ampicillin und wachsen Sie beimpfte Bakterien in einem Shaker 37 ° C über Nacht. Übernachtung-kultivierte Bakterien mit dem Plasmid Mini-Prep Kit nach Anweisung des Herstellers Plasmid entziehen (siehe Tabelle der Materialien).
    8. Reihenfolge der Plasmide mit T3 universal Primer zum Bildschirm für die richtige Klone mit dem Tandem gRNA einsetzen. Etablieren Sie einen Glycerin-bestand von Bakterien mit einer Sequenz verifiziert pCFD4-gRNA in 20 % Glycerin und Shop in einem-80 ° C Gefrierschrank für die zukünftige Verwendung verwandelt.

2. entwerfen und konstruieren des HDR-Spenders

  1. Entwerfen Sie für genomische Knock-in einer Sequenz Gal4 oder LexA einen doppelsträngige HDR Spender mit dem transaktivator Sequenz flankiert von zwei Armen der Homologie.
    1. Nutzung > 1,5 kb Links und rechts Homologie Arme flankieren das gRNA targeting Webseite(n). Erweiterte Homologie Arme steigern die Effizienz von HDR während der Reparatur-Prozess- 10.
    2. PCR verstärken die Homologie Arme aus genomischer DNA (gDNA) extrahiert aus der übergeordneten Fliegenschnur ausgewählt für die Injektion (Z.B. Nein-Cas9 (auf Chromosom X), BL # 54591). Ein Korrekturlesen hot Start Taq-DNA-Polymerase Enzym geeignet für PCR-Erweiterung zu verwenden (siehe Tabelle der Materialien). Sequenz zu überprüfen.
  2. Um zu vermeiden, retargeting von gRNA, veränderter Locus, design der Ersatz-Spenders in einer Weise, dass gRNA Anerkennung Websites durch die exogene Sequenz eingeführt gestört sind.
    Hinweis: um zu vermeiden, die vermeintliche Cis-regulatorische Elemente zu verändern, wählen Sie immer die gRNA Anerkennung Standorte innerhalb der kodierenden Exon-Region.
  3. Zur Erzeugung einer Ersatz-Kassette, planen die DNA Montage Strategie vier Segmente miteinander zu verbinden: die 5' und 3' Homologie Arme, die mittleren exogenen transaktivator DNA-Sequenz und die linearisierte klonen Vektor Rückgrat (z. B. pUC19 oder andere häufig verwendete Klonen Vektoren). Anschluss des Herstellers Leitlinie für DNA-Montage (siehe Tabelle der Materialien), die geeigneten Primer für PCR-Amplifikation und Montage der einzelnen Segmente zu entwerfen. Primer zu 100 μM mit DdH2O. Make 10 μM arbeiten Konzentration Grundierung aufzuwirbeln. Verwenden Sie High Fidelity Polymerase für die PCR-Reaktionen. Führen Sie das folgende Protokoll:
    1. PCR verstärkt eine Gal4 oder LexA Expressionskassette aus einer verfügbaren Vektor (z. B. Nls-LexA:p65; die ideale Gal4/LexA/QF2 Ausdruck Plasmide können gefunden und gemeinsame Ressourcen wie Addgene entnommen) mit der Grundierungen, die in Tabelle 1 baufgeführt.
      1. Alle ursprünglichen transkriptionellen und posttranskriptionelle Verordnungen ersetzt Exon auf die Expression von transaktivator DNA-Sequenz zu behalten, entwerfen die Kassette in einer Weise, dass das bearbeitete genomische Allel eine Chimäre mRNA ausdrücken würde von der transaktivator und dem Gen. Bewahren Sie die 5' und 3' Ende der gezielten Exon, kein Spleißen Signal zu behalten.
      2. Integrieren Sie ein T2A selbst anhaftenden Peptidsequenz zwischen den Rest 5' Codierung Exon und die transaktivator-Sequenz, die Übersetzung in ein chimäres Protein zu verhindern. Fügen Sie ein Stopcodon Übersetzung nach der exogenen transaktivator Sequenz (Abbildung 5).
    2. PCR verstärken die Homologie Arme aus genomischer DNA (gDNA) extrahiert aus der übergeordneten Fliegenschnur ausgewählt für die Injektion (Z.B. Nein-Cas9 (auf Chromosom X), BL # 54591) unter Verwendung der Zündkapseln in Tabelle 1 baufgeführt. High Fidelity Polymerase für die PCR-Reaktionen mit den Systemen wie folgt zu verwenden: 5 μL von 5 x Reaktion Puffer, 0,5 μl 10 mM dNTPs, 1,25 μl von 10 μM Forward Primer, 1,25 μl von 10 μM Reverse Primer, 0,5 μL der Schablone DNA, 0,25 μl der High-Fidelity-DNA-Polymerase , 16,25 μL der DdH2O.
    3. Verwenden Sie linearisierte klonen Vektor wie pUC19. Eine Reihe von Spender-Vektoren sind nun verfügbar. Eine umfassende Liste auf der folgenden Webseite http://flycrispr.molbio.wisc.edu zu sehen.
    4. Führen Sie die PCR-Produkte auf einem 1 % Agarose-Gel. Führen Sie die Elektrophorese für genug Zeit, um eine klare Trennung der gewünschten Band aus den unerwünschten unspezifische Banden (falls vorhanden) zu gewährleisten. Gel-die erwarteten DNA-Fragmente zu reinigen. Messen Sie die Konzentration von gereinigte DNA-Fragment mit einem Spektralphotometer.
    5. Richten Sie die DNA Montage Reaktion nach Anweisungen des Herstellers. Mischen Sie die linearisierte klonen Vektor und Ziel-Fragmente aus Schritt 3 und Schritt 4 in die folgende Reaktion: 1 μL der linearen klonen Vektor (50 ng/μl), 2 – 3 fache Übermaß an jedes Ziel Fragment, 10 μL 2 x DNA Montage master-Mix, bringen 20 μl mit DdH das endgültige Reaktionsvolumen < C21 > 2O. Incubate Reaktion Mischung für 1 Stunde bei 50 ° C.
    6. Verwandeln Sie Platte auf LB/Amp Agarplatten mit 100 μg/mL Ampicillin 2 μL des Produktes Montage in zuständigen Bakterien. Auch fügen Sie X-Gal + IPTG auf dem Teller für blau/weiß-Screening hinzu.
    7. Wählen Sie 3 – 4 weiße Kolonien von der Platte über Nacht inkubiert, impfen die Kolonie in 3 mL LB mit 100 μg/mL Ampicillin und wachsen bei 37 ° C über Nacht in einen Shaker geben. Extrakt-Plasmid aus der Übernachtung-kultivierte Bakterien mit dem Plasmid Mini-Prep Kit nach der Hersteller in der Bedienungsanleitung (siehe Tabelle der Materialien).
    8. Bildschirm der positiven Kolonie durch PCR oder Einschränkung Verdauung.
    9. Sequenz Überprüfen der HDR spenderregion des endgültigen Plasmids. Speichern Sie eine bakterielle Lager mit der richtigen Klone in 20 % Glycerin bei-80 ° C für künftige Impfung transformiert.

(3) Embryo Einspritzung, Fliege Genetik und Screening für Genom-Bearbeitung

  1. Bereiten Sie die hohe Reinheit gRNA Endotoxin-freies Expressionsvektors sowie die HDR-Spender-Plasmid mit einem Plasmid Maxiprep kit (siehe Tabelle der Materialien).
  2. Co injizieren Sie gRNA expressionsplasmid (100 ng/μl) und der Ersatz-Spender (500 ng/μl) in die Keimbahn des Nein-Cas9 Embryonen6. Hinweis: Wir verwenden eine kommerzielle Dienstleistung zur Injektion, aber dieses Verfahren kann im Labor sowie durchgeführt werden.
  3. Fliegen Sie, Genetik und Screening (Abbildung 2 und Abbildung 3):
    1. Wenn die injizierten Embryonen zu Erwachsenen entwickeln, fliegt0 Kreuz jedes einzelnen G Balancer fliegen. Wählen Sie geeignete Balancer für das Chromosom, das gezielte Allel enthalten.
    2. Die F1 Nachkommen aus jedem G0 auf einen CO2 Pad überqueren und nach dem Zufallsprinzip auswählen 10-20 Männer unter einem Stereomikroskop zu betäuben. Überqueren sie einzeln auf die Balancer-Weibchen, wie in Abbildung 3dargestellt.
    3. Wenn die F2 Larven schlüpfen, wählen Sie einzelnen F1-Vater von jedem Kreuz und gDNA mit dem einzigen fliegen genomische DNA Vorbereitung Protokoll zu extrahieren:
      1. GDNA Extraktionspuffer vorbereiten: 10 mM Tris-Cl pH 8,2, 1 mM EDTA, 25 mM NaCl, bei Raumtemperatur lagern. 20 mg/mL Proteinase K-Stammlösung vorbereiten und im Gefrierschrank aufbewahren.
      2. Setzen Sie jede Fliege in einem 1,5 mL Mikro-Zentrifugenröhrchen und beschriften Sie das Rohr. Über Nacht in die Gefriertruhe-80 ° C halten.
      3. Bereiten Sie eine frische Arbeitsvolumen von gDNA Extraktionspuffer enthält 200 µg/mL Endkonzentration von Proteinase K.
        Hinweis: Verwenden Sie einen alte Puffer nicht für diesen Schritt.
      4. Zerquetschen Sie jede Fliege für 10 – 15 s mit einer PIPETTENSPITZE 50 μL der Anquetschen Puffer ohne Verzicht auf die Flüssigkeit enthält. Die verbleibenden Puffer in das Rohr zu verzichten und gut mischen. Inkubation bei 37 ° C für 20-30 min.
      5. Setzen Sie Rohre in 95 ° C Hitze Block für 1 – 2 min. zu inaktivieren die Proteinase K.
      6. Spin-down für 5 min bei 10.000 X g. Speichern Sie die Vorbereitung bei 4 ° C für weitere PCR-Analysen.
  4. Verwenden Sie dieselbe Methode zur gDNA eine Nein-Cas9 Fliege, Vorbereitung dient als Negativkontrolle. Führen Sie Dreistufen-PCR-basierte Bildschirme zur Identifizierung der richtigen "endet," HDR (Abbildung 2, Abbildung 5) mit gDNA jedes F1-Männchen als Vorlage5. 1 μl DNA prep im folgenden PCR Reaktionssystem verwenden: 10 μL 2 x PCR-Master-Mix mit Farbstoff, 1 μL jeder Grundierung (10 μM), 1 μL der DNA Schablone und 7 μL DdH2O.
  5. Wie in Abbildung 5Agezeigt, führen Sie PCR mit Primer fwd1 und rev1 zum Bildschirm für die Existenz der Einfügung oder Ersatzlieferung; Führen Sie PCR unter Verwendung fwd2 und rev2 Zündkapseln, die Einfügung oder Ersatz von 3' Region überprüfen; Führen Sie PCR mit Primer M13F und rev3, "enden in" HDR (Tabelle 1) zu überprüfen.
  6. Halten Sie die Fliegenschnüre mit der bestätigten enden-Out HDR und etablieren Sie ausgewogene Bestände aus der F2-Generation zu. Outcross, die Balancer fliegen wieder, jede unbeabsichtigten Mutationen auf anderen Chromosomen zu entfernen.
  7. Bereiten Sie qualitativ hochwertige gDNA aus den etablierten Beständen zur langen PCR Verstärkung (> 800 – 1.000 nt) Amplikons mit hoher Wiedergabetreue Taq Polymerase und voll Reihenfolge überprüfen der Amplifikate aus veränderten genomischen Regionen gewonnen. Alternativ können Sie rohe gDNA Extrakt wie beschrieben früher kürzere verstärken (< 800 nt), überlappende PCR-Produkte um das bearbeitete Genom-Sequenz zu überprüfen. Verwenden Sie das folgende Protokoll, um gute Qualität Drosophila genomische DNA vorzubereiten:
    1. Habe ca. 25 Erwachsenen fliegen in einem 1,5 mL Microcentrifuge Schlauch, und mindestens 1 Stunde bei-20 ° C oder-80 ° C Gefrierschrank gefrieren lassen.
    2. Fügen Sie 250 μl der Lösung A (pH 9,0 Tris HCl 0,1 M EDTA 0,1 M SDS 1 %).
    3. Die fliegen mit den homogenisierenden Stößel in Mikrozentrifugenröhrchen zu homogenisieren, und das Rohr auf Eis gelegt.
    4. Bei 70 ° C für 30 min inkubieren.
    5. Fügen Sie 35 μL der KOAc (5 M), schütteln und gut mischen, aber tun nicht Wirbel.
    6. Inkubation für 30 min auf Eis.
    7. Mit 12.000 X g für 15 min drehen.
    8. Mit einer Mikropipette 1 mL sorgfältig übertragen nur den klare überstand zu einem neuen Schlauch verlassen wieder jedem Niederschlag oder interphase.
    9. Der Überstand 150 μl Isopropanol hinzufügen. Mischen Sie vorsichtig durch Umkehrung.
    10. Mit 10.000 X g für 5 min drehen.
    11. Nehmen Sie des Überstands vorsichtig und lassen Sie das Pellet in das Rohr.
    12. Waschen Sie die Tablette mit 1 mL 70 % EtOH.
    13. Mit 12.000 X g für 5 min drehen.
    14. Den überstand zu entfernen. Das Pellet für 15 bis 20 min der Luft trocknen lassen. Trocknen Sie die Pellets nicht über.
    15. Das Pellet in 100 μL der DdH2O. Auflösen
    16. High Fidelity DNA-Polymerase geeignet für lange Amplikons verwenden (> 800 bp), die komplette bearbeitete Region zu verstärken. Idealerweise nehmen Sie zwei Zündkapseln, außerhalb der eingelegten Kassette, die genomische Region zu verstärken. Gel reinigen das PCR-Produkt, und wie oben beschrieben, Sequenz überprüfen das Produkt mit mehreren überlappenden Primern.
  8. Überprüfen Sie die korrekte raumzeitlichen Expressionsmuster von seziert Gewebe/Embryonen von veränderten Leinen negativ beeinflussen:
    1. Führen Sie RT-PCR aus der Gesamt-RNS, die Expression von Hybrid-mRNA-Produkt (Tabelle 1) zu überprüfen.
    2. Führen Sie eine in Situ Hybridisierung der mRNA-Produkt des Interesses an der Larven Gewebe/Embryo um den Ausdruck zu überprüfen.
    3. Für die genaue gewebespezifischen raumzeitlichen Expressionsmuster unter die Sequenz verifiziert enden-Out Zeilen cross jede bearbeiteten Linien auf den Bildschirm erhalten, für den binären Ausdruck Fahrer mit dem LexO- GFP oder LexO- RFP (für LexA Treiber) Linie (erhältlich bei den Bloomington-Lager-Zentren) und LexA oder Gal4 getrieben Reporter-gen-Expression in den Embryo, Larven und adulten Geweben unter dem Fluoreszenzmikroskop zu beobachten.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Dieses Protokoll wurde erfolgreich eingesetzt, um eine gezielte binärer Ausdruck Reporter System speziell für Bnl Ausdruck Zellen5zu generieren. Der Cis-regulatorische Elementen (CREs), die komplexe raumzeitlichen Bnl Ausdruck Steuern sind nicht gekennzeichnet. Daher wurde um raumzeitlichen Ausdruck unter der Kontrolle der endogenen Bnl regulatorische Sequenz zu erreichen, nur die ersten kodierende Exon des Bnl entwickelt, um mit der Abfolge der bakteriellen LexA transaktivator ersetzt werden. Eine verbesserte Nls-LexA::p65 Kassette bekannt, bieten optimalen Ausdruck in Drosophila wurde ausgewählt.

Die Ersatz-Strategie zielte darauf ab, eine Chimäre erzeugen Nls-LexA:p65-Bnl mRNA unter endogenen transkriptionellen und posttranskriptionelle Kontrolle. Diese Chimäre mRNA enthalten eine intakte Bnl 5' UTR, Teil 5'-Ende und 3' Ende der bearbeiteten Bnl Codierung Exon (ersten Exon), und die vollständige nachgelagerte Bnl Introns und Exons. Um zu bewahren, die Bnl RNA-spezifische Spleißen der ersetzten Exon, wurden kleine 5' und 3'-Enden der ersetzten kodierenden Exon beibehalten. Jedoch, Synthese eines Chimären Bnl-Proteins zu verhindern verschmolzen, Nls -LexA: p65, ein T2A selbst anhaftenden Peptidsequenz zwischen den verbleibenden 5' Bnl coding gegründet-Region und die ATG von Nls-LexA:p65. Außerdem wurde ein Stopcodon Übersetzung hinzugefügt, nach der Nls-LexA:p65 Sequenz Co Übersetzung eines abgeschnittenen Bnl Protein5 (Abbildung 4 und Abbildung 5A) zu vermeiden.

Ein Ersatz-Spender mit all diesen Features verwendet wurde, die hatte den T2A-Nls-LexA:p65 -Sequenz und 2 kb 5'- und 1,8 kb 3' - Homologie Arme. Lange Homologie Waffen dienten für effiziente HDR und Einfügung eines großen DNA-Fragments am Ort der Reparatur (T2A-Nls-LexA:p65 ist 1,8 kb) (Abb. 5A).

Zwei gRNAs wurden zur DSB an definierten Positionen, die meisten der ersten kodierenden Exon des Bnllöschen erstellen. Zwei gRNAs, die alle in Abschnitt 1.3 (PAM Sequenz unterstrichen) beschriebenen Kriterien erfüllt waren:
gRNA1: TGTATCTGCGATGCCCCTCATGG
gRNA2: ATCCTTCAGATATTGCGGGATGG

Beide gRNA Anerkennung Standorte wurden in der Ersatz-Spender durch die exogene T2A- gestörtNls-LexA:p65 Sequenz, die der einfachste Weg zur Vermeidung von gRNAs, veränderter Locus retargeting ist. Die gestörten gRNA Erkennungssequenzen in der Ersatz-Spender (der exogenen Sequenzen, die gRNA Anerkennung Websites in Kursivschrift gestört) waren:
gRNA1: TGTATCTGCG -GGCTCCGGCGAAGGAC...
gRNA2:... AAAAACTCGTTTAGA- CGGGATGG

PCFD4 gRNA Expressionsvektors, enthält diese gRNAs, zusammen mit der Ersatz-Spender war Co injiziert in die Keimbahn des Nein-Cas9 Embryonen. Das hier beschriebene Protokoll wurde anschließend zum Bildschirm für den beabsichtigten Ersatz (Abbildung 5 b, C). Etwa 67 % der injizierten G0 Tiere waren fruchtbar. Und 56 % der fruchtbaren G0s waren die Gründer, die HDR-positiven Nachkommen hervorbrachte. Unter den F1-Nachkommen überprüft etwa 23 % waren positiv für erfolgreiche HDR, und 73 % der positiven HDR "enden-Out" (Tabelle 2). Seit der ersten Codierung Exon des Bnl war "ausgeschlagen", fanden sich die HDR-Linien homozygot sein tödlich, und die Bestände waren über Balancer gepflegt.

Die Generation der eine Chimäre LexA-Bnl -mRNA in den Zellen wurde durch RT-PCR-Analysen (Abbildung 5) validiert. Zu überprüfen, ob die erhaltenen Bnl-LexA Linien wurden in der endogenen Bnl Expressionsmuster ausgedrückt, jeder "enden-Out" HDR war Ziellinie LexO mCherryCAAX transgene fliegen5und der Reporter Expressionsmuster wurde in der Nachkommenschaft Embryonen und Larven untersucht. 42 46 Linien zeigten exakte raumzeitliche Ausdruck Einklang mit den bisher gemeldeten Bnl Muster5 (Abb. 6). Vier Linien zeigten entweder schwach oder unspezifische Expressionsmuster. Wir sagen voraus, dass diese Zeilen Mutationen könnten, die wir brauchen angesammelt haben, um mit gründlichen Sequenzierung Analysen zu überprüfen. Gemeinsam bestätigt diese Ergebnisse, dass die HDR-vermittelten Exon-Ersatz-Strategie erfolgreich eingesetzt werden könnte, um eine gezielte binärer Ausdruck System für ein Gen zu generieren. Das Tool kann erfolgreich eingesetzt werden, Reporter oder ektopische Gene in den raumzeitlichen Mustern des Gens Bnl zum Ausdruck bringen.

Figure 1
Abbildung 1: Schema eines binären Transkription-Systems für gezielte Genexpression. Ein transaktivator (GAL4 oder LexA), unter der Kontrolle der GUSausgedrückt-regulatorische Elementen (CREs) eines Gens, treibt ein Effektor Transgen platziert die spezifische Transkription Bindungsstellen (FH für Gal4 nachgeschaltet oder LexAop für LexA). Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 2
Abbildung 2: eine Übersicht des Workflows für CRISPR/Cas9-vermittelten Genom bearbeiten, um eine binäre Transkription System generieren. Die voraussichtliche Dauer für jeden Schritt benötigt wird. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 3
Abbildung 3: Veranschaulichung der CRISPR Screening und genetische Kreuz Schema für den Aufbau Genom bearbeitet Fliegenschnüre. In genetischen Kreuze steht R für das bearbeitete Allel, das auf dem Chromosom 3rd ist. MKRS (Tp (3; 3) MRS, M (3) 76A [1] Kar [1] Ry [2] [1] Sb), ist ein 3rd Chromosom Marker; TM6B (In (3LR) TM6B, Antp [Hu] e [1] Tb[1]) ist eine 3-rd -Chromosom-Balancer. Genom bearbeitet fliegen Bestände werden durch PCR Verstärkung der Zielregionen von Interesse aus der genomischen DNA extrahiert aus der F2 oder F3 Generation fliegen und die Reihenfolge bestimmen die PCR-Produkte überprüft. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 4
Abbildung 4: Generation der Ersatz-Kassette von DNA Versammlung. Eine schematische Zeichnung Darstellung PCR Verstärkung und Montage von verschiedenen PCR-Produkte (a, b und c) in den Spender-Vektor (d) mit einer DNA-Montage-Methode. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 5
Abbildung 5: Generation der Bnl-LexA von CRISPR/Cas9-vermittelten Exon Ersatz. (A) schematische Darstellung der Strategie der CRISPR/Cas9 Zeichnung vermittelt HDR für Exon-Ersatz in der Bnl -Lokus. Box - Exon; Linie-Intron; Ersatz-Spender (pDonor -Bnl:LexA) und zwei mögliche Ergebnisse der HDR wurden gezeigt. Die pDonor -Bnl:LexA hatte folgenden Funktionen: (1)T2A-Nls-LexA:p65 (~1.8kb) Sequenz flankiert von 2 kb und 1,8 kb lange Homologie Arme (gestrichelte Linien), (2) ein T2A selbst anhaftenden Peptid zwischen die restlichen N terminal Bnl Exon und die NLS-LexA:p65, und (3) ein Stopcodon Übersetzung (rot *) nach dem Nls-LexA:p65 Sequenz. Die HDR-Produkt erhalten die transkriptionelle und posttranskriptionelle Kontrolle der Bnl,und die LexA: p65 Protein wird voraussichtlich nach dem gleichen Muster hergestellt werden, wie endogene Bnl kleiner schwarzen Pfeile die relative Bindungsstellen (nicht in zeigen Maßstab) der PCR-Primer (Tabelle 1) für 3-stufiger oder RT-PCR Validierung verwendet. (B) Agarose-Gel Bilder mit Ergebnissen der PCR 3-stufiger. PCR-Produkte verstärkt aus genomischer DNA von vier erfolgreichen enden-Out HDR Linien dargestellt werden; Negative Kontrolle, die genomische DNA von Nos-Cas9 Elternlinie; Positivkontrolle, pDonor -Bnl:LexA Plasmid; M, Markierung (SL2K DNA-Leiter). (C) ein Beispiel für das Screening Gel zeigt das erwartete PCR-Produkt mit Primer M13F und rev3 für enden in Linien; M8-7 und M9-6 sind zwei Enden-in Linien; negative und positive Steuerungen, die gleichen wie in B; M, Markierung (NEB 1 kb DNA-Leiter). (D) RT-PCR-Analyse auf Gesamt-RNS von Bnl-LexA und Nein-Cas9 Steuerung fliegt. Forward Primer bindet an eine bestimmte Region LexA , rückwärts-Primer bindet an einen nachgeschalteten Bnl -Exon-Region; ~ 440 bp (Basenpaare) Verstärkung Band (*) wurde entdeckt von RT-PCR auf Bnl-LexA mRNA, aber nicht von der RNA-Steuerung. M, 100 bp Marker (NEB). Adaptiert von Abbildungen 2 und S1 in Du Et Al. 2017-5. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 6
Abbildung 6: Validierung von gewebespezifischen und bedingte Bnl-LexA Ausdruck in verschiedenen Geweben. (A-D) Bnl Ausdruck (rot) in verschiedenen Larven Geweben mit Btl Ausdruck Zellen in grüner Schrift angezeigt. (A, A') Flügel-Disc- Bnl -Quelle vor der wachsenden Luftsack Primordium (ASP). (B, C) BNL Ausdruck im TR5 quer Bindegewebe (TC) (B) und TR2 dorsalen AST (DB) (C). (D) Bnl Ausdruck im genitalen Scheiben. (E-J) Dynamische Bnl Ausdruck (rot) während der embryonalen trachealen Zweig (grün) Musterung; Kleine Pfeile, fünf Bnl Quellen rund um die Trachealkanüle Placode auf Stufe 10. Genotypen: A-J; Btl-Gal4, UAS- CD8GFP / +; Bnl-LexA, LexO- CherryCAAX /+. (K-L ") Hypoxie induzierte Bnl-LexA Expressionsprofil in Flügel Scheiben und die damit verbundenen TR2 trachealen Metamer (TC, DB, dorsal Stamm-DT). Genotyp: Bnl-LexA, LexO -CherryCAAX / +. (K) Steuerscheiben von ex-Vivo kultiviert Organe ohne CoCl2. (L-L") Flügel Scheiben (L, L') und Luftröhre (DT, (L'')) von kultivierten ex Vivo Organe mit CoCl2 induziert Hypoxie. Stern, ektopische Expression durch Hypoxie induziert. Skalieren von Balken = 30 µm; 50 µm (K-L"). Aus Abbildung 3 in Du Et al.angepasst. 2017-5. Bitte klicken Sie hier für eine größere Version dieser Figur.

A. gRNA Klonierung und Sequenzierung
BNL-LexA gRNA fwd TATATAGGAAAGATATCCGGGTGAACTTCg TGTATCTGCGAT
GCCCCTCAGTTTTAGAGCTAGAAATAGCAAG
BNL-LexA gRNA rev ATTTTAACTTGCTATTTCTAGCTCTAAAAC TCCCGCAATATCTGAAGG
BEIcGACGTTAAATTGAAAATAGGTC
T3-Primer zur Sequenzierung CAATTA ACCCTCACTAAAGG-3 "
Hinweis: Nukleotide unterstrichen, U6 Promoter oder gRNA Kern auf pCFD4 Vektor Tempern, wurde die Kleinbuchstaben g/c hinzugefügt, um U6 Promotor-abhängige Transkription Hilfe
B. HDR Spender Bau
BNL N-F_pUC19 AATTCGAGCTCGGTACtgtggtctttgaggctggaac
BNL-LexA-N-R tCCGcaagtCagtAGgctgccgcgtccttcgccggaGCC CGCAGATACAAGGCCC
C
LexA-F CTactGacttgCGGaGAtGTcGAaGAGAACCCtGGCCCt ATGCCACCCAA
GAAGAAGC
LexA-R CTAAACGAGTTTTTAAGCAAACTCACTC
BNL LexA-C Fwd TAAAAACTCGTTTAGACGGGATGGCGTTGTCAAC
BNL C-R_pUC19 GCCAAGCTTGCATGCCtcgcataattgccgcctgg
Hinweis: Nukleotide in Hauptstadt Überschneidung mit pUC19 Vektor für Gibson Assembly, Nukleotide unterstrichen wurden Sequenz Überhang für T2A Peptid Zusatz.
C. HDR-Screening und Sequenzierung
BNL-LexA Scr fwd1 GTGGCGCACGCCCAATAAAC
BNL-LexA Scr rev1 GATCCCAGCCAATCTCCGTTG
BNL-LexA Scr fwd2 CAACGGAGATTGGCTGGGATC
BNL-LexA Scr rev2 CTGGCCAACTGTAGGGAAGTC
enden-in Check rev3 GCAATGTTATGCAATGCGTTGAC
BNL-LexA Seq fwd3 CACTTGTCGCCCATATTGATACAATTG
Hinweis: Diese Primer wurden verwendet für PCR-screening und Sequenzierung, die ungefähren Positionen der Grundierung Bindungsstellen werden als fwd1-2 und rev1-3 in Abbildung 5A gezeigt.
D. RT-PCR-Analyse
RT-f GATATGGATTTCTCCGCTTTGCTG
RT-r CCATGCAGAGATACAGGCAAGTG

Tabelle 1: in dieser Studie verwendeten Primer. (A) Primer für das Klonen gRNA Expressionsvektor und Sequenzierung. (B) Primer zum Klonen von HDR-Spender-Vorlage. (C) Primer für Screening und Sequenzierung der HDR-Produkte. (D) Primer für RT-PCR-Überprüfung des Chimären LexA-Bnl mRNA Produkts verwendet.

Genotyp HDR-Transmission Rate % (# HDR-einträglichen G0 / # fruchtbaren G0) # HDR-positiven F1 / # total F1 überprüft (%) # "enden-Out" HDR / # total HDR (%)
BNL-LexA 56 (15/27) 23 (60/259) 73 (46/60)

Tabelle 2: die Effizienz der CRISPR/Cas9-vermittelten HDR. Die HDR-Übertragungsrate wird als die Anzahl der HDR-einträglichen G0 / # der gesamten fruchtbaren G0 berechnet. Erfolgreiche HDR % errechnet sich als die Anzahl der HDR-positiven F1 / # der gesamten Formel 1 gezeigt. Als die Anzahl der "enden-Out" HDR / # der insgesamt positiven HDR "Enden-Out" % berechnet.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Traditionell wurden Drosophila Enhancer fallen durch zwei unterschiedliche Methoden erzeugt. Eine der Möglichkeiten umfasst zufällige Einfügung eines Treibers (zB., Gal4) Sequenz des Genoms durch Umsetzung (zB., P-Element Umsetzung)1 . Alternativ können die Fahrer Sequenzen transkriptionelle einer vermeintlichen Enhancer/Promotor-Region in ein Plasmid-Konstrukt, unterstellt werden, die dann in eine ektopische Website des Genoms3,11integriert werden würde. Obwohl diese Methoden einen großen Pool von Gal4 oder LexA Enhancer fallen für Drosophilageneriert haben, haben sie mehrere Einschränkungen. Das P-Element-vermittelten zufällige einfügen in das Genom zur Beeinträchtigung der Regulierungstätigkeit der kritische Cis-regulatorischen Sequenzen. Aufgrund der zufälligen Umsetzung im Genom kann transaktivator Ausdruck Muster mehrere benachbarte Gene melden. Auf der anderen Seite, ist eine vorherige Kenntnis der Cis-regulatorischen Sequenzen eines Gens für ein Enhancer-Trap-Plasmid-Konstrukt notwendig. Außerdem gibt es eine Grenze für die Länge einer Sequenz, die geklont und in ein Plasmid-Konstrukt getestet werden können. Isolieren und Klonen nur ein teilweiser Fragment von DNA aus dem endogenen genomische Kontext könnte keine komplette Gen-spezifischen Ausdruck Muster reproduzieren. Zum Beispiel ist die Bnl-Gal4 (NP2211) Linie, die durch P-Element einfügen ein Enhancer-Trap Gal4 Element knapp vor dem Bnl -gen erzeugt wurde, nicht vollständig die Gen-spezifischen Expressionsmuster des Embryos5 reproduzieren . Daher in solchen Kontexten, die Wiederverwendung Techniken, wie z. B. (Homologie unterstützt CRISPR Knock-in), HACK, dass kann konvertieren vorhandene Gal4-Linien in einem anderen LexA oder Q-System basieren Fahrer Linie12 vielleicht nicht sehr nützlich sein. Um diese Einschränkungen zu überwinden, hier beschriebenen wir eine effiziente und alternative Methode zur Erzeugung von binären Expressionssysteme von Genom-Bearbeitung. Bei dieser Methode wird die erste kodierende Exon eines Gens mit der transaktivator vertauscht (zB., LexA oder Gal4) Sequenz, so dass der Ausdruck der Transkription Fahrer ausschließlich die räumlich-zeitliche Muster der Genexpression imitiert. Obwohl die Strategie und die hier beschriebenen Protokolle für Bnl -Ausdruck optimiert wurden, kann die Methode leicht für andere Gene übernommen werden.

Bestimmung einer Einstichstelle innerhalb der gezielte gen-Region ist der wichtigste Schritt in dieser experimentellen Strategie. Die Methode, die wir vorgestellt wurde entwickelt, um alle transkriptionelle Posttranskriptionale Unfallverhütungsvorschriften der Bnl gen5Original zu behalten. Daher wollten wir die meisten der ersten kodierenden Exon des Gens Bnl löschen und ersetzen Sie ihn durch die LexA -Kassette. Der Ersatz war geplant, in einer Weise, dass das bearbeitete Allel eine Hybrid LexA-Bnl drückt mRNA aus der endogenen Transkription und Translation Startseite Bnl unter Beibehaltung der intronischen Regionen. Doch der Hybrid mRNA, um zu produzieren nur LexA Protein, aber nicht Bnl entwickelt wurde. Wir haben gezeigt, dass die Strategie eine Bnl-LexA erfolgreich generiert hatte /LexO-basierte Transkription System und, dass das System genau die dynamisch, räumlich-zeitliche Bnl Expressionsmuster (Abbildung 5)5 Berichten könnten . Eine Einschränkung dieses Prozesses ist die homozygot Letalität in den Drosophila -Linien ist das gezielte gen essentiell für das Überleben. Darüber hinaus kann eine dual gRNA Strategie die Chance der Ziel-Bearbeitung erhöhen. Eine alternative Strategie kann eingesetzt werden, um diese Probleme zu vermeiden. Bei dieser Strategie kann LexA oder Gal4 Kassette platziert werden rechts in der ATG-Startseite des Gens ersetzt und ein T2A selbst anhaftenden Peptidsequenz zwischen die LexA/Gal4 -Kassette und dem Beginn der intakten kodierenden Exon des gesetzt werden kann Das Zielgen. Diese Strategie wird voraussichtlich eine Chimäre mRNA zu produzieren, die in der Transctivator und das funktionelle Genprodukt übersetzt werden kann. Eine solches Design könnte Möglicherweise vermindern das Risiko von homozygot Letalität. Bei dieser Strategie reicht eine einzelne gRNA für Genom-Bearbeitung. Jedoch im Beisein von zwei Kopien der funktionelle Gene, Ausdruck der transgenen Proteinen Varianten angetrieben von Gal4/LexA Fahrer (zB., Bnl-LexA Ausdruck der LexO- Bnl getrieben: GFP Fusionen oder Bnl Proteine mit Löschungen) werden nicht die Funktionalität der variant Proteine informieren.

Eine Einschränkung der Genom-Bearbeitung-Strategie ist den mühsamen Prozess der Ausrichtung und Bearbeitung eines einzigen Gens zu einem Zeitpunkt. Jedoch haben die Einfachheit und Effizienz der CRISPR/Cas9-vermittelten Genom Bearbeitungsmethode revolutioniert die gezielte genomische Knock-in/Knock-out- und Ersatztechnologie, die leicht in jede standard-Labor eingerichtet übernommen werden kann. Drosophila -Forscher haben in den letzten Jahren praktisch Toolkits für Genom-Bearbeitung entwickelt, die eingesetzt werden können, um die genetische Toolsets für Verständnis, grundlegende biologische Prozesse7,13 wesentlich zu erweitern . Das Genom Bearbeitung und screening-Verfahren, die hier beschriebenen ist relativ schneller und dauert etwa zwei Monate im Vergleich zu anderen homologen Rekombination basierende Ersatz. Für erfolgreiche und effiziente Erbgut Bearbeitung Ergebnisse, ist es wichtig, mehrere technisch wichtige Schritte zu befolgen: 1) jedes gRNA wird ausgewählt, indem die maximale Stringenz und Aktivität ohne mögliche Ziel; (2) der HDR-Spender enthält ~1.5 kb Homologie Arme flankieren die gRNA Ausrichtung auf Websites. Längere Arme Homologie (1,8 – 2 kb) werden verwendet, um die Effizienz des HDR, wenn ein große exogenes DNA-Fragment eingefügt werden muss; (3) der HDR-Spender dient der gRNA Anerkennung Websites, um zu vermeiden, retargeting von gRNA, veränderter Locus frei sein; und 4) eine narrensichere ausgeklügelten Plan und Koordinierung der das Timing der genetischen Kreuzungen mit 3-Stufen-PCR-basierten Screening, eine "enden-Out"-HDR-Linie auszuwählen.

Im Gegensatz zu zufälligen Umsetzung oder geklonte Enhancer Konstrukte, die Strategie und die Protokolle, die wir hier beschrieben sorgt für Generation eine gen-spezifische binäre Übertragung ausschließlich Zielsystem. Da der Ausdruck des Fahrers eine native gen Exon ersetzt, Gen-spezifischen Ausdruck des Treibers ist auch vielseitig und gen Expressionsmuster unter alle Entwicklungs-, metabolischen und physiologischen Bedingungen5imitieren soll. Gen/zellspezifische Ausdruck ist die begehrtesten Kriterien aller binäre Treiber Zeilen, wenn sie in verschiedenen Zell- und Entwicklungsbiologie Methoden verwendet werden. Zum Beispiel ermöglicht Gen-spezifischen Ausdruck der Reporter-Gene von einem Transkription Fahrer zuverlässig Abstammung Analysen der Zellen mit dem Ausdruck des Zielgens. Es ermöglicht auch live imaging und Verfolgung der raumzeitlichen Ausdruck, Migration und Reorganisation der Zellen während der Entwicklung. Um die zellulären und molekularen Ereignisse zu untersuchen, während Gewebe Morphogenese, Gal4 oder LexA Überexpression/Misexpression von getrieben sind verschiedene transgene und RNAi-mediated Gene Knock-Down in bestimmte Gruppen von Zellen notwendig. Hochspezifische gezielte Expressionssystems bietet eine unvoreingenommene Analyse und Interpretation der Ergebnisse. CRISPR/Cas9-basierte Angriffe auf ein Gen Exon und seine Ersetzung durch eine transaktivator-Sequenz bietet daher eine bessere Alternative zur Erzeugung von hochspezifischen gezielte gen Expressionssysteme.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren haben keine Interessenkonflikte offenlegen.

Acknowledgments

Wir danken Dr. F. Port, Dr. K. O'Connor-Giles und Dr. S. Feng für Diskussionen über CRISPR-Strategie; Dr. T.B. Kornberg und Bloomington Stock Center für Reagenzien; UMD bildgebenden zentrale Einrichtung; und die Finanzierung von NIH: R00HL114867 und R35GM124878, SR.

Materials

Name Company Catalog Number Comments
X-Gal/IPTG Gentrox (Genesee Scientific) 18-218 cloning
LB-Agar BD Difco BD 244520 cloning
Tris-HCl Sigma Aldrich T3253 Molecular Biology
EDTA Sigma Aldrich E1161 Molecular Biology
NaCl Sigma Aldrich S7653 Molecular Biology
UltraPure DNase/RNase-Free Water ThermoFisher Scientific 10977-023 Molecular Biology
10% SDS Sigma Aldrich 71736 Molecular Biology
KOAc Fisher-Scientific P1190 Molecular Biology
EtOH Fisher-Scientific 04-355-451 Molecular Biology
GeneJET Miniprep ThermoFisher Scientific K0503 Miniprep
PureLink HiPure Plasmid Maxipep kits ThermoFisher Scientific K210006 Maxiprep
BbsI NEB R0539S Restriction enzyme
Primers IDT-DNA PCR
pCFD4 Kornberg Lab DNA template and vector for gRNA
KAPA HiFi Hot Start- (Kapa Biosystems) Kapa biosystems KK2601 PCR
Q5-high fidelity Taq NEB NEB #M0491 PCR
Gibson Assembly Master Mix NEB NEB #E2611 DNA assembly
pBPnlsLexA:p65Uw Addgene DNA template for LexA amplification
Proteinase K ThermoFisher Scientific 25530049 Molecular Biology
2x PCR PreMix, with dye (red) Sydlab MB067-EQ2R Molecular Biology
Gel elution kit Zymo Research (Genesee Scientific) 11-300 Molecular Biology
TRI reagent Sigma-Aldrich Molecular Biology
Direct-zol RNA purification kits Zymo Research (Genesee Scientific) 11-330 Molecular Biology
OneTaq One-Step RT-PCR Kit NEB E5315S Molecular Biology
lexO-CherryCAAX Kornberg Lab Fly line
UAS-CD8:GFP Kornberg lab Fly line
btl-Gal4 Kornberg lab Fly line
MKRS/TB6B Kornberg lab Fly line
Confocal Microscope SP5X Leica Imaging expression pattern
CO2 station Genesee Scientific 59-122WCU fly pushing
Stereo microscope Olympus SZ-61 fly pushing
Microtube homogenizing pestles Fisher-Scientific 03-421-217 genomic DNA isolation
NanoDrop spectrophotometer ThermoFisher Scientific ND-1000 DNA quantification

DOWNLOAD MATERIALS LIST

References

  1. Brand, A. H., Perrimon, N. Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development. 118, (2), 401-415 (1993).
  2. Lai, S. -L., Lee, T. Genetic mosaic with dual binary transcriptional systems in Drosophila. Nature Neuroscience. 9, (5), 703-709 (2006).
  3. Potter, C. J., Tasic, B., Russler, E. V., Liang, L., Luo, L. The Q system: a repressible binary system for transgene expression, lineage tracing, and mosaic analysis. Cell. 141, (3), 536-548 (2010).
  4. Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J. A., Charpentier, E. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 337, (6096), 816-821 (2012).
  5. Du, L., Zhou, A., Patel, A., Rao, M., Anderson, K., Roy, S. Generation of a targeted expression system for branchless and characterization of novel cellular expression patterns of the gene in Drosophila. Developmental Biology. 427, (1), 35-48 (2017).
  6. Port, F., Chen, H. -M., Lee, T., Bullock, S. L. Optimized CRISPR/Cas tools for efficient germline and somatic genome engineering in Drosophila. Proceedings of the National Academy of Sciences of the United States of America. 111, (29), E2967-E2976 (2014).
  7. Gratz, S. J., Rubinstein, C. D., Harrison, M. M., Wildonger, J., O'Connor-Giles, K. M. CRISPR-Cas9 Genome Editing in Drosophila. Current Protocols in Molecular Biology. 111, (1), 31.2.1-20 (2015).
  8. Doench, J. G., Hartenian, E., et al. Rational design of highly active sgRNAs for CRISPR-Cas9-mediated gene inactivation. Nature Biotechnology. 32, (12), 1262-1267 (2014).
  9. Port, F., Bullock, S. L. Augmenting CRISPR applications in Drosophila with tRNA-flanked sgRNAs. Nature Methods. 13, (10), 852-854 (2016).
  10. Beumer, K. J., Trautman, J. K., Mukherjee, K., Carroll, D. Donor DNA Utilization During Gene Targeting with Zinc-Finger Nucleases. G3. 3, (4), Bethesda, Md. 657-664 (2013).
  11. Pfeiffer, B. D., Ngo, T. -T. B., et al. Refinement of tools for targeted gene expression in Drosophila. Genetics. 186, (2), 735-755 (2010).
  12. Lin, C. -C., Potter, C. J. Editing Transgenic DNA Components by Inducible Gene Replacement in Drosophila melanogaster. Genetics. 203, (4), 1613-1628 (2016).
  13. Li, W., Köster, J., et al. Quality control, modeling, and visualization of CRISPR screens with MAGeCK-VISPR. Genome Biology. 16, (1), 281 (2015).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics