Använda i Vitro fluorescens resonans energiöverföring att studera dynamiken i proteinkomplex på en millisekund tidsskala

Biochemistry

Your institution must subscribe to JoVE's Biochemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Protein-protein interaktioner är avgörande för biologiska system, och studier av den bindande kineticsen tillföra insikter och dynamik och funktion av proteinkomplex. Vi beskriver en metod som kvantifierar de kinetiska parametrarna i ett proteinkomplex med fluorescens resonans energiöverföring och slutat-flow teknik.

Cite this Article

Copy Citation | Download Citations

Garsamo, M., Zhou, Y., Liu, X. Using In Vitro Fluorescence Resonance Energy Transfer to Study the Dynamics Of Protein Complexes at a Millisecond Time Scale. J. Vis. Exp. (145), e59038, doi:10.3791/59038 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Proteiner är de primära aktörerna av biologiska system, och de interagerar oftast med andra makro- eller små molekyler att utföra deras biologiska funktioner. Sådana interaktioner kan vara mycket dynamisk, vilket innebär samverkande subunitsna ständigt associerade och dissocierade på vissa priser. Medan mäta det affinitet med tekniker såsom kvantitativa nedrullningsbara avslöjar styrkan i interaktionen, studera bindande kinetik ger insikter om hur snabba de inträffar och hur länge varje komplex kan existera. Dessutom mäta kineticsen av en interaktion i närvaro av ytterligare en faktor, såsom en protein exchange faktor eller en drog, hjälper till att avslöja den mekanism genom vilken samverkan regleras i den andra faktorn, som ger viktig kunskap för de befordran av biologisk och medicinsk forskning. Här beskriver vi ett protokoll för mätning av bindande kineticsen av ett proteinkomplex som har en hög inneboende association och snabbt kan särskiljas genom ett annat protein. Metoden använder fluorescens resonans energiöverföring för att rapportera bildandet av protein komplex in vitro-, och det möjliggör övervakning snabb föreningen och dissociation av anläggningen i realtid på en stoppad-flow fluorimeter. Med denna analys, är i föreningen och dissociation konstanter av protein komplex kvantifierade.

Introduction

Biologiska aktiviteter utförs i slutändan av proteiner, mest som interagerar med andra för korrekt biologiska funktioner. Med en tillämpad metod, den totala mängden protein-protein interaktioner i mänskliga uppskattas till ~ 650,0001, och störningar av interaktionerna ofta leder till sjukdomar2. På grund av deras viktiga roller i styr cellulära och organismers processer, har många metoder utvecklats för att studera protein-protein interaktioner, såsom jäst-två-hybrid, bimolecular fluorescens komplettering, split-luciferas komplettering och co-immunoprecipitation assay3. Medan dessa metoder är bra på att upptäcka och bekräfta protein-protein interaktioner, de är vanligtvis icke-kvantitativa och således ger begränsad information om samhörigheten mellan de samverkande partnerna som protein. Kvantitativa rullgardinsmenyerna kan användas för att mäta affinitet (t.ex. dissociationskonstant Kd), men den mäter inte kineticsen av bindningen, inte heller kan det tillämpas när den Kd är mycket låg på grund av en otillräcklig signal-brus-förhållande4. Ytan plasmon resonans (SPR) spektroskopi kvantifierar bindande kinetik, men det kräver en specifik yta och immobilisering av en reaktant på ytan, vilket potentiellt kan ändra egenskapen bindande av reaktant5. Dessutom är det svårt för SPR att mäta snabb association och dissociation priser5, och det är inte lämpligt att använda SPR för att karakterisera i händelse av utbyte av proteinsubenheter i ett proteinkomplex. Här beskriver vi en metod som möjliggör mätning av protein komplex sammansättnings- och uppdelningsorder på en millisekund tidsskala. Denna metod var nödvändigt för att fastställa Cullin -enmarknadsbedömningar -Nedd8 -dissociated protein 1 (Cand1) roll som F-låda protein exchange faktor6,7.

Cand1 reglerar dynamiken i Skp1•Cul1•F-box protein (SCF) E3 ligases, som tillhör den stora familjen av Cullin-RING ubiquitin ligases. SCFs består av den cullin Cul1, som binder proteinet RING domän Rbx1, och en utbytbar F-låda-protein, som rekryterar substrat och binder Cul1 via adapter proteinet Skp18. Som en E3-ligase, SCF katalyserar konjugationen av ubiquitin till dess substrat, och det aktiveras när substratet rekryteras av proteinet F-låda, och när Cul1 ändras av ubiquitin-liknande proteinet Nedd89. Cand1 binder oförändrad Cul1, och vid bindning, det stör både Föreningen för Skp1•F-box protein med Cul1 och konjugationen av Nedd8 till Cul110,11,12,13. Som ett resultat, Cand1 tycktes vara en hämmare av SCF aktivitet in vitro-, men Cand1 brist i organismer orsakade defekter som tyder på en positiv roll för Cand1 reglera SCF aktiviteter i vivo14,15,16 , 17. denna paradox förklarades slutligen av en kvantitativ studie som avslöjade de dynamiska samspel mellan Cul1, Cand1 och Skp1•F-box protein. Med hjälp av fluorescens resonans energi överföring (bandet) analyser som upptäcka bildandet av SCF och Cul1•Cand1 komplex, föreningen och dissociation Betygsätt konstanter (k och koff, respektive) var mäts individuellt. Mätningarna visade att både Cand1 och Skp1•F-box protein form extremt tight komplex med Cul1, men det koff av SCF är dramatiskt ökade Cand1 och den koff av Cul1•Cand1 är dramatiskt ökat av Skp1•F-box protein6,7. Dessa resultat ger det ursprungliga och kritiska stödet för att definiera rollen av Cand1 som en protein exchange faktor, som katalyserar bildandet av nya SCF komplex genom återvinning Cul1 från de gamla SCF-komplex.

Här presenterar vi förfarandet för att utveckla och använda bandet analysen för att studera dynamiken i den komplexa Cul1•Cand1-7, och samma princip kan användas för att studera dynamiken i olika biomolekyler. FRET uppstår när en donator är glada med lämplig våglängd och en acceptor med excitation spektrum överlappande den givaren emissionsspektrum finns inom ett avstånd av 10-100 Å. Upphetsad staten överförs till den acceptor, därmed minskar givare intensiteten och ökande intensitet acceptanten18. (E) bandet effektivitet beror på både Förster radien (R0) och avståndet mellan givaren och acceptor fluorophores (r), och definieras av: E = R06/ (R0 6 (+ r6). Förster radien (R0) beror på några faktorer, inklusive dipol kantiga orientering, spektrala överlappningen av givare-acceptor paret, och lösningen används19. För att applicera bandet analysen på en stoppad-flow fluorimeter, som övervakar ändringen av givare utsläpp i realtid och möjliggör mätningar av snabba k och koff, det är nödvändigt att fastställa effektiva bandet som resulterar i en betydande minskning av givare utsläpp. Därför utforma effektiva bandet genom att välja den lämpliga par fluorescerande färgämnen och platser på target proteiner att fästa färgämnena är viktigt och kommer att diskuteras i detta protokoll.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. design bandet analysen.

  1. Hämta filen strukturen av den komplexa Cul1•Cand1 från Protein Data Bank (filen 1U6G).
  2. Visa strukturen för Cul1•Cand1 komplex i PyMOL.
  3. Använd funktionen mätning under menyn guiden för PyMOL för att uppskatta avståndet mellan den första aminosyran i Cand1 och den sista aminosyran i Cul1 (figur 1).
  4. Ladda online spectra betraktaren (se Tabell av material) och Visa excitation och utsläpp spectra 7-amino-4-Metylkumarin (AMC) och FlAsH samtidigt (figur 2). Observera att AMC är bandet givaren och FlAsH är den bandet acceptorn.

Figure 1
Figur 1: kristallstrukturen Cul1•Cand1 och mätning av avståndet mellan potential märkning siter. Filen kristall struktur var hämtat från Protein Data Bank (filen 1U6G), och tittade på i PyMOL. Mätningar mellan valda atomer gjordes av PyMOL. Klicka här för att se en större version av denna siffra.

Figure 2
Figur 2: den excitation och utsläpp spektra av fluorescerande färgerna för FRET. Spektra av AMC (7-amino-4-metylkumarin) och FlAsH visas. Streckade linjer anger excitation spectra och heldragna linjer anger utsläpp spectra. Bilden skapades ursprungligen av den fluorescens SpectraViewer och ändrades för bättre tydlighet. Klicka här för att se en större version av denna siffra.

2. förberedelse av Cul1AMC•Rbx1, proteinet bandet givare

  1. Konstruera plasmider för att uttrycka mänskliga Cul1sortase•Rbx1 i E. coli celler. Observera att de två plasmider tillsammans uttrycka mänskliga Cul1•Rbx1 i E. coli celler beskrivs i detalj i en tidigare rapport20.
    1. Lägga till en DNA-sekvens som kodning ”LPETGGHHHHHH” (sortase, hans6 tag) 3' ände Cul1 kodande sekvens genom standard PCR och kloning metoder21,22.
    2. Sekvens nya plasmiden bekräfta gen skäret är korrekt.
  2. Samtidig express Cul1sortase•Rbx1 i E. coli celler. Metoden härstammar från en tidigare rapport20.
    1. Blanda 100 ng varje av de två plasmidsna med BL21 (DE3) kemiskt behöriga celler för samtidig omvandling med värme chock metod23. Odla cellerna på LB agar tallrik innehållande 100 µg/mL ampicillin och 34 µg/mL kloramfenikol vid 37 ° C under natten.
    2. Inokulera 50 mL LB kultur med nymalen transformerade kolonier och växa över natten vid 37 ° C med 250 rpm skakar. Detta ger en förrätt kultur.
    3. Inokulera 6 kolvar, vardera med 1 L LB medium, med 5 mL förrätt kultur varje och växa vid 37 ° C med 250 rpm skakar tills den OD600 är ~ 1.0. Kyl kulturen till 16 ° C och tillsätt isopropyl-β-D-thiogalactoside (IPTG) till 0,4 mM. Förvara odlingen på 16 ° C över natten med 250 rpm skakar.
    4. Skörda de E. coli cellerna genom centrifugering vid 5 000 x g i 15 min och samla cell pellets i 50 mL koniska rör.
      Obs: Cell pellets kan bearbetas för protein rening eller frysas vid-80 ° C innan du fortsätter till de protein reningssteg.
  3. Rening av den Cul1sortase•Rbx1 komplex. Denna metod härstammar från en tidigare rapport20.
    1. Tillsätt 50 mL lyseringsbuffert (30 mM Tris-HCl, 200 mM NaCl, 5 mM DTT, 10% glycerol, 1 tablett av proteashämmare cocktail, pH 7,6) till pelleten av E. coli -celler som uttrycker Cul1sortase•Rbx1.
    2. Lysera celler på isen med ultraljudsbehandling på 50% amplitud. Växla mellan 1 sekund på och 1 sekund av och kör 3 min.
    3. Upprepa steg 2.3.2 2-3 x.
    4. Överför cellen lysate till en 50 mL centrifugering rör och avlägsna cellfragment genom centrifugering vid 25 000 x g i 45 min.
    5. Inkubera den tydliga cellen lysate med 5 mL av glutation pärlor vid 4 ° C i 2 h.
    6. Centrifugera pärlor-lysate blandningen på 1 500 x g under 2 minuter vid 4 ° C. Ta bort supernatanten.
    7. Tvätta pärlorna med 5 mL lyseringsbuffert (med ingen proteashämmare) och ta bort supernatanten efter centrifugering vid 1500 x g under 2 minuter vid 4 ° C.
    8. Upprepa steg 2.3.7 2 x.
    9. Tillsätt 3 mL lyseringsbuffert till tvättade pärlorna och överför pärla slammet till en tom kolumn.
    10. Tillsätt 5 mL eluering buffert (50 mM Tris-HCl, 200 mM NaCl, 10 mM reducerad glutation, pH 8,0) i kolumnen. Inkubera i 10 min och samla eluatet.
    11. Upprepa steg 2.3.10 3-4 x.
    12. Tillsätt 200 µL av 5 mg/mL trombin (se Tabell för material) till eluatet från glutation pärlorna och inkubera över natten vid 4 ° C.
      Obs: Protokollet kan pausas här.
    13. Späd protein provet med buffert A (25 mM HEPES, 1 mM DTT, 5% glycerol, pH 6,5) trefaldigt.
    14. Temperera en katjonbytare kromatografi kolumn (se Tabell för material) på en FPLC system med buffert A.
    15. Ladda protein provet skakad ering kromatografi Jonbytarkolonnen flödeshastighet 0,5 mL/min.
    16. Eluera proteinet med en gradient av NaCl i 40 mL genom att blanda buffert A och 0 till 50% buffert B (25 mM HEPES, 1 M NaCl, 1 mM DTT, 5% glycerol, pH 6,5) flödeshastighet 1 mL/min.
    17. Kontrollera de eluerade proteinet i olika fraktioner med hjälp av SDS-PAGE24.
      Obs: Protokollet kan pausas här.
    18. Poolen eluatet fraktioner som innehåller Cul1sortase•Rbx1.
    19. Koncentrera sig den Cul1sortase•Rbx1 samlingsprov till 2,5 mL av passerar bufferten genom en ultrafiltrering membran (30 kDa cutoff).
  4. Lägga till AMC C-terminus av Cul1 genom sortase-medierad transpeptidation21,22.
    1. Ändra bufferten i Cul1sortase•Rbx1 provet till sortase bufferten (50 mM Tris-HCl, 150 mM NaCl, 10 mM CaCl2, pH 7.5) använder en avsaltning kolumn (se Tabell för material).
      1. Temperera en avsaltning kolumn med 25 mL av sortase buffert.
      2. Ladda 2,5 mL av Cul1sortase•Rbx1 provet till kolonnen. Kassera genomflöde.
      3. Eluera provet med 3,5 mL sortase buffert. Samla genomflöde.
    2. I 900 µL av Cul1sortase•Rbx1 lösningen i sortase bufferten, tillsätt 100 µL av 600 µM renat sortase en lösning och 10 µL av 25 mM GGGGAMC peptid. Inkubera reaktionsblandningen vid 30 ° C i den mörka natten. Observera att detta steg kommer att generera Cul1AMC•Rbx1.
      FÖRSIKTIGHET: Fluorescerande färgämnen är känsliga för ljus, så Undvik att utsätta dem för omgivande ljus under den protein och prov förberedelsen som möjligt.
      Obs: Protokollet kan pausas här.
    3. Tillsätt 50 µL av Ni-NTA agaros pärlor i reaktionsblandningen och odla i rumstemperatur i 30 min.
    4. Pellet Ni-NTA agaros pärlorna genom centrifugering vid 5 000 x g i 2 min och samla supernatanten.
    5. Temperera en storlek utslagning kromatografi kolumn (se Tabell för material) med buffert (30 mM Tris-HCl, 100 mM NaCl, 1 mM DTT, 10% glycerol) på FPLC systemet.
    6. Ladda alla Cul1AMC•Rbx1 prov på kolumnen storlek utslagning kromatografi. Eluera med 1,5 x kolumn volym av buffert.
    7. Kontrollera eluatet fraktioner av SDS-PAGE24.
    8. Pool eluatet fraktioner som innehåller Cul1AMC•Rbx1.
    9. Mätning av protein koncentrationen med dess absorbansen vid 280 nm med en spektrofotometer.
    10. Alikvot protein lösningen och förvaras vid-80 ° C.
      Obs: Protokollet kan pausas här.

3. beredning av FlAsHCand1, bandet acceptor proteinet

Obs: De flesta instruktionerna i denna del är samma som steg 2. Villkor som skiljer sig beskrivs i detalj nedan.

  1. Konstruera plasmiden för att uttrycka mänskliga TetraCysCand1 i E. coli celler.
    1. Lägga till DNA-sekvens som kodar ”CCPGCCGSG” (tetracysteine/TetraCys tag) innan 15th aminosyran av Cand1 genom regelbundna PCR25 (primer sekvenser: TGCTGTCCGGGCTGCTGCGGCAGCGGCATGACATCCAGCGACAAGGACTTTAG; CTAACTAGTGTCCATTGATTCCAAG).
    2. PCR-produkten för in en pGEX-4T-2 vektor. Sekvensera plasmiden bekräfta gen skäret är korrekt och i ram.
  2. Express TetraCysCand1in E. coli celler på samma sätt som steg 2.2, förutom att plasmiden förvandlas till Rosetta behöriga celler.
  3. Rening av TetraCysCand1 från E. coli celler.
    1. Lysera E. coli cell pellets och extrahera TetraCysCand1using glutation pärlor. Dessa steg är samma som steg 2.3.1–2.3.12.
    2. Späd protein eluatet från glutation pärlorna med buffert C (50 mM Tris-HCl, 1 mM DTT, 5% glycerol, pH 7.5) av tre veck. Temperera en anjon Jonbytarkolonnen kromatografi (se Tabell för material) på FPLC systemet med buffert C och load utspädda protein provet flödeshastighet 0,5 mL/min.
    3. Eluera proteinet med en gradient av NaCl i 40 mL genom att blanda buffert C och 0 till 50% buffert D (50 mM Tris-HCl, 1 M NaCl, 1 mM DTT, 5% glycerol, pH 7.5) flödeshastighet 1 mL/min. Kontrollera de eluerade proteinet i olika fraktioner med hjälp av SDS-PAGE24och pool fraktioner som innehåller TetraCysCand1. Observera att TetraCysCand1 har en större lagring volym än gratis GST.
    4. Koncentrera sig poolade TetraCysCand1 provet genom att passera bufferten genom en ultrafiltrering membran (30 kDa cutoff).
    5. Temperera kolumnen storlek utslagning kromatografi med märkning buffert (20 mM Tris-HCl, 100 mM NaCl, 2 mM TCEP, 1 mM EDTA, 5% glycerol) på FPLC systemet. Ladda TetraCysCand1 prov (500 µL varje gång) och kontrollera eluatet fraktioner av SDS-PAGE24.
    6. Samla alla de fraktioner som innehåller TetraCysCand1 och koncentrera sig proteinet till ~ 40 µM genom att passera bufferten genom en ultrafiltrering membran (30 kDa cutoff). Uppskatta den proteinkoncentration med dess absorbansen vid 280 nm. Lagra protein som 50 µL portioner vid-80 ° C.
      Obs: Protokollet kan pausas här.
  4. Beredning av FlAsHCand1.
    1. Tillsätt 1 µL av FlAsH lösning (se Tabell för material) till 50 µL TetraCysCand1 lösning.
    2. Blanda väl och inkubera blandningen vid rumstemperatur i mörkret för 1-2 h att få FlAsHCand1.
      Obs: Protokollet kan pausas här.

4. beredning av Cand1, bandet chase proteinet

Obs: Protein förberedelse protokollet är liknande till steg 3, med följande ändringar.

  1. Infoga den kodande sekvensen av fullängds Cand1 i pGEX-4T-2 vektorn.
  2. Ändra den buffert som används i steg 3.3.5 till en buffert som innehåller 30 mM Tris-HCl, 100 mM NaCl, 1 mM DTT, 10% glycerol.
  3. Eliminera steg 3.3.7 och 3.3.8.

5. testa och kontrollera bandet analysen

  1. Förbereda den band buffert innehållande 30 mM Tris-HCl, 100 mM NaCl, 0,5 mM DTT, 1 mg/mL äggalbumin, pH 7,6, och använda vid rumstemperatur.
  2. Testa bandet mellan Cul1AMC•Rbx1 och FlAsHCand1 på en fluorimeter.
    1. Lägg till Cul1 i 300 µL av bandet buffert,AMC•Rbx1 (bandet givare) till en slutlig koncentration på 70 nM. Över lösningen till en kyvetten.
    2. Placera kyvetten i provet innehavaren av en fluorimeter. Excitera provet med 350 nm excitation ljus och skanna utsläpp signalerna från 400 nm till 600 nm vid 1 nm steg.
    3. Upprepa steg 5.2.1 men förändring Cul1AMC•Rbx1 till FlAsHCand1 (bandet acceptor). Skanna FlAsHCand1 provet med samma metod som i steg 5.2.2.
    4. (Valfritt) Excitera den FlAsHCand1 med 510 nm excitation ljus och skanna utsläpp signalen från 500 nm till 650 nm.
    5. Lägg till båda Cul1 i 300 µL bandet buffert,AMC•Rbx1 och FlAsHCand1 till en slutlig koncentration på 70 nM. Analysera provet på samma sätt som i steg 5.2.2.
  3. Bekräfta bandet mellan Cul1AMC•Rbx1 och FlAsHCand1 genom att lägga till proteinet chase (omärkt Cand1) (figur 3 c).
    1. I 300 µL av bandet buffert, lägga till 70 nM Cul1AMC•Rbx1 och 700 nM Cand1. Skanna provet utsläpp som i steg 5.2.2.
    2. I 300 µL av bandet buffert, lägga till 70 nM FlAsHCand1 och 700 nM Cand1. Skanna provet utsläpp som i steg 5.2.2.
    3. I 300 µL av bandet buffert, lägga till 70 nM Cul1AMC•Rbx1 och 70 nM FlAsHCand1, och inkubera provet vid rumstemperatur i 5 min. Lägg sedan till 700 nM Cand1, och omedelbart efter tillägg, avsöka prov utsläpp som i steg 5.2.2). Observera att detta steg är liknande till steg 5.2.5.
    4. I 300 µL bandet buffert, sekventiellt lägga 70 nM Cul1AMC•Rbx1, 700 nM Cand1 och 70 nM FlAsHCand1. Inkubera provet vid rumstemperatur i 5 min och skanna provet utsläpp som i steg 5.2.2. Observera att detta är chase provet (gröna linjen i figur 3 c).

6. Mät den association konstanten (k) av Cul1•Cand1

Obs: Detaljer för drift en stoppad-flow fluorimeter har beskrivits i en tidigare rapport26.

  1. Förbereda den stoppas flöde fluorimeter för mätning.
    1. Slå på den stoppade-flow fluorimeter enligt tillverkarens anvisning.
    2. Ställ in magnetiseringen ljus på 350 nm och använda ett band-passera filter som tillåter 450 nm utsläpp ljus passera och blockerar 500-650 nm utsläpp ljus.
    3. Behåll provet ventilerna vid fylla position och ansluta en 3 mL-sprutan som är fylld med vatten. Tvätta de två prov sprutorna (A och B) med vatten genom att flytta enheten prov med sprutan upp och ned flera gånger. Kassera alla det vatten som används i detta steg.
    4. Hålla provet ventilerna vid fylla position och ansluta en 3 mL-sprutan som är fylld med bandet buffert. Tvätta två prov sprutorna med bandet bufferten genom att flytta enheten prov med sprutan upp och ner flera tiden. Kassera alla bandet bufferten används i detta steg.
  2. Ta en kontrollmätning (figur 4 c).
    1. Ansluta en 3 mL-sprutan och fyll sprutan A med 100 nM Cul1AMC•Rbx1 i bandet bufferten. Vrid ventilen prov till DRIVE .
    2. Ansluta en 3 mL-sprutan och fyll sprutan B med bandet bufferten. Vrid ventilen prov till DRIVE .
    3. Använda Kontrollpanelen under förvärva i programvaran ta fem skott (blanda lika stor volym av prover från sprutan A och spruta B) på den stoppade-flow fluorimeter utan inspelning resultaten.
    4. Öppna Kontrollpanelen under förvärva i programvara och program för att spela in utsläpp av Cul1AMC över 60 s. Ta sedan ett enda skott.
    5. Upprepa steg 6.2.4 2 x.
    6. Vrid ventilen prov till fylla . Töm sprutan B och tvätta med bandet bufferten.
  3. Åtgärd som observerats association konstanter (kobs) av Cul1•Cand1 (figur 4B).
    1. Förvara provet i sprutan A samma som steg 6.2.1.
    2. Ansluta en 3 mL-sprutan och fyll sprutan B med 100 nM FlAsHCand1 i bandet bufferten. Vrid ventilen prov till DRIVE .
    3. Använd Kontrollpanelen under förvärva i programvaran för att ta fem skott utan att lagra resultaten.
    4. Öppna Kontrollpanelen under förvärva i programvara och program för att spela in utsläpp av Cul1AMC över 60 s. Ta sedan ett enda skott.
    5. Upprepa steg 6.3.4 2 x.
    6. Töm sprutan B och tvätta med bandet bufferten.
    7. Upprepa steg 6.3.1–6.3.6 flera tider med ökande koncentrationer av FlAsHCand1 i bandet bufferten.
    8. Passa ändringen (minskning) i fluorescerande signaler mätt över tid från varje skott till en enda exponentiell kurva. Detta ger kobsvarje mätning, och enheten är s-1. Observera att denna beräkningsgrund väl har diskuterats i en tidigare rapport27.
  4. Beräkna medelvärde och standardavvikelse för kobsför varje FlAsHCand1 koncentration används. Rita de genomsnittliga kobsmot Cand1 koncentration (figur 4 d) och lutningen på linjen representerar den k av Cul1•Cand1, med en enhet av M-1 s-1.

7. Mät den takt dissociationskonstant (koff) av Cul1•Cand1 i närvaro av Skp1•F-box protein.

Obs: Detta steg är liknande till steg 6, med följande ändringar.

  1. I spruta A, under den fylla positionen, ladda en lösning av 100 nM Cul1AMC•Rbx1 och 100 nM FlAsHCand1 i bandet bufferten. Vrid ventilen prov till ”DRIVE”.
  2. I spruta B, under den fylla positionen, ladda en lösning av Skp1•Skp2 (förberedd efter en tidigare rapport20). Vrid ventilen prov till ”DRIVE”.
  3. Öppna Kontrollpanelen under förvärva i programvara och program för att spela in utsläpp av Cul1AMC över 30 s. Ta sedan ett enda skott. De fluorescerande signalerna ökar med tiden efter blandning lösningar från sprutan A och spruta B (figur 5).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Att testa bandet mellan Cul1AMC och FlAsHCand1, vi först bestäms utsläpp intensiteten av 70 nM Cul1AMC (givaren) och 70 nM FlAsHCand1 (acceptorn), respektive (figur 3A-C, blå linjer). I varje analys bara ett utsläpp peak var närvarande, och utsläppen av FlAsHCand1 var (acceptorn) låg. När 70 nM varje Cul1AMC och FlAsHCand1 blandades för att generera FRET, två utsläpp toppar var närvarande i utsläpp spektra, och topp av Cul1AMC blev lägre och toppen av FlAsHCand1 blev högre (figur 3A -C, röda linjer). När de fullängds Cand1 användes för bandet, givare toppen visade en 10% minskning i intensitet (figur 3A, röd linje), och Cand1 med dess första helix trunkeras användes, ökades minskning av givare peak intensitet till 30% (figur 3B -D, röda linjer), vilket tyder på högre bandet effektivitet. Bekräfta att signalförändringar var resulterade från bandet mellan Cul1AMC och FlAsHCand1, 70 nM Cul1AMC (givaren) blandades med 700 nM omärkt Cand1 (jakten) och 70 nM FlAsHCand1 (acceptorn). Som ett resultat, givare toppen var helt återställd och acceptor toppen minskade (figur 3 c, grön linje), vilket bekräftade att den observerade bandet beror på bildandet av Cul1AMCFlAsHCand1 komplex. Lägga till 700 nM Skp1•Skp2 till de 70 nM Cul1AMCFlAsHCand1 också helt återställd givare topp (figur 3D, grön linje), vilket tyder på att Cul1•Cand1 komplexet var fullt störs av Skp1•Skp2 vid jämvikt.

Figure 3
Figur 3: representativa bandet assay för Cul1•Cand1 komplexa bildande. Prover i bandet bufferten (30 mM Tris-HCl, 100 mM NaCl, 0,5 mM DTT, 1 mg/mL äggalbumin, pH 7,6) var glada på 350 nm och utsläppen skannades från 400 nm till 650 nm. (A) utsläpp spectra 70 nM Cul1AMC, 70 nM FlAsHCand1 (full), och en blandning av två (bandet). Cand1 (full) står för full längd Cand1. (B) utsläpp spectra 70 nM Cul1AMC, 70 nM FlAsHCand1, och en blandning av två (bandet). Cand1 med dess första helix bort användes i detta experiment och därefter. (C) utsläpp spectra 70 nM Cul1AMC, 70 nM FlAsHCand1, en blandning av två (bandet), och jaga kontroll för bandet (Chase). Chase provet innehöll 70 nM Cul1AMC, 700 nM Cand1 och 70 nM FlAsHCand1. (D) utsläpp spectra 70 nM Cul1AMC, en blandning av 70 nM Cul1AMC och 70 nM FlAsHCand1 (bandet) och 700 nM Skp1•Skp2 tillsätts med 70 nM Cul1AMCFlAsHCand1 komplexet. I varje tomt, utsläpp signalerna var normaliserade till utsläpp av 70 nM Cul1AMC vid 450 nm. Klicka här för att se en större version av denna siffra.

För att mäta den k av Cul1•Cand1 med etablerade bandet analys genom att övervaka minskning av givaren signalen över tid på den stoppade-flow fluorimeter, vi först testade och fastställs koncentrationen av protein att användas. När 5 nM varje Cul1AMC och FlAsHCand1 användes, mycket små signal förändringar observerades (figur 4A), medan, när koncentrationen av varje protein ökades till 50 nM, observerades en minskning av signalen över tid ( Figur 4B) och denna förändring avskaffades om buffert utan FlAsHCand1 lades till (figur 4 c). Därför, 50 nM Cul1AMC användes för ytterligare analyser, och en rad observerade association konstanter (kobs) mättes genom att blanda 50 nM Cul1AMC med ökande koncentrationer av FlAsHCand1. De kobs för varje experiment beräknades genom att montera punkterna till en enda exponentiell kurva och de kobs erhållits från samma FlAsHCand1 koncentration var i genomsnitt. Genom att rita de genomsnittliga kobs med Cand1 koncentrationen och utföra en linjär regression (figur 4 d), den k var beslutsamma7,27.

Figure 4
Figur 4: representativ mätning av föreningen konstant. (A) fluorescensen 5 nM Cul1AMC övervakades av en stoppad-flow fluorimeter över tiden vid tillsats av 5 nM FlAsHCand1. (B) fluorescensen av 50 nM Cul1AMC övervakades av en stoppad-flow fluorimeter över tiden vid tillägg av 50 nM FlAsHCand1. (C) fluorescensen av 50 nM Cul1AMC övervakades av en stoppad-flow fluorimeter över tiden vid tillägg av bandet bufferten. (D) k för Cand1 bindning till Cul1. Karlssonobs av Cul1•Cand1 vid olika koncentrationer av Cand1 ritas. Linjär lutning ger k 1,8 x 107 M-1 s-1. Felstaplar representera ±SEM; n = 4. Alla prover var förbereds i bandet bufferten och upphetsad på 350 nm. Ett band-passera filter användes för att samla in signaler från AMC och utesluta signaler från FlAsH. Inga data var normaliserade. Klicka här för att se en större version av denna siffra.

Liknar mätningen av k, vi mätte den observerade dissociationskonstant klassar av Cul1•Cand1 genom att övervaka ökningen (Återställ) av givaren signalen över tid på den stoppade-flow fluorimeter. Cul1AMC och FlAsHCand1 blandades först, och sedan Skp1•Skp2 lades till den förmonterade Cul1AMCFlAsHCand1 på den stoppade-flow fluorimeter. Givarens signal ökade snabbt och det visade en kobs 0,4 s-1 (figur 5). Däremot när bufferten lades till den förmonterade Cul1AMCFlAsHCand1, ingen signal ökning observerades, vilket tyder på snabb dissociationen av Cul1•Cand1 utlöstes av Skp1•Skp2.

Figure 5
Figur 5: representativ mätning av hastighet dissociationskonstant. Förändringen i givaren fluorescens kontra tiden mättes efter tillägg av 150 nM Skp1•Skp2 eller bandet bufferten till 50 nM Cul1AMCFlAsHCand1 komplex. Signalförändringar var passar till en enda exponentiell kurva, och det ger observerade dissociationskonstant för 0.4 s-1. De experimentella förhållandena liknade som beskrivs i figur 4. Klicka här för att se en större version av denna siffra.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

BANDET är ett fysiskt fenomen som är av stort intresse för att studera och förstå biologiska system19. Här presenterar vi ett protokoll för att testa och använda bandet för att studera bindande kineticsen av två samverkande proteiner. När du utformar FRET, ansåg vi tre viktiga faktorer: spektrala överlappningen mellan givare utsläpp och acceptor excitation, avståndet mellan de två fluorophores och dipol orientering i fluorophores28. Välj fluorophores för bandet, vi överlagras av excitation och utsläpp spektra av fluorophores och sökte fluorophores vars utsläpp toppar är väl åtskilda medan emissionsspektrum givarens överlappar avsevärt magnetiseringen spectrum av acceptorn (figur 2). För att optimera interfluorophore avstånd och orientering, vi använde kristallstrukturen för bistånd, och vi betraktas främst som kopplar fluorophores till protein termini, främst på grund av den lägre risken för störa proteinstruktur och verksamhet. Eftersom avståndet mellan N-terminalen av Cand1 (Cand1NTD) och C-terminus av Cul1 (Cul1CTD) är kortare än avståndet mellan C-terminus av Cand1 och N-terminalen av Cul1 (figur 1), vi beslutat att märka Cand1NTD och Cul1CTD. Eftersom vi hade kunnat uppnå 80 – 90% märkning effektivitet av N-terminalen av ett protein som använder den tetracysteine tag25, valde vi att märka Cand1NTD med blixt genom taggen tetracysteine. Vi ursprungligen märkt Cul1CTD med cyan fluorescerande protein (GFP), som har några fördelar jämfört med AMC. Det första är en genetiskt kodade fluorescerande tagg, så det inte kräver ytterligare märkning process eller steg som renar märkt fluorescerande proteinet från dess omärkt föregångare. Andra gemensamma fiskeripolitiken är ljusare än AMC, och därför erbjuder högre analysens känslighet (se diskussionen nedan). Det tredje har gemensamma fiskeripolitiken ett större spektrum överlappar med blixt, potentiellt ger effektivare bandet med blixt. Trots dessa fördelar, dock är gemensamma fiskeripolitiken protein mycket större än taggen AMC, som kan störa protein konformation och mellan molekylär interaktion. Ja, vi inte har följt bandet mellan Cul1gemensamma fiskeripolitiken och FlAsHCand1 i vårt test, vilket sannolikt beror på otillräcklig dipol orientering eller avbrott av Cul1-Cand1 samverkan med taggen GFP. Vi märkt sedan Cul1CTD med AMC, och vi observerade bandet mellan Cul1AMC och FlAsHCand1. Ursprungliga bandet med den fullängds Cand1 ledde till 10% minskning av givare utsläpp (figur 3A). Vi hittade ytterligare att genom att ta bort den första helix av Cand1, avståndet mellan Cul1 och Cand1 förkortas från 26,8 Å till 15,5 Å (figur 1), och Cand1 saknas den första helix gav en mycket starkare bandet med Cul1, visar 30% minskning av givare utsläpp topp (figur 3B). Dessutom kan en effektivisera bandet genom att välja en donator fluorophore med högre kvantutbyte och en acceptor fluorophore med en större extinktionskoefficient.

Utmärkande för bandet är som när bandet sker utsläpp av givare minskar och utsläppen av acceptor ökar (figur 3B). Men fluorophores kan visa känslighet till sin omgivning, och därmed utsläpp intensiteten kan ändras när ett annat protein är närvarande, även i avsaknad av bandet29. Bekräfta att den ändrade utsläpp som vi observerat är på grund av bandet mellan Cul1AMC och FlAsHCand1, vi lagt till 10 x överskjutande mängd omärkta acceptor protein (Cand1) som en jakt. Chase konverterar utsläpp av givaren och acceptorn tillbaka till normal nivå (figur 3 c), som stöder att de ändra utsläppen av Cul1AMC och FlAsHCand1 beroende protein-protein interaktioner, och därför detta resultat bekräftar att vi etablerat ett FRET analysmetod som rapporterar föreningen och dissociation av Cul1•Cand1. Dessutom har vi lagt Skp1•Skp2 till den förmonterade Cul1AMCFlAsHCand1 komplex och Skp1•Skp2 är känd för att kunna störa de Cul1-Cand1 interaktiv6. Vi fann att bandet mellan Cul1AMC och FlAsHCand1 försvann (figur 3D, gröna linjen) och emissionsspektrum blev liknar emissionsspektrum av chase provet (figur 3 c, grön linje), vilket tyder på Cul1AMCFlAsHCand1 är separerade av Skp1•Skp2 och Cul1AMC visar inte onormala utsläpp när Skp1•Skp2 är närvarande.

Genom att övervaka förändringar i givaren utsläpp, kan vi direkt konstatera föreningen och dissociation av Cul1AMCFlAsHCand1 på en stoppad-flow fluorimeter. Stoppas-flow systemet fungerar genom att injicera reaktanterna till en blandningskammare att snabbt blanda reaktanterna och stoppa flödet när blandade reaktanterna är flyttat till en observation kammare5. Signaldetektion börjar vanligtvis 1-2 millisekund (ms) efter blandning, vilket möjliggör studera interaktioner som inträffar på millisekund tidsskalan. Men när halveringstiden för observerade reaktionen är kortare än den tid som behövs för att blanda reaktanterna på en viss enhet, detta tillvägagångssätt är inte tillräckligt känslig och är inte längre lämpliga30. Stoppas-flödesanalyser har använts för att bestämma konstanter allt 10-6– 106 s-1 för första ordningens reaktioner, och 1 – 109 M-1 s-1 för andra ordningens reaktioner5. För att erhålla tillförlitlig mätning av kinetiska parametrarna använder den stoppas flöde fluorimeter, är en betydande förändring av fluorescerande signalen mellan start- och jämvikt pekar nödvändigt. Vi använde den FlAsHCand1 saknas den första helix som acceptorn, eftersom det ger bättre bandet med Cul1AMC, och vi testade koncentrationen av proteinerna som skall användas för mätning. När 5 nM varje Cul1AMC och FlAsHCand1 blandades, ingen förändring i Cul1AMC signal observerades (figur 4A), tyder på denna koncentration är otillräcklig för mätning. När protein koncentrationerna höjdes till 50 nM, minskningen av Cul1AMC signal över tid blev uppenbar (figur 4B), och denna förändring uppstår inte när proteinet acceptor var frånvarande (figur 4 c). Baserat på detta resultat, vi använde Cul1AMC på 50 nM samförståndet att mäta den k för Cul1•Cand1. Koncentrationen av givare protein används för mätningen kan variera vid olika fluorophores används. Till exempel när Cul1 är märkt med GFP, 5 nM av GFPCul1 räcker för mätning av k6. Därför den optimala koncentrationen av protein bör testas för varje tabellpar som bandet, och i princip ljusare fluorophores tillåta användning av lägre protein koncentrationer och ge bättre signal-brusförhållande31.

För att studera protein-protein interaktioner av bandet, kräver det att fästa fluorophores på proteiner på lämpliga positioner utan att störa proteinstruktur och verksamhet, vilket potentiellt begränsar användningen av bandet. I detta protokoll, vi märkt N-terminalen av Cand1 med en tetracysteine-tagg, som specifikt binder FlAsH färgämnet och FlAsH färgen blir fluorescerande först efter det binder den mål protein32. Vi märkt Cul1 med sortase-medierad transpeptidation, som fäster en kort peptid som transporterar en fluorophore för att taggen sortase på C-terminus Cul121,22. Märkning effektiviteten är > 80% med taggen tetracysteine och nästan 100% med taggen sortase, hans6 efter bort oreagerad proteinet använder Ni-NTA pärlor (steg 2.4.3–2.4.4). Båda metoderna lägga till några aminosyror i Målproteinet, införa minimala förändringar i protein struktur. Liknande tillvägagångssätt, såsom transglutaminase erkännande sekvens (Q-tag)33 och den ybbR taggen34, kan också användas för att märka Målproteinet på platsspecifika sätt. Dessutom kan photostability av fluorescerande färgerna även begränsa användningen av bandet. Repetitiva eller lång exponering för magnetisering ljus kan leda till fotoblekning av fluorophore, vilket resulterar i felaktig kvantifiering resultat35. Givare och acceptor proteinerna bör därför skyddas från ljus under beredning och förvaring stegen. När du använder bandet för att mäta händelser som sker långsamt, istället för att ständigt övervaka förändringen i givaren utsläpp över tid, kort avläsningar av givare utsläpp bör tas vid längre tidsintervall och provet bör hållas i mörkret under hela experiment6.

Eftersom bandet är känslig och kvantitativa, har det blivit ett viktigt verktyg för att studera interaktionen mellan makromolekyler. Detta protokoll presenterar ett exempel att använda bandet för att studera dynamiken i ett proteinkomplex i lösning. BANDET har också använts tillsammans med levande cellen imaging för att studera molekylära interaktioner i levande celler36, vilket är kraftfull i avslöjande dynamiken i proteinkomplex under fysiologiska betingelser. Dessutom kan bandet också användas på nivån singel-molekyl för att studera realtid dynamiken i makromolekylärt komplex37,38, som ger insikter i conformationaländring av komplexet. För att förbättra effektiviteten och detektion av bandet, fluorophores och biosensorer med förbättrad ljusstyrka och photostability är av stort intresse, som är aktivt konstruerade och studerade28,39.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna har något att avslöja.

Acknowledgments

Vi tackar Shu-Ou Shan (California Institute of Technology) för insiktsfull diskussion om utvecklingen av bandet analysen. M.G., Y.Z. och X.L. har finansierats genom start medel från Purdue University till Y.Z. och X.L.This arbete var stöds delvis av ett frö bidrag från Purdue University Center för växtbiologi.

Materials

Name Company Catalog Number Comments
Anion exchange chromatography column GE Healthcare 17505301 HiTrap Q FF anion exchange chromatography column
Benchtop refrigerated centrifuge Eppendorf 2231000511
BL21 (DE3) Competent Cells ThermoFisher Scientific C600003
Calcium Chloride Fisher Scientific C78-500
Cation exchange chromatography column GE Healthcare 17505401 HiTrap SP Sepharose FF
Desalting Column GE Healthcare 17085101
Floor model centrifuge (high speed) Beckman Coulter J2-MC
Floor model centrifuge (low speed) Beckman Coulter J6-MI
Fluorescence SpectraViewer ThermoFisher Scientific https://www.thermofisher.com/us/en/home/life-science/cell-analysis/labeling-chemistry/fluorescence-spectraviewer.html
FluoroMax fluorimeter HORIBA FluoroMax-3
FPLC GE Healthcare 29018224
GGGGAMC peptide New England Peptide custom synthesis
Glutathione beads GE Healthcare 17075605
Glycerol Fisher Scientific G33-500
HEPES Fisher Scientific BP310-100
Isopropyl-β-D-thiogalactoside (IPTG) Fisher Scientific 15-529-019
LB Broth Fisher Scientific BP1426-500
Ni-NTA agarose Qiagen 30210
Ovalbumin MilliporeSigma A2512
pGEX-4T-2 vector GE Healthcare 28954550
Protease inhibitor cocktail MilliporeSigma 4693132001
Reduced glutathione Fisher Scientific BP25211
Refrigerated shaker Eppendorf M1282-0004
Rosetta Competent Cells MilliporeSigma 70953-3
Size exclusion chromatography column GE Healthcare 28990944 Superdex 200 10/300 GL column
Sodium Chloride (NaCl) Fisher Scientific S271-500
Stopped-flow fluorimeter Hi-Tech Scientific SF-61 DX2
TCEP·HCl Fisher Scientific PI20490
Thrombin MilliporeSigma T4648
Tris Base Fisher Scientific BP152-500
Ultrafiltration membrane MilliporeSigma UFC903008 Amicon Ultra-15 Centrifugal Filter Units, Ultra-15, 30,000 NMWL

DOWNLOAD MATERIALS LIST

References

  1. Stumpf, M. P. H., et al. Estimating the size of the human interactome. Proceedings of the National Academy of Sciences of the United States of America. 105, (19), 6959-6964 (2008).
  2. Kuzmanov, U., Emili, A. Protein-protein interaction networks: probing disease mechanisms using model systems. Genome Medicine. 5, (4), 37 (2013).
  3. Titeca, K., Lemmens, I., Tavernier, J., Eyckerman, S. Discovering cellular protein-protein interactions: Technological strategies and opportunities. Mass Spectrometry Reviews. 1-33 (2018).
  4. Lapetina, S., Gil-Henn, H. A guide to simple, direct, and quantitative in vitro binding assays. Journal of Biological Methods. 4, (1), 62 (2017).
  5. Zheng, X., Bi, C., Li, Z., Podariu, M., Hage, D. S. Analytical methods for kinetic studies of biological interactions: A review. Journal of Pharmaceutical and Biomedical Analysis. 113, 163-180 (2015).
  6. Pierce, N. W., et al. Cand1 promotes assembly of new SCF complexes through dynamic exchange of F box proteins. Cell. 153, (1), 206-215 (2013).
  7. Liu, X., Reitsma, J. M., Mamrosh, J. L., Zhang, Y., Straube, R., Deshaies, R. J. Cand1-Mediated Adaptive Exchange Mechanism Enables Variation in F-Box Protein Expression. Molecular Cell. 69, (5), 773-786 (2018).
  8. Zheng, N., et al. Structure of the Cul1-Rbx1-Skp1-F boxSkp2 SCF ubiquitin ligase complex. Nature. 416, (6882), 703-709 (2002).
  9. Kleiger, G., Deshaies, R. Tag Team Ubiquitin Ligases. Cell. 166, (5), 1080-1081 (2016).
  10. Zheng, J., et al. CAND1 binds to unneddylated CUL1 and regulates the formation of SCF ubiquitin E3 ligase complex. Molecular Cell. 10, (6), 1519-1526 (2002).
  11. Hwang, J. W., Min, K. W., Tamura, T. A., Yoon, J. B. TIP120A associates with unneddylated cullin 1 and regulates its neddylation. FEBS Letters. 541, (1-3), 102-108 (2003).
  12. Min, K. W., Hwang, J. W., Lee, J. S., Park, Y., Tamura, T., Yoon, J. B. TIP120A associates with cullins and modulates ubiquitin ligase activity. Journal of Biological Chemistry. 278, (18), 15905-15910 (2003).
  13. Goldenberg, S. J., et al. Structure of the Cand1-Cul1-Roc1 complex reveals regulatory mechanisms for the assembly of the multisubunit cullin-dependent ubiquitin ligases. Cell. 119, (4), 517-528 (2004).
  14. Chuang, H. W., Zhang, W., Gray, W. M. Arabidopsis ETA2, an apparent ortholog of the human cullin-interacting protein CAND1, is required for auxin responses mediated by the SCF(TIR1) ubiquitin ligase. Plant Cell. 16, (7), 1883-1897 (2004).
  15. Feng, S., et al. Arabidopsis CAND1, an Unmodified CUL1-Interacting Protein, Is Involved in Multiple Developmental Pathways Controlled by Ubiquitin/Proteasome-Mediated Protein Degradation. the Plant Cell Online. 16, (7), 1870-1882 (2004).
  16. Cheng, Y., Dai, X., Zhao, Y. AtCAND1, a HEAT-repeat protein that participates in auxin signaling in Arabidopsis. Plant Physiology. 135, (June), 1020-1026 (2004).
  17. Lo, S. -C., Hannink, M. CAND1-Mediated Substrate Adaptor Recycling Is Required for Efficient Repression of Nrf2 by Keap1. Molecular and Cellular Biology. 26, (4), 1235-1244 (2006).
  18. Okamoto, K., Sako, Y. Recent advances in FRET for the study of protein interactions and dynamics. Current Opinion in Structural Biology. 46, 16-23 (2017).
  19. Hussain, S. A. An introduction to fluorescence resonance energy transfer (FRET). arXiv preprint. (2009).
  20. Li, T., Pavletich, N. P., Schulman, B. A., Zheng, N. High-level expression and purification of recombinant SCF ubiquitin ligases. Methods in Enzymology. 398, (1996), 125-142 (2005).
  21. Popp, M. W., Antos, J. M., Grotenbreg, G. M., Spooner, E., Ploegh, H. L. Sortagging: A versatile method for protein labeling. Nature Chemical Biology. 3, (11), 707-708 (2007).
  22. Antos, J. M., Ingram, J., Fang, T., Pishesha, N., Truttmann, M. C., Ploegh, H. L. Site-Specific Protein Labeling via Sortase-Mediated Transpeptidation. Current Protocols in Protein Science. 89, (2017).
  23. Froger, A., Hall, J. E. Transformation of Plasmid DNA into E. coli Using the Heat Shock Method. Journal of Visualized Experiments. (2007).
  24. Simpson, R. J. SDS-PAGE of Proteins. Cold Spring Harbor Protocols. 2006, (1), (2006).
  25. Kleiger, G., Saha, A., Lewis, S., Kuhlman, B., Deshaies, R. J. Rapid E2-E3 Assembly and Disassembly Enable Processive Ubiquitylation of Cullin-RING Ubiquitin Ligase Substrates. Cell. 139, (5), 957-968 (2009).
  26. Biro, F. N., Zhai, J., Doucette, C. W., Hingorani, M. M. Application of Stopped-flow Kinetics Methods to Investigate the Mechanism of Action of a DNA Repair Protein. Journal of Visualized Experiments. (37), 2-8 (2010).
  27. Patel, J. T., Belsham, H. R., Rathbone, A. J., Friel, C. T. Use of Stopped-Flow Fluorescence and Labeled Nucleotides to Analyze the ATP Turnover Cycle of Kinesins. Journal of Visualized Experiments. (92), 1-6 (2014).
  28. Bajar, B. T., Wang, E. S., Zhang, S., Lin, M. Z., Chu, J. A guide to fluorescent protein FRET pairs. Sensors (Switzerland). 16, (9), 1-24 (2016).
  29. Chen, A. K., Cheng, Z., Behlke, M. A., Tsourkas, A. Assessing the sensitivity of commercially available fluorophores to the intracellular environment. Analytical Chemistry. 80, (19), 7437-7444 (2008).
  30. Lin, C. T., Rorabacher, D. B. Mathematical approach for stopped-flow kinetics of fast second-order reactions involving inhomogeneity in the reaction cell. Journal of Physical Chemistry. 78, (3), 305-308 (1974).
  31. Toseland, C. P., Geeves, M. A. Rapid Reaction Kinetic Techniques. Fluorescent Methods for Molecular Motors. 49-65 (2014).
  32. Adams, S. R., et al. New biarsenical ligands and tetracysteine motifs for protein labeling in vitro and in vivo: Synthesis and biological applications. Journal of the American Chemical Society. 124, (21), 6063-6076 (2002).
  33. Lin, C. W., Ting, A. Y. Transglutaminase-catalyzed site-specific conjugation of small-molecule probes to proteins in vitro and on the surface of living cells. Journal of the American Chemical Society. 128, (14), 4542-4543 (2006).
  34. Yin, J., et al. Genetically encoded short peptide tag for versatile protein labeling by Sfp phosphopantetheinyl transferase. Proceedings of the National Academy of Sciences of the United States of America. 102, (44), 15815-15820 (2005).
  35. Diaspro, A., Chirico, G., Usai, C., Ramoino, P., Dobrucki, J. Photobleaching. Handbook Of Biological Confocal Microscopy. 690-702 (2006).
  36. Aoki, K., Kamioka, Y., Matsuda, M. Fluorescence resonance energy transfer imaging of cell signaling from in vitro to in vivo: Basis of biosensor construction, live imaging, and image processing. Development, Growth & Differentiation. 55, (4), 515-522 (2013).
  37. Kilic, S., et al. Single-molecule FRET reveals multiscale chromatin dynamics modulated by HP1α. Nature Communications. 9, (1), (2018).
  38. Shen, K., Arslan, S., Akopian, D., Ha, T., Shan, S. O. Activated GTPase movement on an RNA scaffold drives co-translational protein targeting. Nature. 492, (7428), 271-275 (2012).
  39. Bajar, B. T., et al. Improving brightness and photostability of green and red fluorescent proteins for live cell imaging and FRET reporting. Scientific Reports. 6, (February), 1-12 (2016).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics