Inyección intratorácica para el estudio del corazón de pez cebra adulto

Biology
 

Summary

Este método se basa en la inyección de 0,5 − 3 μL de solución en el tórax del pez cebra adulto. El procedimiento proporciona eficientemente proteínas y compuestos químicos en la proximidad del corazón del pez cebra sin dañar el órgano. El enfoque es adecuado para probar los efectos de factores exógenos en varios tejidos del corazón.

Cite this Article

Copy Citation | Download Citations

Bise, T., Jaźwińska, A. Intrathoracic Injection for the Study of Adult Zebrafish Heart. J. Vis. Exp. (147), e59724, doi:10.3791/59724 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

El corazón de pez cebra adulto proporciona un modelo poderoso en la investigación de regeneración cardíaca. Aunque la fuerza de este sistema se basa en enfoques transgénicos, una rápida entrega de factores exógenos proporciona una técnica complementaria en estudios funcionales. Aquí, presentamos un método que se basa en la administración de unos pocos microlitros de solución en la cavidad pericárdica sin causar daño miocárdico. Las inyecciones intratorácicas (TI) pueden suministrar proteínas y compuestos químicos de manera eficiente directamente sobre la superficie del corazón. Las sustancias inyectadas se difunden a través del epicardio en los tejidos cardíacos subyacentes. En comparación con las inyecciones intraperitoneal (IP), la principal ventaja de las inyecciones intratorácicas es la administración focal de los factores probados en el órgano Diana. La entrega de moléculas directamente en el pericardio es una estrategia adecuada para los estudios de preacondicionamiento cardíaco y regeneración en el pez cebra adulto.

Introduction

Entre los vertebrados, el pez cebra posee una notable capacidad para regenerar sus corazones1,2. Esta capacidad se ha notificado en varios modelos de lesiones, a saber, resección del ápice ventricular, criolesión (IC) y ablación de cardiomiocitos genéticos3,4,5,6,7. Después de las lesiones invasivas, la pared dañada del ventrículo se cura de forma transitoria por el tejido fibrotico, que se sustituye progresivamente por un nuevo miocardium8,9,10,11. La respuesta de cicatrización temprana de heridas implica la activación y el reclutamiento de células inmunitarias12,13,14,15. Concomitantemente, los cardiomiocitos cerca del miocardio lesionado se activan, desdiferencian, proliferan y reemplazan progresivamente la zona lesionada dentro de 30 − 90 días16,17,18, 19. se han logrado progresos sustanciales en la descifrado de los mecanismos moleculares y celulares de regeneración cardíaca gracias a la disponibilidad de herramientas genéticas, como el análisis de rastreo de linaje celular, la sobreexpresión génica inducible, líneas de reportero de tejido fluorescente, y mutagénesis de genes CRISPR/Cas920,21.

Recientemente hemos establecido un modelo de preacondicionamiento cardíaco en el pez cebra adulto por thoracotomía22,23. El preacondicionamiento aumenta la expresión de los genes cardioprotectores y eleva la reentrada en el ciclo celular en los corazones intactos y regeneradoras. Estos procesos están asociados con el reclutamiento de células inmunitarias y la remodelación de matrices22,24. Los mecanismos de preacondicionamiento son poco entendidos, y se requiere el establecimiento de nuevas técnicas para fomentar esta área de investigación. En particular, la administración optimizada de proteínas de señalización secretadas u otros compuestos químicos es esencial para investigar más a fondo este tema.

Al tratarse de animales acuáticos, el pez cebra puede absorber naturalmente varias sustancias disueltas en el agua a través de sus branquias y su piel. Esto ofrece una posibilidad para la entrega de fármacos no invasivos a través de la inmersión de peces en soluciones con diversos productos químicos, tales como inhibidores farmacológicos, hormonas esteroides, tamoxifeno, BrdU y antibióticos. De hecho, numerosos estudios de varios laboratorios, entre ellos el nuestro25,26,27, han aprovechado este método, que es particularmente valioso en el campo de la biología regenerativa6, 28. sin embargo, este enfoque no es adecuado para la entrega de péptidos, ADN, ARN, morfolinos o moléculas con una permeabilidad limitada del tejido. En estos casos, una entrega más eficiente se logra mediante microinyección en el cuerpo, por ejemplo, insertando el capilar en el seno venoso retro-orbital, en la cavidad intraperitoneal o intrapericárdica29,30, 31. Aquí describimos un procedimiento de inyección intratorácica de una pequeña cantidad de solución, como un método adecuado para estudiar la regeneración del corazón y el preacondicionamiento en el pez cebra adulto.

Protocol

El cuidado animal y todos los procedimientos animales descritos en el siguiente protocolo fueron aprobados por la Oficina veterinaria cantonal de Friburgo, Suiza.

1. herramientas y soluciones para inyecciones

  1. Tire de los capilares de vidrio de borosilicato adaptados a la microinyección utilizando un extractor de agujas según la figura 1A. Almacene los capilares tirados en una placa de Petri de 9 cm con rieles de arcilla modelada o cinta adhesiva.
  2. Usando tijeras comunes, cortar un trozo de esponja (7 cm x 3 cm x 1 cm) y tallar una silueta de pez en su medio.
  3. Prepare pequeñas alícullias de solución inyectable con las proteínas probadas u otros compuestos. Ajustar su concentración de manera dependiente en el ensayo diluyendo la sustancia en la solución de sal equilibrada (HBSS) 1x Hanks complementada con un 10% de rojo fenol.
    Nota: Aquí, la concentración de la proteína probada fue de 100 ng/mL.
  4. Para preparar una solución en stock de anestésicos de Tricaine amortiguadas, disolver 4 g de tricaína en 980 mL de agua destilada. Ajuste el pH a 7,0 − 7.4 utilizando 1 M Tris-HCl pH 9, y llene con agua hasta 1.000 mL. Almacene la solución en color oscuro a 4 ° c.
  5. Para obtener la concentración de trabajo de los anestésicos, añadir 1 − 2 mL de solución de Tricaine en 50 mL de agua de pescado en un vaso de precipitados.
    Nota: La concentración de trabajo de los anestésicos de Tricaine se debe preparar recién antes de su uso.

2. preparación de la estación de inyección

  1. Encienda el estereomicroscopio con la luz de la parte superior y ajuste la magnificación a 16X.
  2. Remoje la esponja con agua de pescado, colóquelo en una placa de Petri de 9 cm en la etapa del microscopio y ajuste el enfoque.
  3. Bajo el estereomicroscopio, cortar el extremo de un microcapilar a ~ 7 mm de la base utilizando una tijeras de iridectomía como se muestra en la figura 1A. El diámetro de la punta ideal sería ~ 20 μm.
    Nota: Cortar la punta del capilar de forma oblicua es óptimo para inserciones en el tejido.
  4. Inserte el microcapilar en el soporte de la aguja del aparato del microinyector.
  5. Utilizando puntas de microcargadores, cargue una solución de control (p. ej., 1x HBSS) para configurar la presión de inyección, con el fin de obtener el caudal adecuado que oscila entre 0,3 μL/s y 0,5 μL/s. Vacíe la aguja.
  6. Cargue el volumen seleccionado de la solución inyectable (p. ej., factor neurotrófico ciliario [CNTF] diluido en 1x HBSS) en la punta del capilar (figura 1B). No debe haber burbujas de aire en el capilar.
    Nota: El volumen máximo de la solución inyectable depende del tamaño del pez. Para una longitud estándar de 2,5 − 3 cm (distancia desde el hocico hasta el pedúncula caudal), se determinó que el volumen máximo de inyección que previene la hinchazón torácica exesiva y el sangrado fue de 5 μL (Figura 1F). Los volúmenes más grandes podrían inyectarse a peces más grandes.

3. preparación de los pescados para la inyección intratorácica

  1. Coger un pez cebra adulto (Danio rerio) con una red y transferirlo a la solución anestésica.
  2. Después de 1 − 2 minutos, cuando los peces dejan de nadar y se reduce el movimiento del opérculum, toque el pez con una cuchara de plástico para asegurarse de que no reacciona a ningún contacto.
  3. Transfiera rápidamente y con cuidado el pez con la cuchara en la ranura de la esponja húmeda, con el lado ventral hacia arriba. La cabeza del pez debe apuntar lejos de la mano dominante del operador.

4. la microinyección en el pericardio

  1. Bajo el estereomicroscopio, observar cuidadosamente el movimiento del corazón palpitante debajo de la piel del pez. Determinar visualmente el punto de inyección por encima del corazón palpitante y en el centro del triángulo definido por las placas ventrales cartilaginosas (Figura 1D). Inserte la punta del capilar a 30 − 45 ° de ángulo de grado en relación con el eje del cuerpo (Figura 1E). Penetrar suavemente la piel con la punta del microcapilar en el pericardio (figura 1C). Un punto de entrada óptimo está más cerca del abdomen que de la cabeza.
    Nota: No inserte el capilar demasiado profundamente en el cuerpo y el corazón, ya que esto causará lesiones en el órgano. En caso de punción cardíaca, la aguja generalmente se llena de sangre. Si esto sucede, retire el capilar y excluya el pescado del experimento.
  2. Una vez que la aguja está dentro del pericardio, complete la inyección presionando el pedal del dispositivo de microinyector.
    Nota: Tenga cuidado de no inyectar aire en la cavidad torácica.
  3. Después de la inyección, retire suavemente el capilar del tórax y transfiera inmediatamente el pez a un tanque con agua del sistema para su recuperación.
  4. Monitoree los peces hasta la recuperación total de la anestesia.
  5. Recoger el corazón en el punto de tiempo deseado y prepararlo para un análisis posterior.
    Nota: En caso de que el pez no reanude el movimiento del opérsculo dentro de los 30 s, reanime el pez apretando el agua en las branquias con una Piera plástica.

Representative Results

Después de las inyecciones intratorácicas (TI), se pueden analizar los efectos de la solución exógena. Para este propósito, los peces deben ser eutanizados y los corazones recogidos, fijos e histológicamente procesados, de acuerdo con los protocolos previamente publicados32,33.

Para validar el método, primero realizamos dos experimentos de prueba inyectando tintes de color y fluorescentes. Primero, los peces eutanizados y post mortem inyectaron 3 μL de tinta en el tórax. Los corazones fueron recolectados después de 5 min, lavados en suero salino-amortiguado (PBS), fijados en 2% formalina, lavados en PBS y fotografiados bajo el microscopio. En segundo lugar, inyectamos 3 μL de 1 μg/mL 4 ′, 6-diamidino-2-Phenylindole (DAPI) in vivo, y arreglamos el corazón después de las 2 h. En ambos ensayos, el análisis de montaje integral reveló el etiquetado de todo el corazón, incluyendo el ventrículo, el atrio y el bulbo arterioso (figura 2A, B). Estos resultados revelan la propagación eficiente de la solución inyectada en la superficie del corazón.

Un protocolo común para la entrega de sustancias exógenas en el pez adulto es la inyección intraperitoneal (IP). Para comparar la idoneidad de las inyecciones de ti versus IP para los estudios cardíacos, inyectamos una cantidad similar de DAPI usando ambos métodos y arreglamos los corazones después de 5 min y 120 min (figura 3a). Los corazones fueron seccionados y manchados con Phalloidin Alexa Fluor (AF) 568 que etiqueta F-actin en el músculo cardíaco. No se observaron células DAPI positivas en los corazones después de la inyección de IP en ambos puntos de tiempo (figura 3B). Por el contrario, la inyección de ti dio lugar a la presencia de núcleos etiquetados con DAPI en el miocardio (figura 3B). Estos resultados demuestran que la inyección de ti mejoró la entrega del compuesto al corazón, en comparación con la inyección de IP.

Para probar la idoneidad de este método para los estudios de regeneración cardíaca, se crilesionó ventrículos8, y se realizaron inyecciones de TI de 3 μl de 1 μg/ml de DAPI y 1 μg/ml de Phalloidin AF649 a los 3 y 7 días después de la criolesión (DPCI) (figura 4a). A 1 h después de la inyección, los corazones fueron recogidos, fijos, seccionados y manchados con Phalloidin AF568 para visualizar el miocardio intacto. Descubrimos que tanto el miocardio como el tejido lesionado contenían numerosas células positivas de DAPI, lo que indica una penetración eficiente de este tinte en el corazón intacto y en el tejido fibrotico (Figura 4B). Además, la Phalloidin inyectada AF649 también fue incorporada por cardiomiocitos de la zona peri-lesión y algunos reclutaron fibroblastos de la zona lesionados. Este experimento revela que los fármacos pueden atravesar el epicardio y penetrar en el miocardio subyacente.

Después de probar la eficiencia de las inyecciones de ti usando tintes, analizamos los efectos de las proteínas inyectadas en el corazón. Hemos sintetizado una citoquina, llamada CNTF, que se alza después de la toracotomía24. Investigamos los efectos de la CNTF exógena en varios procesos, a saber, la proliferación de cardiomiocitos, la deposición de matrices extracelulares, el reclutamiento de células inmunes y la expresión génica cardioprotectora. Descubrimos que todos estos aspectos biológicos se activaron mediante la inyección de TI de CNTF, en comparación con las inmunoglobulinas de control (figura 5)24. Estos resultados demuestran que el método de inyección intratorácica proporciona una estrategia adecuada para la entrega selectiva de proteínas para estudiar sus efectos en los distintos tejidos del corazón en una variedad de ensayos.

Figure 1
Figura 1: inyección Intrathorascic (it) en el pez cebra adulto. (A) fotografía de un capilar de microinyección extraída con filamento (6 ", 1,0 mm de diámetro) y valores del programa de extractor de agujas utilizado. (B) fotografía de un capilar de microinyección extraída con filamento (6 ", 1,0 mm de diámetro) llenado con 2,5 μl de solución conteniendo un 10% de rojo fenol. La punta extraída de la aguja es máxima de 7 mm de largo. (C) representación esquemática del procedimiento de inyección de ti. (D) fotografías del procedimiento de inyección de ti. Esta cifra ha sido modificada de Bise et al.24. Los números en los paneles C y D corresponden a los mismos pasos del procedimiento: (1) el pescado se coloca ventral lado hacia arriba en una esponja humidificada. El sitio de punción (punto rojo en el triángulo) se encuentra en el centro del tórax cerca de las branquias. (2) penetración de la aguja en el pericardio. El punto rojo indica el sitio de punción. (3) la inyección se monitorea observando la propagación de la solución roja en la cavidad pericárdica. (E) esquema de la inyección. El ángulo entre el capilar de inyección y el eje del cuerpo debe estar entre 30 ° y 45 ° para evitar la punción cardíaca. (F) fotografías de peces tórax a 1 hora después de la inyección de TI de los volúmenes indicados. Las flechas blancas apuntan al tejido remarcado, que podría indicar sangrado interno. Por favor, haga clic aquí para ver una versión más grande de esta figura.

Figure 2
Figura 2: las soluciones inyectadas de TI se extienden casi uniformemente sobre la superficie del corazón. (A) imágenes estereomicroscopios de corazones enteros de peces sometidos a inyección de ti post-mortem con 2,5 ΜL de HBSS o 2,5 μl de tinta. La tinta manchó la superficie del ventrículo (V), el atrio (A) y el el bulbo arterioso (BA). Barra de escala = 300 μm. (B) imágenes estereomicroscopios de campo brillante y fluorescentes de corazones enteros de peces sometidos a inyección de TI con HBSS y 3 μl de 1 μg/ml de DAPI. La fluorescencia de DAPI se detecta en las partes del corazón poco después de la inyección de ti. Barra de escala = 300 μm. por favor, haga clic aquí para ver una versión más grande de esta figura.

Figure 3
Figura 3: comparación de dos métodos de inyección para la entrega de DAPI al corazón. (A) esquema del diseño experimental. Las inyecciones intraperitoneal (IP) e Intrathorascic (IT) se realizaron con la misma cantidad de 1 μg/mL de DAPI (3 μL). Los corazones fueron recogidos en 5 y 120 min después de la inyección. (B) imágenes de microscopía confocal de secciones cardíacas manchadas con Phalloidin fluorescente (rojo) que etiqueta abundantemente las fibras musculares. La DAPI inyectada fue visualizada en el canal apropiado mostrado en verde. Después de la inyección de IP, DAPI no se detecta en el corazón en cualquier momento. Después de la inyección de ti, las células positivas de DAPI están presentes en el ventrículo después de ambos puntos de tiempo. Barra de escala = 500 μm. por favor, haga clic aquí para ver una versión más grande de esta figura.

Figure 4
Figura 4: inyección de TI para estudiar la regeneración cardíaca. (A) esquema del diseño experimental. A los 3 y 7 días después de la criolesión, se inyectó una mezcla de DAPI y Phalloidin AF649 (3 μL de 1 μg/mL). Los corazones fueron recogidos 1 hora después de la inyección de ti, fijo, seccionado y manchado con Phalloidin AF568 (rojo). (B) imágenes de microscopía confocal de secciones cardíacas longitudinales a 3 y 7 DPCI. Células de la etiqueta DAPI (verde) y Phalloidin AF649 (azul) inyectadas de la zona lesionada (delimitadas por la línea blanca discontinua) y el miocardio intacto (mancha roja). Las flechas blancas apuntan a la distribución DAPI (verde) a través de la miocardia compacta y trabeculada intacta y el epicardio. Barra de escala = 500 μm. por favor, haga clic aquí para ver una versión más grande de esta figura.

Figure 5
Figura 5: la CNTF exógena inyectada estimula varios procesos biológicos en el corazón. (A) esquema del diseño experimental. En primer lugar, se inyectaron 2,5 μL de una solución que contenía 250 ng de pez cebra CNTF o inmunoglobulinas de control (hIgG) en el pericardio de peces transgénicos que expresaban DsRed2 nucleares en cardiomiocitos. Los corazones fueron recolectados a los 7 y 1 días después de la inyección (DPI) y analizados por inmunofluorescencia e hibridación in situ, respectivamente. (B-D) Imágenes de microscopía confocal de secciones ventriculares de control y corazones inyectados en CNTF. (B) inmunostaining contra un marcador de ciclo celular, componente complejo de mantenimiento minicromosoma 5 (MCM5; verde), revela un mayor número de cardiomiocitos proliferantes en respuesta a CNTF exógena. Barra de escala = 500 μm. (C) el inmunoostenamiento contra el colágeno XII muestra un aumento de la deposición de colágeno XII en el miocardio después de la inyección de CNTF. En el corazón del control, el colágeno XII se limita al epicardio34. Barra de escala = 500 μm. (D) la inmunoostención contra un marcador de células inmunitarias, L-Plastina, detecta un mayor reclutamiento de células inmunitarias en el pescado inyectado de CNTF. Barra de escala = 500 μm. (E) las imágenes del microscopio de campo brillante de las secciones transversales ventriculares después de la hibridación in situ utilizando una sonda de ARNm antisentido contra la cistatina, un factor cardioprotector, muestra la regulación transcripcional de este gen en el corazón de peces inyectados por CNTF. Barra de escala = 500 μm. Esta cifra ha sido modificada de Bise et al.24. Por favor, haga clic aquí para ver una versión más grande de esta figura.

Discussion

Aquí, describimos un método para la entrega de compuestos y proteínas exógenas en la cavidad pericárdica con el fin de estudiar sus efectos en el corazón en el pez cebra adulto. El procedimiento se basa en la inyección intratorácica, lo que resulta en la entrega de un pequeño volumen de solución en las proximidades del órgano. Esta técnica fue desarrollada y descrita para estudiar el preacondicionamiento cardíaco y la regeneración.

El paso crítico en este procedimiento es la penetración del capilar de vidrio en la cavidad torácica. Este paso depende de tres parámetros: la rigidez y la nitidez de la punta capilar, el ángulo de penetración y el sitio de punción. Para optimizar la penetración a través de la piel, la parte extraída del capilar no debe ser demasiado larga, ya que tales agujas son demasiado flexibles y se doblan en contacto con la piel. Para evitarlo, la rigidez se puede adaptar reduciendo el tamaño de la punta con la tijera de iridectomía. Aunque el ángulo de penetración puede variar entre 30 ° y 45 °, se puede adaptar a la rigidez de la punta. De hecho, una punta delgada penetrará la piel mejor con un ángulo más estrecho.

Con el fin de optimizar la penetración de la aguja, el sitio de inserción debe estar inmediatamente por encima del corazón palpitante. El riesgo de punción cardíaca suele ser bajo que oscila entre el 5% y el 8%. La inserción de la aguja posterior al corazón aumenta el riesgo de punción cardíaca, como se ve por el sangrado mejorado. En tales casos, los animales deben ser removidos de los experimentos.

Otra fuente de problemas durante la inyección de TI se produce en el nivel capilar. De hecho, el capilar puede romperse cuando se ejercen fuerzas laterales sobre ella. Para evitar esto, la aguja debe moverse a lo largo del eje de inyección de forma recta. Ocasionalmente, el capilar puede ser bloqueado por residuos de tejido que impiden que el líquido fluya. La aguja puede desbloquearse retirando suavemente la punta mientras se inyecta. Si esto no mejora el caudal, recomendamos retirar por completo la aguja del tórax y sustituir la aguja.

Las lesiones pueden ser causadas por una aguja muy profundamente insertada en el pericardio. Con el fin de evitar lesiones en el saco pericárdico, la aguja no debe insertarse demasiado (1 − 2 mm) en el tórax. Se observaron algunas fugas cuando el volumen de inyección era mayor de 8 μL.

En el pez cebra, se desconoce la composición exacta del fluido pericárdico. Sin embargo, el volumen de la cavidad pericárdica se estima en ~ 10 μL31. Dado que el volumen del ventrículo de pez cebra adulto es de aproximadamente 1 − 2 mm3, suponemos que la cavidad pericárdica en consecuencia tiene un volumen pequeño, que debe ser considerado antes de las inyecciones. A partir de nuestros estudios preliminares, determinamos que el rango óptimo del volumen inyectado es entre 0,5 y 3 μL para peces que miden 2,5-2,8 cm (distancia desde el hocico hasta el pedúncula caudal). Este volumen se puede adaptar en función del tamaño del pez. La inyección de hasta 5 μL no induce ninguna lesión en el pez de este tamaño. Sin embargo, los volúmenes de 8 μL fueron suficientes para causar sangrado interno y abultamiento, como se muestra en la Figura 1F. Basándonos en estos datos, estimamos que una cantidad de solución mayor a 3 μL podría causar estrés físico y fisiológico en el órgano. Esta limitación deduce la necesidad de elegir una mayor concentración de moléculas en lugar de aumentar la cantidad de la solución inyectada.

Otro factor importante es la propiedad osmótica de la solución inyectada, que debe estar en el rango fisiológico. De hecho, para evitar el riesgo de estrés osmótico, recomendamos HBSS como medio de inyección.

En el pez cebra, los métodos comunes utilizados para suministrar fármacos son a través del tratamiento de agua y la inyección intraperitoneal30,35. Aunque ambas técnicas son adecuadas para muchas aplicaciones, las inyecciones de ti proporcionan ventajas experimentales y económicas, disminuyendo los riesgos de efectos secundarios sistémicos no deseados y reduciendo el uso de moléculas costosas, respectivamente. Este método puede ser adecuado para la entrega de tamoxifeno para activar el sistema transgénico CRE-ERT2 utilizado para el análisis de rastreo de linaje celular, y guiar RNAs modificados para estudios funcionales en la investigación de regeneración.

El método de inyección de IT en el pez pez cebra se ha descrito anteriormente31,36. En esos informes, las inyecciones intratorácicas se realizaron con aguja de insulina, pinchando desde el lado anterior. En contraste, nuestro protocolo presenta una estrategia alternativa con el capilar de vidrio extraído insertado desde la dirección posterior. Específicamente, nuestro enfoque tiene en cuenta la anatomía del pericardio de los peces para optimizar la inyección con un menor riesgo de punción cardíaca. Además, durante el procedimiento, el pez no está retenido por fórceps metálicos, sino por una esponja húmeda y blanda, que es un método más adecuado para evitar cualquier lesión externa del pez. Por lo tanto, el método presentado podría ser más adecuado para estudios de homeostasis cardiaca, preacondicionamiento y regeneración en el pez cebra adulto.

Las inyecciones de ti ya se han establecido en los organismos modelo de mamíferos. De hecho, este método también se ha aplicado en experimentos con cerdos y estudios clínicos en humanos37,38. En ratones, las inyecciones intramyocárdicas transtorácicas guiadas por ultrasonidos se han utilizado para desafiar su corazón39. En este artículo proponemos un protocolo detallado para facilitar el uso de la inyección de TI para el pez cebra. Esto será particularmente valioso para el campo, con el fin de complementar los enfoques genéticos en la homeostasis cardiaca, preacondicionamiento y la investigación de la regeneración.

Disclosures

Los autores no tienen nada que revelar.

Acknowledgments

Agradecemos a V. Zimmermann por su excelente asistencia técnica y por el cuidado de los peces, D. König (Universidad de Friburgo) para la lectura crítica del manuscrito, D. Kressler (Universidad de Friburgo) en busca de ayuda con la síntesis proteica de zCNTF, F. Ruggiero (Institut de génomique Fonctionnelle de Lyon) para proporcionar el anticuerpo de ColXII, y P. Martin (Universidad de Bristol) para el anticuerpo de L-Plastina. Agradecemos el centro de imágenes y la plataforma de Proteómica de la Universidad de Friburgo. Este trabajo fue apoyado por la Fundación Nacional de Ciencias de Suiza, Grant número 310030_179213, y por la Schweizerische Herzstiftung (Fundación Suiza del corazón).

Materials

Name Company Catalog Number Comments
Hanks Balanced Salt Solution Gibco by Life technology 14065-056
Iridectomy scissor Roboz Surgical Instruments Co RS-5602
Macroscope (binocular) M400 with Apozoom
Micro-injector femtojet Eppendorf 5247 0034 77
Microloaders femtotips Eppendorf 5242 956.003
Micropipette glass needles type C WPI TW100F-6 thin-wall capillary
Micropipette puller model P-87 Flaming/Brown 20081016 filament box 2.5 mm x 4.5 mm
Sponge any any dim. carved sponge 7cm x 3 cm x 1 cm
Tricaine (Anestethic) Sigma E10521
Dyes and Antibodies Company Catalog Number Comments
anti-Chicken Cy5 Jackson ImmunoResearch Laboratories Concentration: 1/500
anti-Guinea pig Cy5 Jackson ImmunoResearch Laboratories Concentration: 1/500
anti-Rabbit Cy5 Jackson ImmunoResearch Laboratories Concentration: 1/500
Chicken l-plastin gift from P. Martin, Bristol Concentration: 1/1,000
DAPI Sigma 10236276001 Concentration: 1/2,000 (1µg/ml); 1/100 IT injected
Guinea pig anti-ColXII gift from Florence Ruggerio, Lyon Concentration: 1/500
Phalloidin-Atto-565 (F-actin) Sigma 94072 Concentration: 1/500
Phalloidin-Atto-647 (F-actin) Sigma 95906 Concentration: 1/50 IT injected
Rabbit anti-MCM5 gift from Soojin Ryu, Heidelberg Concentration: 1/500
Stamping Ink 4K Pelikan 1 4k 351 197 Concentration: 1/1
ISH probe primers
Cystatin gene number: ENSDARG00000074425
fw primer: GATTCACTGTCGGGTTTGGG
Rev primer: ATTGGGTCCATGGTGACCTC

DOWNLOAD MATERIALS LIST

References

  1. Tzahor, E., Poss, K. D. Cardiac regeneration strategies: Staying young at heart. Science. 356, (6342), 1035-1039 (2017).
  2. Iismaa, S. E., et al. Comparative regenerative mechanisms across different mammalian tissues. npj Regenerative Medicine. 3, (1), (2018).
  3. Xiang, M. S. W., Kikuchi, K. Endogenous Mechanisms of Cardiac Regeneration. Int Rev Cell Mol Biol. 326, 67-131 (2016).
  4. González-Rosa, J. M., Burns, C. E., Burns, C. G. Zebrafish heart regeneration: 15 years of discoveries. Regeneration. 4, (3), 105-123 (2017).
  5. Jazwinska, A., Sallin, P. Regeneration versus scarring in vertebrate appendages and heart. The Journal of Pathology. 238, (2), 233-246 (2016).
  6. Sehring, I. M., Jahn, C., Weidinger, G. Zebrafish fin and heart: what's special about regeneration? Current Opinion in Genetics & Development. 40, 48-56 (2016).
  7. Rubin, N., Harrison, M. R., Krainock, M., Kim, R., Lien, C. L. Recent advancements in understanding endogenous heart regeneration-insights from adult zebrafish and neonatal mice. Seminars in Cell and Developmental Biology. 58, 34-40 (2016).
  8. Chablais, F., Veit, J., Rainer, G., Jazwinska, A. The zebrafish heart regenerates after cryoinjury-induced myocardial infarction. BMC Developmental Biology. 11, 21 (2011).
  9. Schnabel, K., Wu, C. C., Kurth, T., Weidinger, G. Regeneration of cryoinjury induced necrotic heart lesions in zebrafish is associated with epicardial activation and cardiomyocyte proliferation. PLoS One. 6, (4), e18503 (2011).
  10. Gonzalez-Rosa, J. M., Martin, V., Peralta, M., Torres, M., Mercader, N. Extensive scar formation and regression during heart regeneration after cryoinjury in zebrafish. Development. 138, (9), 1663-1674 (2011).
  11. Poss, K. D., Wilson, L. G., Keating, M. T. Heart regeneration in zebrafish. Science. 298, (5601), 2188-2190 (2002).
  12. Cao, J., Poss, K. D. The epicardium as a hub for heart regeneration. Nature Reviews Cardiology. 15, (10), 631-647 (2018).
  13. Andres-Delgado, L., Mercader, N. Interplay between cardiac function and heart development. Biochim Biophys Acta. 1863, 1707-1716 (2016).
  14. Richardson, R. J. Parallels between vertebrate cardiac and cutaneous wound healing and regeneration. npj Regenerative Medicine. 3, 21 (2018).
  15. Lai, S. -L., Marín-Juez, R., Stainier, D. Y. R. Immune responses in cardiac repair and regeneration: a comparative point of view. Cellular and Molecular Life Sciences. (2018).
  16. Kikuchi, K., et al. Primary contribution to zebrafish heart regeneration by gata4(+) cardiomyocytes. Nature. 464, (7288), 601-605 (2010).
  17. Jopling, C., et al. Zebrafish heart regeneration occurs by cardiomyocyte dedifferentiation and proliferation. Nature. 464, (7288), 606-609 (2010).
  18. Pfefferli, C., Jaźwińska, A. The careg element reveals a common regulation of regeneration in the zebrafish myocardium and fin. Nature Communications. 8, 15151 (2017).
  19. Sánchez-Iranzo, H., et al. Tbx5a lineage tracing shows cardiomyocyte plasticity during zebrafish heart regeneration. Nature Communications. 9, (1), (2018).
  20. Wang, J., Poss, K. D. Methodologies for Inducing Cardiac Injury and Assaying Regeneration in Adult Zebrafish. Methods In Molecular Medicine. 1451, 225-235 (2016).
  21. Gut, P., Reischauer, S., Stainier, D. Y. R., Arnaout, R. Little Fish, Big Data: Zebrafish as a Model for Cardiovascular and Metabolic Disease. Physiological Reviews. 97, (3), 889-938 (2017).
  22. de Preux Charles, A. S., Bise, T., Baier, F., Marro, J., Jazwinska, A. Distinct effects of inflammation on preconditioning and regeneration of the adult zebrafish heart. Open Biology. 6, (7), (2016).
  23. de Preux Charles, A. S., Bise, T., Baier, F., Sallin, P., Jazwinska, A. Preconditioning boosts regenerative programmes in the adult zebrafish heart. Open Biology. 6, (7), (2016).
  24. Bise, T., de Preux Charles, A. S., Jazwinska, A. Ciliary neurotrophic factor stimulates cardioprotection and the proliferative activity in the zebrafish adult heart. npj Regenerative Medicine. 4, (2019).
  25. Thorimbert, V., Konig, D., Marro, J., Ruggiero, F., Jazwinska, A. Bone morphogenetic protein signaling promotes morphogenesis of blood vessels, wound epidermis, and actinotrichia during fin regeneration in zebrafish. The FASEB Journal. 29, (10), 4299-4312 (2015).
  26. König, D., Page, L., Chassot, B., Jaźwińska, A. Dynamics of actinotrichia regeneration in the adult zebrafish fin. Developmental Biology. 433, (2), 416-432 (2018).
  27. Sallin, P., Jaźwińska, A. Acute stress is detrimental to heart regeneration in zebrafish. Open Biology. 6, (3), 160012 (2016).
  28. Mokalled, M. H., Poss, K. D. A Regeneration Toolkit. Developmental Cell. 47, (3), 267-280 (2018).
  29. Pugach, E. K., Li, P., White, R., Zon, L. Retro-orbital Injection in Adult Zebrafish. Journal of Visualized Experiments. (34), e1645 (2009).
  30. Kinkel, M. D., Eames, S. C., Philipson, L. H., Prince, V. E. Intraperitoneal Injection into Adult Zebrafish. Journal of Visualized Experiments. (42), (2010).
  31. Xiao, C., et al. Nanoparticle-mediated siRNA Gene-silencing in Adult Zebrafish Heart. Journal of Visualized Experiments. (137), (2018).
  32. Chablais, F., Jazwinska, A. Induction of myocardial infarction in adult zebrafish using cryoinjury. Journal of Visualized Experiments. (62), (2012).
  33. Gonzalez-Rosa, J. M., Mercader, N. Cryoinjury as a myocardial infarction model for the study of cardiac regeneration in the zebrafish. Nature Protocols. 7, (4), 782-788 (2012).
  34. Marro, J., Pfefferli, C., de Preux Charles, A. S., Bise, T., Jazwinska, A. Collagen XII Contributes to Epicardial and Connective Tissues in the Zebrafish Heart during Ontogenesis and Regeneration. PLoS One. 11, (10), e0165497 (2016).
  35. Ma, X., Ding, Y., Wang, Y., Xu, X. A Doxorubicin-induced Cardiomyopathy Model in Adult Zebrafish. Journal of Visualized Experiments. (136), (2018).
  36. Diao, J., et al. PEG-PLA nanoparticles facilitate siRNA knockdown in adult zebrafish heart. Developmental Biology. 406, (2), 196-202 (2015).
  37. Lloyd, L. C., Etheridge, J. R. The pathological and serological response induced in pigs by parenteral inoculation of Mycoplasma hyopneumoniae. Journal of Comparative Pathology. 91, (1), 77-83 (1981).
  38. Zhou, A., Guo, L., Tang, L. Effect of an intrathoracic injection of sodium hyaluronic acid on the prevention of pleural thickening in excess fluid of tuberculous thoracic cavity. Clinical and Experimental Pharmacology and Physiology. 30, (3), 203-205 (2003).
  39. Prendiville, T. W., et al. Ultrasound-guided Transthoracic Intramyocardial Injection in Mice. Journal of Visualized Experiments. (90), (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics