Роста и Agrobacterium опосредованной цветочно цинкования трансформации Extremophyte Schrenkiella parvula

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Agrobacterium опосредованной преобразования с помощью метода цветочные цинкования успешно может использоваться для создания стабильной трансгенных линий модели extremophyte Schrenkiella parvula. Мы представляем протокол изменения от того для Arabidopsis thaliana, учитывая различные роста привычки и физиологические характеристики extremophyte.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Wang, G., Pantha, P., Tran, K. N., Oh, D. H., Dassanayake, M. Plant Growth and Agrobacterium-mediated Floral-dip Transformation of the Extremophyte Schrenkiella parvula. J. Vis. Exp. (143), e58544, doi:10.3791/58544 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Schrenkiella parvula является extremophyte, адаптированных к различным абиотическим стрессам, включая несколько напряжений токсичности ионов. Несмотря на высокое качество геномных ресурсов для изучения, как растения адаптироваться к окружающей среды подчеркивает ее значение как модель функциональной геномики, и средство было ограничено отсутствием возможности трансформации системы. В этом протоколе, мы приводим как генерировать стабильные трансгенных S. parvula линий, с помощью метода Agrobacterium опосредованной цветочные цинкования. Мы изменили преобразования протокол, используемый для A. thaliana отчитаться за уникальные черты S. parvula, как неопределенный цветения привычку и содержанием высокого epicuticular воска на листьях. Вкратце S. parvula семена были стратифицированы на 4 ° C за 5 дней до посадки. Растения выращивались на Фотопериод свет 14 h и 10 h темно и 130 мкмоль м-2s-1 интенсивности света, при 22 ° C до 24 ° C. Восьми до девяти недельных растений с несколькими соцветий были выбраны для преобразования. Эти соцветий были ближнего в проникновения раствора Agrobacterium tumefaciens GV3101 проведение pMP90RK плазмиды. Мы провели два раунда цветок погружения с интервалом в три-четыре недели для повышения эффективности преобразования. T1 семена были собраны и сушат в течение четырех недель в контейнере с осушители до прорастания экран для кандидата преобразовать линии. Сопротивление BASTA был использован для экрана T1 растений. Мы распылять раствор БАСТА три раза с интервалом в три дня, начиная с двух недельных растений для уменьшения ложных срабатываний. Испытание на падение BASTA была выполнена на сохранившихся отдельных растений, чтобы определить истинный положительный трансформантов. Эффективность преобразования был 0,033%, уступая трансгенных растений 3-4 на 10 000 T1 семена распространяются.

Introduction

В этом протоколе мы описываем, рост и создание стабильных трансгенных линий для модели extremophyte Schrenkiella parvula. Отличительной чертой любой универсальный генетический модели является наличие эффективной трансформации системы. Растения, которые процветают в экстремальных условиях, упоминаемый как extremophytes, обеспечивают жизненно важным ресурсом для понимания адаптации растений к экологическим стрессам. Schrenkiella parvula (ранее Thellungiella parvula и Eutrema parvulum) является одной из таких моделей extremophyte, с расширением геномных ресурсов1,2,3,4,5. Однако протоколы преобразования не пока не поступало для S. parvula в опубликованных исследованиях.

Геном S. parvula Геном первой опубликованной extremophyte в капустные (горчица капуста семьи) и показывает обширную общую генома synteny с не extremophyte модель, Arabidopsis thaliana1. Таким образом сравнительные исследования между A. thaliana и S. parvula выиграют от богатства генетических исследований, выполненных на A. thaliana сделать информативный гипотез о как развивалась и регулируется геном S. parvula по-разному справиться с экстремальных экологических подчеркивает5,6,7. S. parvula является одним из наиболее солевыносливых видов (основанный на почве NaCl LD50) среди известных диких сородичей A. thaliana8. В дополнение к терпимости NaCl S. parvula выживает и завершает свой жизненный цикл в присутствии нескольких соли ионов при высоких концентрациях токсичен для большинства растений7. В ответ к абиотическим стрессам, распространенных в своей естественной среде обитания она развивалась различные черты, среди которых несколько учился в биохимических и физиологических уровня 8,9,10, 11.

С 2010 года были более 400 публикаций сверстников reveiwed, которые использованы S. parvula как вид целевого или использовать его в сравнении с другими геномов растений. Однако ясно узким местом может быть отождествлен с пристальный взгляд какой тип исследований были проведены. Большинство этих сообщений обсуждают потенциальное использование S. parvula в будущих исследованиях или использовать его в сравнительной геномной или phylogenomic исследований. Из-за отсутствия доказательства в концепция преобразования протокола создана для S. parvula, он не был использован в функциональных геномных исследований, несмотря на то, что один из высокого качества завода геномов имеющейся на сегодняшний день (> 5 МБ contig N50) собрал и заметки в pseudomolecules хромосомы уровня1.

Agrobacterium опосредованной цветочные цинкования преобразования метод стал наиболее широко используемым методом для создания trasngenic линий в A. thalianaи развитие воспроизводимые системы трансформации было решающим фактором ее успеха как генетическая модель12,13. Однако не все виды капустные было показано, быть успешно преобразованы с помощью метода цветочные цинкования, разработанные для A. thaliana. Специально капустные Lineage II виды, которые включают S. parvula был непокорным цветочные цинкования на основе преобразования методов14,15.

Привычка роста неопределенного цветения S. parvula, в сочетании с его узкие листья морфология сделала сложно принять стандартный Agrobacterium опосредованной цветочные цинкования трансформации метода. В этом исследовании мы приводим измененный Протокол, который мы разработали для воспроизводимых трансформации S. parvula.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. завод рост

  1. Семя стерилизации (опционально)
    1. Подготовка 50% отбеливатель в двойной дистиллированной воды (ddH2O) с 1 или 2 капли неионных моющего средства (см. Таблицу материалы) в 50 мл трубки. Инвертируйте трубке несколько раз перемешать раствор.
      Примечание: Он является предпочтительным для проведения стерилизации семян в поток Ламинарный шкаф с поверхностью УФ стерилизовать 15 мин.
    2. Добавить раствор отбеливателя в ~ 100 – 200 S. parvula семена в 1,5 мл. Тщательно перемешать и пусть трубе сидеть в течение 5 мин.
    3. Удалите отбеливатель из трубки и добавить на 70% спирте. Вымойте семена, закупорить несколько раз и затем немедленно удалить этанола раствор.
    4. Вымойте семена в стерилизованные водой, чтобы удалить избыток отбеливателя и этанола, а затем удалите воду. Повторите этот шаг 5-6 раз.
  2. Стратификация семян
    1. Погружать семена в стерилизованные воды и хранить для 5-7 дней при 4 ° C. Кроме того сушеные нестерилизованных семена непосредственно на влажную почву и место почвы лоток для 5-7 дней при 4 ° C.
  3. Выращивание растений в подготовке трансформации
    1. Заливки почвы mix (см. Таблицу материалы) в 7 x 6 см2 кастрюли, Замочите горшки в воду и брызги воды сверху для обеспечения роста равномерно влажной среде. Добавьте 5 – удобрение бусины (см. Таблицу материалы) на поверхности почвы каждого банка.
      Примечание: Насколько мы испытали, S. parvula растет на любой почвенной смеси, где A. thaliana может расти.
    2. С помощью мокрой зубочисткой, передачи 20 ~ 25 семян на горшок на поверхности почвы.
      Примечание: Удобный рекомендуется помещать пакет 4 – 5 семян в четырех углах и центр горшок (рис. 1, 15 день, левая панель).
    3. Обложка кастрюлю лоток с прозрачный купол сохранить семена при высокой влажности во время прорастания.
    4. Держите растение лотков в камере роста с интенсивностью освещения на 130 мкмоль m−2 s−1 света, 22 – 24 ° C температура и 14 часа в день/10 h за ночь цикл. После 7-10 дней после прорастания, удалите куполов. Добавьте воду из нижней части лотка держать почвы увлажняется равномерно на желательный уровень.
    5. Отсеять дополнительных саженцев и оставить только 4-5 здоровых саженцев на горшок, хорошо отделены друг от друга (рис. 1, день 15, справа).
    6. Аккуратно поливать растения каждые два дня и удобрять с 0,2 x Хоугланд решение16 раз в две недели.
      Примечание: Сохраняя влажности почвы на единообразный уровень является ключом для выращивания S. parvula , последовательно и здорово.
    7. Продолжать расти растения для 8-10 недель, пока несколько соцветий производят 100 – 150 цветочные бутоны на заводе (рис. 1, день 60-80). В день, запланированных на основе преобразования цветочные цинкования (шаг 4.5) удалите все Зрелые и развивающиеся siliques из растений.

2. клонирование гена/геномной элемент интерес в вектор трансформации растений

  1. Усилить целевой фрагмент ДНК, с помощью полимеразной цепной реакции (ПЦР)17 и изолировать ПЦР продукта с помощью извлечения геля комплекта (см. Таблицу материалы) согласно комплект протокола или любой другой соответствующий метод для того чтобы очистить с помощью геля агарозы дна электрофорез17,18. Проверьте последовательность изолированных ПЦР продукта через Сэнгер последовательности19.
  2. Клон, желаемый продукт PCR клонирования вектор и преобразование, клонированные конструкции в сведущее Escherichia coli клеток с помощью топоизомеразы based клонирование комплекта (см. Таблицу материалы) после рекомендации производителя.
  3. Распространения 50 мкл преобразованные продуктов на Лурия Бертани20 (LB) агар бактериальных питательных сред (Таблица 1) с соответствующие антибиотики, например., 50 мкг / мл спектиномицин (см. Таблицу материалы) и Инкубируйте на 37 ° C на ночь.
  4. На следующий день, выберите один колоний 5 – 10, прививать в жидкой среде LB с соответствующие антибиотики и проинкубируйте с нежным тряску при 37 ° C ночь.
  5. Изолировать плазмид, используя плазмида изоляции комплекта (см. Таблицу материалы) и проверить через Сэнгер последовательности19 ли последовательности целевых объектов, усиленный в 2.1 правильно клонируются.
  6. Перевод продукта PCR клонирования и проверенной назначения вектор трансформации растений совместим с рекомбинацией based клонирование (см. Таблицу материалы), используя сочетание фермента рекомбиназа комплект следующее (см. Таблицу материалы), Инструкция комплект Производитель. Повторите шаг 2.3 шаг 2,5 изолировать и проверить клоны, укрывательство надлежащего плазмидные конструкции.

3. преобразование векторных построить завод преобразования в Agrobacterium tumefaciens

  1. Трансформировать плазмидные конструкции вектора от 2.6 в A. tumefaciens штамм GV3101:pMP90RK21, который затаивает рифампицин сопротивления ген для отбора хромосомных фона. Использовать соответствующие антибиотики, например, гентамицина или канамицин (см. Таблицу материалы), для подбора растений преобразования построить (Ti плазмида). Краткий протокол для преобразования A. tumefaciens через электропорации входит в раздел 3.2.
  2. A. tumefaciens преобразование Электропорация
    1. Оттепель в A. tumefaciens сведущие клетки22 на льду. Mix 0,1-1 мкг плазмида, приготовленный из 2.6, растворенного в 1-2 мкл ddH2O, с компетентным ячеек на льду. Передача смеси в кювет электропорации (см. Таблицу материалы).
    2. Выполните электропорации на смесь плазмидов и сведущие клетки от 3.2.1, используя electroporator (см. Таблицу материалы) после рекомендации производителя.
      Примечание: Чистота поверхности кювета перед началом электропорации.
    3. Передавать реакционную смесь из кювета microcentrifuge трубку, содержащую 1,5 мл жидкого фунтов и хорошо перемешать с закупорить и инкубировать 1 час на 28 ° C с нежным встряхивания.
  3. Прививать преобразованные A. tumefaciens из раздела 3.2 на тарелках LB, содержащий соответствующий выбор антибиотиков (например канамицин 25 мкг / мл, спектиномицин 50 мкг / мл, гентамицина 25 мкг / мл и рифампицин 50 мкг / мл) и Инкубируйте на 28 ° C в течение 3 дней.

4. при посредничестве Agrobacterium преобразование S. parvula

  1. Прививать сингл превратил колонии от пластин в 10 мл LB жидких сред, содержащих антибиотики (так же, как и 3.3) в стерильных 50 мл Конические трубки (см. Таблицу материалы). Проинкубируйте 24 ч в тряску инкубатора (см. Таблицу материалы) на 250 r.p.m. 28 ° c.
  2. Передавать бактериальных решение от 3.4.1 флакон 250 мл стерильного, добавить 40 мл жидких сред LB с соответствующие антибиотики и инкубировать 12 h до тех пор, пока оптическая плотность при длине волны 600 Нм (600OD) достигает около 2.0.
  3. Центрифуга A. tumefaciens cultureat 3100 x g 10 мин удалить супернатант и вновь приостановить бактериальной культуры в 40 мл раствора инфильтрации A. tumefaciens (Таблица 1).
  4. Развести ресуспензированы A. tumefaciens раствором проникновения до окончательного ОД600 0,8. Добавить 25 мкл раствора поверхностно-активных веществ (Таблица 1) 50 мл разбавленной A. tumefaciens решения и микс от переворачивать несколько раз.
  5. Окуните соцветие растений в A. tumefaciens раствор, приготовленный в разделе 4.4 для 20 s. использование свежих бактериальных решение после погружения соцветия из шести горшки. Убедитесь, что все цветы соприкасаются решение. Накапайте бактериальных решения непосредственно на цветы, расположенный в нижней части соцветие, если они не могут быть погружается в решение.
    Примечание: Для преобразования первого раунда не забудьте удалить все Зрелые и развивающиеся siliques, используя острый скальпель или маленькие ножницы. Не удаляйте siliques, если выполнение преобразования во второй раз.

5. После преобразования завод уход и второй преобразования

  1. Поместите растения, цветочные, смоченной горизонтально в чистые подносы с купола для покрытия растений и место в комнате темно роста на 1 – 2 дней.
    Примечание: Сохранение цветов при высокой влажности имеет важное значение на данном этапе (рис. 1, растения после преобразования).
  2. Возвращение растения в вертикальном положении и передачи растения к роста комнате с 14 ч в день/10 h за ночь цикла, 130 мкмоль м-2 s-1 интенсивности света и 22-24 ° C температуры.
  3. Контролировать Ближний соцветия на следующей неделе. Если значительное количество цветов прервать (рис. 2), повторите цветочные dip (шаг 4) после 4 недель или после того, как недавно разработали большое количество цветов.
    Примечание: В отличие от подготовки шаг для первого преобразования (шаг 1.3.7) не удаляйте до второго раунда трансформации существующих или разработки siliques (рис. 2).
  4. Растут растения, до тех пор, пока семена созревать и урожай семян на ~ 21 недель.
  5. Сухие семена для 2-3 недель при комнатной температуре в герметичном контейнере с заполнены с осушители (см. Таблицу материалы).

6. Выбор положительных трансформантов

  1. T1 семена растений, как описано для семена дикого типа шагов 1.2 к 1.3.
  2. Растут растения, до тех пор, пока первые 2 истинный листья развиваться, примерно 10-14 дней после прорастания.
  3. Выполните первый выбор для гербицидов сопротивления (рис. 3A и 3B) как описано ниже.
    1. Разбавить гербициду глюфосинату аммония (11,3%) (или БАСТА) (Таблица 1) до 1:1,000 (v/v). Spray разбавленный раствор БАСТА на рассаду и покрывают растения с куполами на ночь.
    2. Повторите БАСТА, опрыскивание 2 – 3 раза каждые 5 – 7 дней.
  4. Выполните второй выбор, с помощью БАСТА падение теста, как описано ниже.
    1. Определите растения, которые выживают после распыляется 3 – 4 раза раствором BASTA. Растут растения еще 2-3 недель до 3-5 листьев развиваться сравнительно большой площадью поверхности.
    2. Выберите крупнейший зрелых листьев на завод, руб поверхности листа нежно с пальцем, чтобы удалить слой воска и место капля разбавленного раствора BASTA (от шага 6.3.1).
      Примечание: Марк расположение листьев, применяется с падение БАСТА, поместив бумажной ленты на оси ближайшего.
    3. Следить за листья, применяется с БАСТА падение признаков увядания до одной недели. Выберите растения с листьями, затронутые БАСТА капли.
      Примечание: Листья от наиболее ложно положительных растений начинают вянуть в течение двух дней, в то время как листья от true срабатываний нетронутыми, даже после того, как капля раствора БАСТА сушит вверх (рис. 3C).
  5. Подтверждают положительные трансформантов с использованием геномной ПЦР.
    1. Собирают листья 2 – 3 от живых растений на шаге 6.4.5.
    2. Извлечь геномной ДНК из листьев с помощью метода CTAB23 или любой другой соответствующий метод экстракции ДНК.
    3. Выполняйте PCR используя извлеченные геномной ДНК образцов из целевых установок, одичал тип растения (как негативный контроль) и плазмидные конструкции от шаг 3.1 (как позитивный элемент управления). Используйте соответствующие пары праймеров PCR, специфичные для селективного маркер гена, например, для БАСТА устойчивостью генов (бар), TCAGCAGGTGGGTGTAGA (вперед) и GTCAACCACTACATCGAGACAA (реверс).
      1. Для примера праймеры PCR ориентации бар Джин, используйте следующие условия PCR: первоначальный денатурации шаг на 98 ° C за 30 сек; После 30 циклов денатурации на 98 ° C за 30 сек, отжиг на 59 ° C за 30 s и расширение в 72 ° C для 30 s; и окончательное расширение при 72 ° C за 5 мин.
        Примечание: Чтобы обеспечить включение всей T-ДНК, мы рекомендуем также геномной PCR используя PCR праймер от селективного маркер гена и другой PCR праймер для целевого объекта последовательности клонируются вектора трансформации растений на шаге
    4. Подтвердить наличие ожидаемого размера продукта PCR усиливается бар геля агарозы электрофорез17 для целевых выборок (рис. 4A), а также секвенирование изолированных ПЦР продукта19 с помощью та же процедура, как и шаг 2.1.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Мы разработали протокол преобразования, позволяющий заготовки T0 семян в течение 150 дней, с помощью метода цветочные цинкования изменения от того для A. thaliana. Рисунок 1 показывает резюме timeline и S. parvula растений, которые представляют собой оптимальный этап для выполнения преобразования через цветочные цинкования. Мы выбрали S. parvula растения с цветами 70 – 80 в нескольких соцветия на 60-80 дней после прорастания как этап целевого объекта для преобразования. Небольшое количество уже существующих открытых или оплодотворенных цветов и siliques на данном этапе были удалены перед проникновением A. tumefaciens цветочные Цинкование методом. Инфекции с A. tumefaciens в результате аборта некоторых цветов (рис. 2, скобка ()). Siliques полностью разработан после цветочные цинкования, вероятно, будет содержать преобразованные семена (рис. 2, держатель (b)). Даже после преобразования S. parvula продолжала разрабатывать новые соцветия и цветки до тех пор, как растения были сохранены здоровые (рис. 2, белые стрелки). Благодаря этой привычки неопределенного цветения второй раунд трансформации может быть выполнена, если завод не показывать признаки стресса или старение. Рисунок 2 A и 2B показывают примеры растений S. parvula после первого и второго раунда трансформации, соответственно, 25 дней друг от друга. В втором преобразовании не будут удалены существующие siliques потому, что они могут содержать трансгенных семян. Кроме того, A. tumefaciens могут быть применены закупорить проникновения раствора (Таблица 1) на вновь возникающие кластеры цветок, вместо погружения всего стрелять в раствор, чтобы свести к минимуму ущерб для siliques от первого преобразование.

Эффективность преобразования-0,033%, уступая трансгенных растений 3-4 за 10000 T1 семена распространяются с использованием текущего протокола. Эта смета основана на ~ 50 000 T1 семена испытаны во время десяти попыток независимой преобразования. В то время как эффективность ниже, чем у Arabidopsis thaliana, оно сопоставимо с преобразования еще extremophyte завод Eutrema salsugenium24 и некоторые из Arabidopsis thaliana экотипов25. Эффективность преобразования может быть оптимизирован с помощью альтернативных Agrobacterium штаммов и модификации растворов ПАВ и инфильтрации. Несколько BASTA спрей и падение тесты (шаги 6.3 и 6.4) будет иметь решающее значение для выявления истинный положительный трансформантов и уменьшить количество образцов с помощью ПЦР подтверждение на шаге 6.5 (рис. 4A). Дальнейшее подтверждение преобразования могут быть проверены с выражением генов репортер, если клонированные последовательность включает Репортер ген (Рисунок 4B).

Figure 1
Рисунок 1 : Хронология трансформации S. parvula . Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 2
Рисунок 2: S. parvula растения после преобразования цветочные падение Растения были сфотографированы через 10 дней после первого цветочные провал в день 60 (A) и 25 дней после второго раунда цветочные цинкования на день 85 (B). Проникновение с Agrobacterium может прервать стручок развития цветков, как показано в скобках . Siliques полностью разработан после цветочные цинкования, вероятно, будет содержать преобразованные семена ( bскобки). Белые стрелки указывают, что цветы и соцветия вновь появившихся после каждого преобразования. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 3
Рисунок 3 : Выбор S. parvula трансформантов основан на сопротивление BASTA. (A) T1 саженцев до спрей BASTA. (B) красный круг указывает кандидат transformant, выживших первый раунд отбора распылением BASTA. Испытание на падение (C) второй раунд отбора BASTA. Показан пример ложных срабатываний (Верхняя панель) и истинный трансгенных растений (Нижняя панель). Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 4
Рисунок 4 : Подтверждение преобразования S. parvula . (A) PCR амплификация гена бар от геномной ДНК, извлеченные из растений S. parvula . Переулок 1 и 13: размер маркеров; Участок 2: отрицательный контроль; Майна 3-5: одичал типа S. parvula ; Переулок 6-10: трансгенных S. parvula кандидатов; Лэйн 11, 12: переносчиками. Полос, 7, 8 и 9 иллюстрируют положительные трансформантов. (B) пример выражения гена репортера ГАС в положительном transformant S. parvula . Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Средства массовой информации / решения Реагент Сумма
Лурия-Бертани (LB) бактериальных питательных сред NaCl
Триптон
Экстракт дрожжей
Агар (для плит)
ddH2O
10 g
10 g
5 g
20 g
955 мл
Agrobacterium инфильтрации решение Г-жа соли (1/4 x)
Витамины B5 (1 x)
Сахароза (5%w/v)
МОН
N6- БАП (BA)
Silwet L-77 (0.05%v/v)
pH
2.16 g
1 мл
50 г
0.5 g
10 МКЛ
500 МКЛ
5.7

Таблица 1: состав бактериальных питательных сред и Agrobacterium раствор инфильтрации.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Физиологическое состояние растений значительно влияет на эффективность преобразования25. Использование растений, здоровым и энергичным для трансформации является одним из ключевых требований для успешной трансформации в S. parvula. Воды или света подчеркнул растений будет иметь меньшее количество цветов, по сравнению с здоровых растений, идеально подходит для преобразования (рис. 1, панели). S. parvula может расти на интенсивность света менее 130 мкмоль м-2 s-1, но растения, как правило, быть frailer; такие растения приведет к более прервана цветы после цветочные цинкования. S. parvula , как правило, прервать Agrobacterium, смоченной цветы по более высокой ставке, чем A. thaliana. Таким образом каждый шаг, предпринятый для сведения к минимуму прерванных цветы, когда смоченной в растворе инфильтрации A. tumefaciens способствует более высокой эффективности преобразования. Мы рекомендуем легкий период больше не чем 14 ч в день. Часто преобразование A. thaliana выполняется на растения, выращенные в состоянии долго день (18 h светло и темно 6 h) или даже под непрерывный свет. Однако мы нашли такой результат практики в менее устойчивыми S. parvula растений и привести к эффективности низкой трансформации.

Бутоны постоянно производятся на оси соцветия S. parvula (рис. 2, белые стрелки). Таким образом позволяя преобразованию новых цветов будет значительно увеличить вероятность получения положительных трансформантов. Второй цветочные купанием (шаг 5.3) не является необходимым, но настоятельно предложил. Однако, этот шаг является сравнительно много времени по сравнению с A. thaliana цветочные погружения, потому что S. parvula производит несколько оси соцветия.

Одичал типа S. parvula чувствительна к БАСТА, хотя начальный экран для положительных трансформантов БАШТА спрей (шаг 6.3) оставит 5 – 8 живых растений из проросшие 100 семян (рис. 3A и 3B). Большинство этого (> 80%) будет ложных срабатываний. Это во многом благодаря форме узких листьев и конечный угол S. parvula, которые не обеспечивают достаточной поверхности листа в соответствующей ориентации сохранить БАСТА решение для достаточной продолжительности соблюдать фенотип. Кроме того из-за высокой воск содержание adaxial листовой поверхности S. parvula10, она стремится создать более непроницаемую поверхность для BASTA. Таким образом второй скрининг для положительных трансформантов, с помощью BASTA падение на отдельные листья (шаг 6.4, рис. 3C) является важным шагом, чтобы избежать PCR тестирования на сотни ложных срабатываний (шаг 6.5).

Текущий протокол был протестирован с A. tumefaciens штамм GV3101 проведение pMP90RK плазмиды. Эффективность преобразования может быть улучшена с другими A. tumefaciens штаммов, включая штаммы ABI, LMG20 и C58C1 Rifr, с pMP90 вирулентности плазмида сообщил для увеличения эффективности трансформации в A. thaliana 25. таксономически виды Brassica и Eutrema более тесно связаны с S. parvula по сравнению с A. thaliana1. Таким образом, A. tumefaciens штамм LBA4404, который успешно использовался для преобразования рапс и деформации, которые EHA105, который успешно используется для преобразования Eutrema salsugineum может предложить более высокие преобразования эффективность, чем сообщалось эффективность штамма в настоящее время используется26,27,28.

Сокращение времени и труда, требуемые протоколом трансформации является другим важным фактором в повышении эффективности преобразования. Размещение отдельных БАСТА капли на листьях и мониторинг листьев на неделю на нескольких растений (шаг 6.4) утомительно. Будущие усилия для повышения эффективности преобразования можно искать надлежащие альтернативные выбирается маркер гены29.

Наличие установленного преобразования протокола значительно продвинет нашу способность идентификации генов и новых механизмов, которые позволяют extremophyte модель растения выжить несколько абиотическим стрессам2,4. Новые генетические различия в S. parvula будет предоставлять более широкий пул генетические изменения, которые не могут добываться из коллективных аллельных варианта, определены как стресс отзывчивым генов в модели относительно стресс фактора, A. thaliana Пан геном5,6. Таким образом наши цветочные цинкования основе A. tumefaciens опосредованной преобразования протокол, разработанный для S. parvula заполнит пробел для потребность в таких инструментов для выполнения функциональных геномной эксперименты в extremophyte модели, тесно связанных с а. thaliana.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторы не имеют ничего сообщать.

Acknowledgments

Эта работа была поддержана Национальный научный фонд премии MCB 1616827.

Materials

Name Company Catalog Number Comments
Agar VWR International, Radnor, PA 90000-762 Bacto Agar Soldifying Agent, BD Diagnostics
B5 vitamins Sigma-Aldrich, St. Louis, MO G1019 Gamborg’s Vitamin Solution
Desiccant W A Hammond Drierite, Xenia, OH 22005 Indicating DRIERITE 6 mesh
Destination vector for plant transformation TAIR Vector:6531113857 pKGWFS7
Electroporation cuvette USA Scientific 9104-5050 Electroporation cuvette, round cap, 0.2 cm gap
Electroporator BIO-RAD Laboratories, Hercules, CA 1652100 MicroPulser Electroporator
Fertilizer beads Osmocote Garden, Marysville, OH N/A Osmocote Smart-Release Plant Food Flower & Vegetable
Gel extraction kit iNtRON Biotechnology, Boston, MA 17289 MEGAquick-spin Total fragment DNA purification kit
Gentamicin Sigma-Aldrich, St. Louis, MO G1914-5G Gentamicin sulfate
Glufosinate-ammonium (11.3%) herbicide (BASTA) Bayer environmental science, Montvale, NJ N/A FINALE herbicide
Kanamycin VWR International, Radnor, PA 200004-444 Kanamycin monosulfate
MES Bioworld, Dublin, OH 41320024-2 MES, Free Acid
MS salt MP Biomedicals, Santa Anna, CA 092621822 Hoagland's modified basal salt mixture
N6-benzylaminopurine (BA)  Sigma-Aldrich, St. Louis, MO B3274 6-Benzylaminopurine solution
NaCl Sigma-Alrich S7653 Sodium chloride
Non-ionic detergent Sigma-Aldrich, St. Louis, MO 9005-64-5 TWEEN 20 
Plasmid isolation kit Zymo Research, Irvine, CA D4036 Zyppy Plasmid Kits
Recombinase enzyme mix kit Life Technology 11791-020 Gateway LR Clonase II Enzyme mix
Rifampicin Sigma-Aldrich, St. Louis, MO R3501-1G Rifampicin, powder, ≥ 97% (HPLC)
Shaking incubator ThermoFisher Scientific, Waltham, MA SHKE4450 MaxQ 4450 Benchtop Orbital Shakers
Soil mix Sun Gro SUN239223328CFLP Sun Gro Metro-Mix 360 Grower Mix
Spectinomycin VWR International, Radnor, PA IC15206705
Sterile 50 mL conical tubes USA Scientific, Ocala, FL 1500-1811 50 mL conical screw cap tubes, copolymer, racks, sterile
Sucrose VWR International, Radnor, PA 57-50-1 Sucrose, ACS
Surfactant solution Lehle seeds, Round Rock, TX VIS-02 Silwet L-77
Topoisomerase-based cloning kit Life Technologies, Carlsbad, CA K240020 pENTR/D-TOPO Cloning Kit, with One Shot TOP10 Chemically Competent E. coli
Tryptone VWR International, Radnor, PA 90000-282 BD Bacto Tryptone, BD Biosciences
Yeast Extract VWR International, Radnor, PA 90000-722  BD Bacto Yeast Extract, BD Biosciences

DOWNLOAD MATERIALS LIST

References

  1. Dassanayake, M., et al. The genome of the extremophile crucifer Thellungiella parvula. Nature Genetics. 43, (9), 913-918 (2011).
  2. Oh, D. -H., Dassanayake, M., Bohnert, H. J., Cheeseman, J. M. Life at the extreme: lessons from the genome. Genome Biology. 13, (3), 241 (2012).
  3. Whited, J. The Next Top Models. Cell. 163, (1), 18-20 (2015).
  4. Dassanayake, M., Yun, D. O. D., Bressan, R. A., Cheeseman, J. M., Bohnert, J. H. The scope of things to come: New paradigms in biotechnology. Plant Biotechnology and Agriculture: Prospects for the 21st Century. 19-34 (2009).
  5. Dittami, S. M., Tonon, T. Genomes of extremophile crucifers: New platforms for comparative genomics and beyond. Genome Biology. 13, (8), 166 (2012).
  6. Amtmann, A. Learning from evolution: Thellungiella generates new knowledge on essential and critical components of abiotic stress tolerance in plants. Molecular Plant. 2, (1), 3-12 (2009).
  7. Oh, D. -H., Hong, H., Lee, S. Y., Yun, D. -J., Bohnert, H. J., Dassanayake, M. Genome structures and transcriptomes signify niche adaptation for the multiple-ion-tolerant extremophyte Schrenkiella parvula. Plant Physiology. 164, (4), 2123-2138 (2014).
  8. Orsini, F., et al. A comparative study of salt tolerance parameters in 11 wild relatives of Arabidopsis thaliana. Journal of Experimental Botany. 61, (13), 3787-3798 (2010).
  9. Uzilday, B., Ozgur, R., Sekmen, A. H., Yildiztugay, E., Turkan, I. Changes in the alternative electron sinks and antioxidant defence in chloroplasts of the extreme halophyte Eutrema parvulum (Thellungiella parvula) under salinity. Annals of Botany. 115, (3), 449-463 (2015).
  10. Teusink, R. S., Rahman, M., Bressan, R. A., Jenks, M. A. Cuticular waxes on Arabidopsis thaliana close relatives Thellungiella halophila and Thellungiella parvula. International Journal of Plant Sciences. 163, (2), 309-315 (2002).
  11. Jarvis, D. E., Ryu, C. H., Beilstein, M. A., Schumaker, K. S. Distinct roles for SOS1 in the convergent evolution of salt tolerance in Eutrema salsugineum and Schrenkiella parvula. Molecular Biology and Evolution. 31, (8), 2094-2107 (2014).
  12. Clough, S. J., Bent, A. F. Floral dip: A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant Journal. 16, (6), 735-743 (1998).
  13. Koornneef, M., Meinke, D. The development of Arabidopsis as a model plant. Plant Journal. 61, (6), 909-921 (2010).
  14. Bai, J., Wu, F., Mao, Y., He, Y. In planta transformation of Brassica rapa and B. napus via vernalization-infiltration methods. Protocol Exchange. 10, 1028 (2013).
  15. Sparrow, P. A. C., Goldsack, C. M. P., Østergaard, L. Transformation technology in the Brassicaceae. Genetics and Genomics of the Brassicaceae. 505-525 (2011).
  16. Hoagland, D. R., Arnon, D. I. The water-culture method for growing plants without soil. California Agricultural Experiment Station Circular. 347, (347), 1-32 (1950).
  17. Saiki, R., et al. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science. 239, (4839), 487-491 (1988).
  18. Sun, Y., Sriramajayam, K., Luo, D., Liao, D. J. A Quick, cost-free method of purification of dna fragments from agarose gel. Journal of Cancer. 3, 93-95 (2012).
  19. Sanger, F., Nicklen, S., Coulson, A. R. DNA sequencing with chain-terminating inhibitors. Proceedings of the National Academy of Sciences of the United States of America. 74, (12), 5463-5467 (1977).
  20. Bertani, G. Studies on Lysogenesis I. The mode of phage liberation by lysogenic Eschericia coli. Journal of Bacteriolgy. 62, (3), 293-300 (1951).
  21. Koncz, C., Martini, N., Szabados, L., Hrouda, M., Bachmair, A., Schell, J. Specialized vectors for gene tagging and expression studies. Plant Molecular Biology Manual. 53-74 (1994).
  22. Weigel, D., Glazebrook, J. Transformation of Agrobacterium using electroporation. Cold Spring Harbor Protocols. 2006, (30), (2006).
  23. Murray, M. G., Thompson, W. F. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Research. 8, (19), 4321-4326 (1980).
  24. Inan, G. Salt cress. a halophyte and cryophyte Arabidopsis relative model system and its applicability to molecular genetic analyses of growth and development of extremophiles. Plant Physiol. 135, (3), 1718-1737 (2004).
  25. Ghedira, R., De Buck, S., Nolf, J., Depicker, A. The efficiency of Arabidopsis thaliana floral dip transformation is determined not only by the Agrobacterium strain used but also by the physiology and the ecotype of the dipped plant. Molecular Plant-Microbe Interactions. 26, (7), 823-832 (2013).
  26. Shaohong, F. U., Xianya, W. E. I., Yingze, N. I. U., Shixing, G. U. O. Transformation of Brassica napus with the method of floral-dip. Biotechnology: Genomics and Its Applications. 45-49 (2005).
  27. Li, J., Tan, X., Zhu, F., Guo, J. A rapid and simple method for Brassica napus floral-dip transformation and selection of transgenic plantlets. International Journal of Biology. 2, (1), 127 (2010).
  28. Li, H. Q., Xu, J., Chen, L., Li, M. R. Establishment of an efficient Agrobacterium tumefaciens-mediated leaf disc transformation of Thellungiella halophila. Plant Cell Reports. 26, (10), 1785-1789 (2007).
  29. Wu, G., Rossidivito, G., Hu, T., Berlyand, Y., Poethig, R. S. Traffic lines: New tools for genetic analysis in Arabidopsis thaliana. Genetics. 200, (1), 35-45 (2015).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics