השתקה הניצוץ: CRISPR/Cas9 הגנום עריכה בדגים חשמליים חלש

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

כאן, פרוטוקול מוצג לייצר והאחורי CRISPR/Cas9 הגנום מנוקאאוט דגים חשמליים. מפורטים בפירוט הינם דרישות הביולוגיה המולקולרית, הרבייה והטיפול בשני הצדדים, ובטכניקות הזרקה ושיטות הזרקת הCas9 המושרה ביותר.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Constantinou, S. J., Nguyen, L., Kirschbaum, F., Salazar, V. L., Gallant, J. R. Silencing the Spark: CRISPR/Cas9 Genome Editing in Weakly Electric Fish. J. Vis. Exp. (152), e60253, doi:10.3791/60253 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

הגשלות האלקטורלוגיה ואלקטרוגנזה השתנו בהיסטוריה האבולוציונית של החוליות. יש מידה מרשימה של התכנסות אלה פנוטיפים נגזר באופן עצמאי, אשר חולקים ארכיטקטורה גנטית משותפת. זה אולי הטוב ביותר לידי ביטוי על ידי התכונות הרבות מתכנסת של צורות הג ו mormyrids, שני מינים עשירים teleost clades כי לייצר ולזהות שדות חשמליים חלשים והם נקראים דגים חשמליים חלש. בשנים 50 מאז התגלית כי הדגים החשמליים חלש להשתמש בחשמל כדי לחוש את סביבתם ולתקשר, קהילה גוברת של מדענים צברה תובנות עצומות להתפתחות של פיתוח, מערכות ומעגלים מדעי המוח, פיזיולוגיה של הסלולר, אקולוגיה, ביולוגיה אבולוציונית והתנהגות. לאחרונה, יש התפשטות של משאבים גנומית עבור דגים חשמליים. השימוש במשאבים אלה כבר הנחה תובנות חשובות לגבי הקשר בין הגנוטיפ לבין הפנוטיפים במינים אלה. מכשול גדול לשילוב נתונים גנומיקה עם נתונים פנוטים של דגים חשמליים חלש הוא העדר הנוכחי של כלי גנומיקה תפקודית. אנו מדווחים כאן פרוטוקול מלא לביצוע CRISPR/Cas9 מוטגנזה אשר מנצל מנגנוני תיקון DNA אנדוגניים בדגים חשמליים חלש. אנו מדגימים כי פרוטוקול זה הוא יעיל באותה מידה הן מיני מורגמיל ברינורוס ברכימיטיוס ואת הטופס המסוןברכימוטציות gauderio באמצעות Crispr/Cas9 כדי למקד את indels ואת הנקודה המוטציות באקסון הראשון של ערוץ הנתרן גן scn4aa. באמצעות פרוטוקול זה, עוברים משני המינים הושגו והוקלדה על מנת לאשר כי המוטציות החזוי ב הראשון של ערוץ הנתרן scn4aa היו נוכחים. הצלחת להוריד את ההצלחה פנוטיפ היה אישר עם הקלטות מראה מופחת החוצה איבר חשמלי הפחתת המוני כאשר לעומת שולטת בגודל לא מוזרק התאמה.

Introduction

הגשלות האלקטורלוגיה ואלקטרוגנזה השתנו בהיסטוריה האבולוציונית של החוליות. שני מדורות של דגי teleost, אוסטוריאים וסילאואים, התפתחו התפשלות חשמלית במקביל, וחמש שנות שילוח (ממוראים, מוררידים, וכללי אסטרוסקופוס, מאלאפטראורוס וסינודונטיס) התפתחו אלקטרוגנזה במקביל. יש מידה מרשימה של התכנסות אלה פנוטיפים נגזר באופן עצמאי, אשר חולקים ארכיטקטורה גנטית משותפת1,2,3.

זה אולי הטוב ביותר לידי ביטוי על ידי התכונות הרבות מתכנסת של טפסי ממורשים ו mormyrids, שני מינים עשירים teleost clades, אשר לייצר ולזהות שדות חשמליים חלשים והם נקראים דגים חשמליים חלש. בשנים 50 מאז גילוי כי הדגים החשמליים חלש להשתמש בחשמל כדי לחוש את סביבתם ולתקשר4, קהילה גוברת של מדענים צברה תובנות עצומות לתוך האבולוציה של פיתוח1,5 ,6, מערכות ומעגלים מדעי המוח7,8,9,10, פיזיולוגיה הסלולר11,12, אקולוגיה ו energetics13 ,14,15,16,17, התנהגות18,19, ומאקרואבולוציה3,20,21 .

לאחרונה, יש התפשטות של גנומית, טראנסקריפט, ו פרוטאומית משאבים עבור דגים חשמליים1,22,23,24,25,26, 27,28. השימוש במשאבים אלה כבר הפיק תובנות חשובות בנוגע לקשר בין גנוטיפ לפנוטיפ במינים אלה1,2,3,28,29 ,30. מכשול גדול כדי לשלב נתונים גנומיקה עם נתונים פנוטימית של דגים חשמליים חלש הוא חוסר הנוכחי של כלים גנומיקה תפקודית31.

אחד כלי כזה הוא שפותחה לאחרונה באשכולות באופן קבוע במרווחים של Palindromic קצר לזווג עם Cas9 endonuclease (CRISPR/Cas9, CRISPR) טכניקה. Crispr/Cas9 הוא כלי עריכת הגנום כי נכנס לשימוש נרחב בשני דגם32,33,34 ו אורגניזמיםשאינם מודל 35,36, 37 כאחד . CRISPR/Cas9 הטכנולוגיה התקדמה לנקודה שבה מעבדה המסוגלת ביולוגיה מולקולרית בסיסי יכול בקלות ליצור גנים ספציפיים המכונה RNAs מדריך קצר (sgRNAs), בעלות נמוכה באמצעות שיטה שאינה שיבוט38. Crispr יש יתרונות על אחרים הסתרה/מיקוד אסטרטגיות, כגון activator olinos39,40, תמלול שעתוק כמו הנוקלאוסים (talens), ו אבץ האצבעות הנוקלאוטיות (zfns), אשר יקרים ו זמן רב להפיק. עבור כל גן מטרה

מערכת CRISPR/Cas9 פונקציות כדי ליצור הסתרה גנים על ידי התמקדות באזור ספציפי של הגנום, בבימויו של רצף sgRNA, וגרימת הפסקה כפולה תקוע. הפסקה כפולה נתקע מזוהה על ידי התא ומפעילה מנגנוני תיקון DNA אנדוגניים המועדפת באמצעות הסוף הלא הומוולוגי להצטרף (NHEJ) המסלול. מסלול זה הוא מאוד מועדת לטעויות: במהלך תהליך התיקון, מולקולת ה-DNA כוללים לעתים קרובות הוספות או מחיקות (indels) באתר הפריצה כפול תקוע. Indels אלה יכולים לגרום לאובדן של הפונקציה בשל אחד (1) משמרות במסגרת הקריאה הפתוחה, (2) החדרת codon עצירה מוקדמת, או (3) משמרות במבנה העיקרי הקריטי של המוצר הגן. בפרוטוקול זה, אנו מנצלים CRISPR/Cas9 עריכה כדי מוטציות נקודת היעד בגנים היעד באמצעות NHEJ ב מינים של דגים חשמליים חלש. בעוד ששיטה זו פשוטה ויעילה יותר מטכניקות אחרות, צפויה שיטה זו של מוטגנזה לגרום למגוון של התסופנותולים ב-F0, המיוחס לפסיפס גנטי41,42,43 ,44

מבחר של אורגניזמים
לצורך הקלה על מחקרים עתידיים על הגנומיקה השוואתית של דג חשמלי חלש, מינים מייצגים עבור הטפסים ומורמירידים לפיתוח פרוטוקולים הדרושים כדי להיבחר. בעקבות דיונים במהלך הפגישה 2016 דג חשמלי במונטווידאו, אורוגוואי, היה קונצנזוס הקהילה לנצל מינים שכבר יכול להיות מתרבה במעבדה, כי היו משאבים גנומית זמין. והמורמיטיוס של ברימאסיוס . נבחרו כמינים המתאימים לקריטריונים הללו... בשני המינים, רמזים טבעיים כדי לגרום ולשמור על תנאי הרבייה קל לחקות בשבי. ב. gauderio, מינים בצורת מיני מדרום אמריקה, יש את היתרון של דרישות גידול נמוכות: ניתן לשמור על הדגים בצפיפות גבוהה יחסית בטנקים קטנים יחסית (4 ל). ב. gauderio גם יש מחזור דורי מהיר בתנאים שבויים. בתנאי מעבדה, B. gauderio יכול להתפתח ביצה למבוגר בתוך כ 4 חודשים.

ב. ברכסיטיוס, זן של דג מורמי ממערב אפריקה, מוליד בקלות בשבי. ב. ברכסיטיוס הוא זמין באמצעות הסחר באקווריום, נעשה שימוש נרחב במחקרים רבים, וכעת יש מספר משאבים גנומית זמין. מחזור חייהם משתרע על פני 1-3 שנים, תלוי בתנאי מעבדה. דרישות הגידול מאינטנסיביות מעט יותר עבור מין זה, הדורשות מיכלים בגודל בינוני (50 ל-100 ליטר) בשל התוקפנות שלהם במהלך הרבייה.

מעבדות לימוד מינים אחרים של דגים חשמליים צריך להיות מסוגל להתאים בקלות את הפרוטוקול הזה כל עוד המינים יכולים להיות מתרבה, ועוברי תא בודד ניתן לאסוף והתרומם לתוך בבגרות. הדיור, גידול הזחל, ו הפריה חוץ גופית (IVF) התעריפים עשויים להשתנות עם מינים אחרים; עם זאת, פרוטוקול זה יכול לשמש כנקודת התחלה עבור ניסיונות רבייה של דגים חשמליים חלש אחרים.

יעד הגן האידיאלי עבור הוכחת המושג: scn4aa
מורגמיל חשמלי חלש ודגים מיוחדים יוצרים שדות חשמליים (אלקטרוגנזה) על ידי הפעלת איבר מיוחד, שנקרא עוגב חשמלי. מקלעת לאיברים חשמליים (EODs) נובעת מייצור סימולטני של פוטנציאל פעולה בתאי איבר חשמלי הנקרא אלקטרוציטים. EODs מזוהים על ידי מערך של אלקטורים חשמליים בעור כדי ליצור תמונות חשמל ברזולוציה גבוהה של הסביבה של הדג45. דגים חשמליים חלש הם גם מסוגלים לזהות תכונות של הפרטים שלהם ' EOD גל טפסים18 , כמו גם את שיעורי השחרור שלהם46, המאפשר eod לתפקד בנוסף כאות תקשורת חברתית האנלוגית לשיר ציפורים או צפרדע ברירתמ47.

המרכיב העיקרי של הדור הפוטנציאלי לפעולה באלקטרוציטים של מורגמיל הן והוא בצורה מאוד לא ברור דגים חשמליים חלש הוא ערוץ הנתרן מגודרת מתח 1.42. טלאוסטים שאינם חשמליים מבטאים שני עותקי גנים paralogous, scn4aa ו scn4ab, קידוד עבור ערוץ הנתרן מגודרת מתח 1.430. בשני הצדדים האלה ומורייפטור מפני הscn4aa דגים חשמליים חלש, התפתחו במהירות ועברו החלפות חומצות אמינו רבות המשפיעות על המאפיינים הקינטית שלה48. והכי חשוב, scn4aa הפכה להיות ממדר בשני הצדדים לעוגב חשמלי2,3. הביטוי המוגבל יחסית של scn4aa לאיבר החשמלי, כמו גם התפקיד העיקרי שלה בדור של eods, הופך אותו יעד אידיאלי עבור הניסויים CRISPR/Cas9, כפי שיש לו אפקטים מינימליים מינימלית pleiotropic. בגלל הדגים החשמליים חלש להתחיל לפתוח את הזחל שלהם האיברים החשמליים 6-8 ימים הפריה פוסט (DPF), פילוח של scn4aa הוא אידיאלי מתאים לפנוטיפים מהירים לאחר העובר מיקרוהזרקה.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

כל השיטות המתוארות כאן אושרו על ידי הוועדה לטיפול בבעלי חיים מוסדיים (IACUC) של אוניברסיטת מדינת מישיגן.

1. בחירת יעדי sgRNA

הערה: פרוטוקול מסופק לעיצוב ידני של sgRNAs בשלב 1.1. זה היה מנוצל לבחירת היעד scn4aa . פרוטוקול נוסף מסופק כדי להקל על תהליך זה (שלב 1.2) באמצעות פורטל האינטרנט של EFISHגנומיקה. מומלץ למשתמשים לבחור פרוטוקול 1.2, הכולל מספר ' בדיקות ' אוטומטיות כדי להבטיח הצלחה בעיצוב sgRNAs עבור מטרות מותאמות אישית.

  1. עיצוב מטרות sgRNA.
    1. ליצירת sgrna מדריך oligos, עדיף להתמקד אקסון 1, או אחרים 5 ' אקסון. את 5 ' UTR ניתן לפלח; עם זאת, מוטב למקד את רצף הקידוד של 5. ניצול מידע גנומי הוא עדיף, אבל זה אפשרי לפתח sgRNAs מוצלחת באמצעות נתונים transcript. ביאורים של גבולות intron/exon (נתונים גנומית) או הגבול/exon גבולות עדיף.
    2. המועמד רצפים גנומית מ 1.1 מתבצע חיפוש אחר רצפי היעד התואמים את התבנית 5 '-N (18)-NGG-3 '. זה יכול להתבצע באופן אוטומטי באמצעות תוכנת ניתוח רצף שולחן העבודה, סקריפטים מותאמים אישית, או באמצעות בדיקה ידנית של רצפים.
    3. ניתן לסדר את הרצפים באמצעות השיטה של דוותר ואח '49 לפעילות ביעד. בנוסף, רצפי היעד עשויים להיות מוערכים על-ידי חיפוש הפיצוץ נגד מסדי נתונים גנומית/הטרנססקריפט עבור כריכה מחוץ ליעד.
    4. ודא שניתן ליצור את התחל הרגיל של ה-PCR המאגף את רצף היעד. התחל צריך להיות לפחות 20 bp משני הצדדים של האתר לחתוך (שלושה בסיסים במעלה הזרם NGG). באופן אידיאלי, מוצר ה-PCR צריך להיות 150-200 בסיס זוגות (bp).
    5. עיצוב oligomers מפגש את הקריטריונים לעיל באמצעות התבנית להלן, הכוללת יזם T7 (5 ' של N18) ואזור משלים (3 ' של n18) לריפוי הקבוע לינלייומר (1.1.6): 5 '-TAאטקGהטקקאכא2-N18 -הגנה מפני 3 '
      הערה: רצף N18 אינו כולל את מוטיב ngg בסמוך (פאם) רצף. אל תכלול את זה באולייומר.
    6. הזמן את ה-אוליגומר הקבוע (טבלה 1) אשר ישמש לסנתז את כל sgrnas, oligomers עבור מטרות sgrnas (שלב 1.1.5), ו-PCR התחל (שלב 1.1.4) כמו oligomers סטנדרטי מתוך שירות הפקה של האוליונולי. ניתן להזמין אולימרים ו-PCR התחל כסטנדרט oligomers סטנדרטיים, אין צורך בטיהור נוסף.
  2. בצע עיצוב אוטומטי של יעדי sgRNA.
    1. באמצעות נתונים גנומית, בחר גן יעד. ניתן להשתמש בנתונים טראנסקריפט במקום זאת כאשר גבולות exon/intron ידועים. מטרות ניתן לזהות באמצעות הפורטל EFISHגנומיקה (http://efishgenomics.integrativebiology.msu.edu). היעד האידיאלי יהיה בתוך אקסון 1; עם זאת, 5 ' exons אחרים ו 5 ' UTR יכול להיחשב.
    2. לאחר רצף היעד מזוהה, טען את הכלי הזמין באופן חופשי EFISHגנומיקה CRISPR (http://efishgenomics.integrativebiology.msu.edu/crispr_tool/). כלי אינטרנט זה משתמש בגירסה מותאמת אישית של האלגוריתם crispor עבור דור היעד50,51.
    3. בתיבה עבור שלב 1, הזן את שם הרצף והזן את רצף היעד לתוך התיבה המתאימה.
  3. בחר את הגנום המתאים שהרצף נובע ממנו. כיום, נתונים גנומית זמינים עבור b. ברכסינטיוס ו ב gauderio. רצפי הגנום אינם נדרשים לשימוש בכלי זה, אך הם שימושיים בהערכת פוטנציאל לא רצוי השפעות היעד.
  4. בחר את הפאם המתאימה. The 20 bp-NGG פאם מומלץ, אם כי יש כמה מוטיבים פאם נוספים לבחירה, בהתאם חלבון Cas9 בשימוש.
  5. דו ח ייווצר עם המיקום של רצף היעד בגנום עם רצפי מדריך מוצעים. בחר שלושה מטרות עם תופעות נמוכות מחוץ ליעד, ציונים גבוהים ועשרות יעילות גבוהה. רצפים מדריך הניקוד הגבוה ביותר מודגשים עם ירוק בצד שמאל. יש להימנע מרצפי מדריך צהובים ואדומים מודגשים, אם אפשר.
  6. לחיצה על רצפי היעד שנבחרו יוצרת דוח CRISPOR מקיף. מידע מפתח מדוחות אלה מיועד ל-"T7 in ביטוי מתורבת מפני החלת מחלת ביטויים מאוגורונואודים". מתוך דוח זה, חלץ את המידע הבא: מומלץ sgrna oligos, ה-PCR התחל עבור אתר היעד, ו אוליגומר קבוע שישמש לסנתז את כל sgrna.
  7. הסדר את האויגמרים שנבחרו (שלב 1.6) משירות הפקת שירותי הפקה. ניתן להזמין אולימרים ו-PCR התחל כסטנדרט oligomers סטנדרטיים, אין צורך בטיהור נוסף.

2. צור sgRNA

  1. אנאל oligomers ב-PCR שפופרת: להוסיף 1 μL של 100 μM קבוע oligעומר, 1 μL של 100 μM sgRNA מסוים oligיומר ספציפיים, ו 8 μL של nuclease-H חינם2O
  2. אנאל אולימרים בתוך התכנית הבאה: חימום ב95 ° c למשך 5 דקות, קריר עד 85 ° c ב-2 ° צ'/s, קריר עד 25 ° צ' ב 0.1 ° צ'/ים, ולהחזיק 4 ° c.
  3. כדי להפיק את התבנית sgRNA, להוסיף 2.5 μL של שילוב dNTP (10 מ"מ), 2 μL של מאגר 10x, 0.5 μL של T4 DNA פולימראז ו-5 μL של nuclease-H ללא תשלום2O כדי oligomers הנ משלב 2.2. מודקון למשך 20 דקות ב 12 ° c.
  4. טהר את התבנית באמצעות עמודת ה-PCR לניקוי לפי הוראות היצרן.
  5. אליוט בתוך 20 – 30 μL. השתמש בספקטרוסקופיה כדי להעריך ריכוז וטוהר. התבנית צריכה להיות 100-200 ng/μL ו-1.8 – 1.9 A260/280.
  6. ודא באמצעות ג'ל agarose על ידי ריצה 1 – 5 μL. הלהקה הדומיננטית צריכה להיות 120 bp. ראה איור 1A לקבלת תוצאות מייצגות.
  7. אחסון בתבנית sgRNA מאומת ב-20 ° צ' (טווח ארוך) או 4 ° צ' (טווח קצר, 1 – 4 שבועות).
  8. תעתיבה sgRNA באמצעות T7 RNA ערכת שעתוק על-ידי הוספת שפופרת מיקרוצנטריפוגה 1.5 mL בטמפרטורת החדר 8 μL של שילוב dNTP (כמויות שוות של dA, dT, dG, dC), 2 μL של מאגר 10x (טמפרטורת החדר), 2 μL של T7 RNA פולימראז, 100 ליטר תבנית , ו nuclease חינם H2O ל 20 μl כולל נפח. . תסתובב כדי לאסוף בתחתית מודטה עבור 2 – 4 h ב 37 ° c.
  9. הוסף 1 μL של DNase ו-דגירה 15 דקות נוספות ב 37 ° c.
    1. ניקוי sgRNA על ידי הוספת 1 μL של הגליקוגן, 30 μL של nuclease-H חינם2O, 30 μl של 5 M אמוניום אצטט ו-180 μl של 100% אטוח לתוך העתק sgRNA. מערבבים היטב ומשלבים לפחות 20 דקות ב-80 ° צ' (עד קפוא) או ב-20 ° c בלילה. צנטריפוגה ב -4 ° c עבור 15 דקות במהירות מקסימלית.
  10. להסיר ולמחוק supernatant מבלי להפריע את הגלולה, ולשטוף עם 1 מ ל של RNase-חינם 70% אטוח מקורר ב-20 ° c. סובב 5 דקות נוספות במהירות המירבית ב -4 ° c.
  11. להסיר ולמחוק את supernatant מבלי להפריע את הגלולה, ואת האוויר יבש את הגלולה עבור 5 דקות.
  12. השהה מחדש 30 μL של nuclease-H חינם2O ולקבוע טוהר ותשואה באמצעות ספקטרוסקופיית UV (תשואה מינימלית של 200 Ng/μl).
  13. בדוק את הנוכחות של sgRNA על ג'ל חינם RNase. SgRNA מופיע בין 50 ו 150 bp כשתי להקות בשל המבנה המשני (איור 1B).
  14. מקטע לתוך 3 μL ולאחסן ב-80 ° c.

3. לאמת יעילות גזירה מחוץ לגופית

  1. לחלץ דנ א גנומית ממינים היעד באמצעות ערכת ה-DNA מסחרי החילוץ. ניתן להשתמש בגזירות סנפיר מבלי להקריב את הדג, משום שרקמות הנייר נוצרות מחדש.
  2. להגביר את אזור ה-DNA היעד באמצעות התחל שתוכנן כמתואר בשלבים 1.6 ו 1.7 באמצעות ה-PCR הסטנדרטי. אמת את המוצר על ידי ג'ל אלקטרופורזה. קביעת רצף הקטע כדי להבטיח את האזור הנכון הוא להיות מוגבר הוא הציע, אבל לא הכרחי. תוצאות הנציגים עבור התבנית scn4aa מוצגות באיור 2.
  3. נקה את מקטע ה-PCR באמצעות פרוטוקול מעבדה או חברה מבוססת.
  4. אחסן את ה-DNA המוגבר ב-20 ° c. שקול להפריד אותו לתוך הפחת כדי להפחית מחזורי הפשרת הקפאה.
  5. קבע את הכמויות ואמצעי האחסון הנדרשים של כל אחד מהרכיבים. שקול להפעיל פקדים שליליים (לא כולל sgRNA או Cas9) ופקד חיובי (sgRNA שנבדק קודם לכן מפעיל את ה-DNA המוגבר של היעד שלו) אם הוא זמין, כמו גם סדרת ריכוז של sgRNA.
  6. הגדר את תערובת התגובה להלן בסדר שצוין בצינור PCR בטמפרטורת החדר, הוספת sgRNA ו Cas9 חלבון האחרון עבור התוצאות הטובות ביותר: 50-100 ng המוצר ה-DNA PCR היעד, 1 μL של מאגר 10x 3, 1 μL של 10x BSA (0.1 g/mL) , 50-200 ng של חלבון Cas9 (1 מ"ג/mL, 150 ng הציע), ו 30-200 ng sgRNA (100 ng הציע).
    1. דגירה התגובה ב 37 ° צ' עבור 1 h ולאחר מכן ב 65 ° צ' עבור 10 דקות כדי השבית Cas9 חלבון.
    2. הפעל את המדגם כולו על 2% – 3% agarose ג'ל (גודל הלהקה צפוי בין 30-200 bp) יחד עם פקדים חיוביים ושליליים. מחשוף מוצלח עשוי להראות כמה מוצר ה-PCR, אך יהיו גם שתי להקות קטנות יותר. תוצאות הנציג מוצגות באיור 2.

4. קבלת עוברים

הערה: קבלת עוברים של דגים חשמליים חלש יכול להיות מאתגר. ניטור זהיר של איכות המים, זמן מספיק לטיפול דגים, האכלה רגילה הם המפתח לתוכנית רבייה מוצלחת. על הדגים להיות ממוזגים במשך מספר שבועות עבור שכפול52 כפי שמתואר בשלב הפרוטוקול 4.1. לאחר מכן, פרוטוקול הגדלת gametogenesis טבעי (4.2) לשימוש התנהגות טבעית הבזים (4.3), חלופה שפותחה לאחרונה בטכניקת מבחנה עבור קבלת עוברים בדיוק מתוזמן (4.4) מוצגים. פרוטוקול 4.3 הוא יעיל באותה מידה עבור b. ברכסינטיוס ו ב gauderio, ו הפרוטוקול 4.4 הוא עליון ב -gauderio.

  1. יזוג
    1. שמור על ב. ברכסינטיוס בזוגות/קבוצות קטנות (100-150 מיכלים) או בטנקים גדולים מאוד (2 זכרים ו-5-6 נקבות ב כ 475 L טנק), כפי שהם הופכים אגרסיבי מאוד בתנאי רבייה. צריך להיות לפחות 1-2 צינורות PVC לכל דג לשמש מקלט (איור 3 א,ב).
    2. ב. gauderio ניתן לגדל בצפיפות גבוהה הרבה יותר. שמור עד שמונה אנשים במיכל 100 L (2 זכרים ו -6 נקבות). צריך להיות לפחות 1 צינור PVC לכל דג לשמש מחסה. הוספת חוטים סבוכים מגבירה את העשרה והסתרת נקודות. להוסיף 50 mL צנטריפוגה צינורות עם 1 החורים קוטר ס"מ קדח אותם לראש הטנק כדי לאפשר למבוגרים להשריץ באופן טבעי לתוך הצינורות (איור 3C).
    3. במהלך עונת הרבייה, להאכיל דגים תולעים טריים מדי יום שיושלם עם תולעי דם קפואים. האוכל יכול להיות מועשר בויטמינים ותוספי מזון, במידת הצורך.
    4. בית דגים בדרך כלל מוליכות גבוהה יחסית (300 – 600 μS), מאוזנת פתרון pH. במהלך עונת הרבייה, להנמיך בהדרגה את המוליכות על ידי לפחות חצי במהלך של 1 – 3 שבועות כדי לגרום לוטה recrudescence והבשלה. מוליכות נמוכה יותר על ידי שנוספו יומיים של אוסמוזה הפוכה (RO) מים, שמירה על תשומת לב מקרוב ל-pH כאשר מוליכות נמוכה (pH < 6).
    5. ניתן לשמור על תנאי רבייה במשך כ -3 עד 5 חודשים עם ייצור ביצים המתחדד לאורך זמן. לאחר זמן זה, מחזירים דגים למוליכות גבוהה באיטיות מעל 1 – 3 שבועות. שמרו על עוד 3 חודשים במוליכות גבוהה לפני שייחשפו שוב לתנאי הרבייה.
  2. השתמש ההשאיפה סוכן (SGnRHa + Domperidone) זריקות.
    1. זיהוי דגים נקביים בתנאים הרבייה המופיעים gravid (איור 4). ב -gauderio לנקבה יהיו הביצים הנפוחות רק מקדל אל פתח האוורור. ב. ברכסינטיוס הנקבות יהיו נפוחות ומופיעות גוף עמוק (איור 4a). לזכרים בדרך כלל אין בעיה בהפקת זרע. עם זאת, זכרים גדולים יותר מעדיפים בשל נפח הזרע הגדול שנאסף.
      הערה: ההשריץ סוכן הוא תערובת הורמון מסחרי שמקל על ההבשלה של גמטות וקואורדינטות ההשריץ. אם הדג הוזרק עם סוכן ההשריץ בעבר, לאפשר > 4 שבועות של מנוחה והאכלה בשפע בין זריקות. אנו מציעים הזרקת לפחות 2 זכרים ו-4-5 נקבות כדי להבטיח כמה מצמדים של ביצים והרבה זרע.
    2. דג מורדם ב-MS-222 (0.4 g/3 L) במשך כמה דקות, עד הדג אינו מסוגל לשמור על היציבה שלה, הוא משותק, אבל ממשיך יש תנועה מבצעית (שלב II53).
    3. שוקלים את הדג (g) כדי לחשב את כמות סוכן ההשריץ, (0.5 μL/g) + 0.5 μL. חשבונות 0.5 μL נוספים לקבלת שגיאות מפיג.
    4. הוסף את הסוכן השאיפה כדי 4x כרכים של מאגר (1x PBS או DPBS) בצינור PCR ולערבב היטב. הפתרון יהיה מעונן. היא מסייעת לוותר על האדם ההשכן לחומר תרמופלסטי ולאחר מכן להשתמש בפיפטה כדי למדוד את המינון המחושב. סוכן ההשפיק הוא צמיגי, ולכן הקפד לוותר על כל המינון ולהיות זהיר עם ליטוף.
    5. פיפטה את פתרון ההזרקה על תרמופלסטיים ולצייר לתוך מזרק זכוכית דיוק, הימנעות בועות אוויר. אנו ממליצים על 28 G, 19-25 מ"מ באורך, מחט משופע.
    6. הכנס את הפתרון לשריר העורק הגבי בקצב החלקה. תן את המחט לשבת 2 – 4 s ולאחר מכן להסיר. מיד הכניסו דגים למים מערכת טריים להתאוששות.
    7. לאחר כ -24 שעות היכונו לאיסוף העוברים (ראו 4.3 או 4.4). אסוף את כל החומרים הנחוצים כולל מה שנדרש עבור מיקרוזרקת תא בודד (ראה סעיף 5).
  3. להשיג עוברים באמצעות שאיפה טבעית.
    1. בית ההשריץ סוכן-מבוגרים מוזרק (4.2) בטנקים גדולים 450 L. יחסי המין היעילים ביותר יש בדרך כלל 1 – 2 זכרים 3 – 4 נקבות עם מקומות מסתור נאותה עשוי PVC צינורות, ואת המצע השיש כהה על קרקעית הטנק כדי למנוע צריכת ביצים. גולות הן בדרך כלל חשובות יותר עבור b. ברכסינטיוס מ- b. gauderio, אשר מעדיפים להפקיד את הביציות הדביקות שלהם בנקרות או 50 mL מצינורות צנטריפוגה כמתואר לעיל.
    2. מניחים דגים במחזור האור הפוך כדי להתאים לילית הלילה לעבוד במעבדה רגילה שעות. באמצעות מערכת אבטחה מחוץ למדף הצרכן, הצג דגים באמצעות תאורה אינפרא אדום כדי למזער הפרעה ממחשב מחובר מרחוק (איור 3).
    3. הדג יהיה להשריץ באופן ספונטני במהלך photoperiod כהה כ 24 h לפרסם את הזרקה סוכן הבשלה.
    4. כאשר השאיפה מתחיל, לאסוף ביצים מדי שעה בעוד התנהגות השההשבב מ ב ב. ברכאסטיוס, לאסוף ביצים באמצעות סיפון בקוטר קטן על רשת כותנה משובחת למזער את הנזק הביצים הטרי הוליד. לאסוף ביצים ב. gauderio מ- 50 mL צנטריפוגה צינורות או מצע טנק. עבוד ביעילות עם הפרעה מינימלית להשבעת דגים באמצעות מנורת ראש עם אור אדום בעוצמה נמוכה. כמו המחשוף הראשון מתרחש כ 1 הפריה הפוסט (HPF), חלק גדול של ביצים יהיה מתאים מיקרוהזרקה תא בודד.
    5. המשך מייד אל ההזרקה (ראה סעיף 5).
  4. לסחוט גברים עבור הפריה חוץ גופית של ב. gauderio.
    1. הכינו את פתרון הרחבת הזרע (SES) כפי שמתואר בספר Zebrafish54: 10 מ"מ hepes, 80 Mm kcl, 45 mm הייקל, 45 נתרן מילימטר, 0.4 בגודל2מילימטר, ו 0.2 mm mgcl2.
      1. השתמש ddH2O כדי להביא נפח ולהתאים את ה-pH כדי 7.7 עם 1 M naoh.
      2. . חנות במקרר
      3. סנן דרך מסנן 0.22 יקרומטר לפני השימוש.
    2. דג מורדם ב-MS-222 (0.4 g/3 L) במשך כמה דקות, עד הדג אינו מסוגל לשמור על היציבה שלה, הוא משותק, אבל ממשיך יש תנועה מבצעית (שלב II53). מקום 500 μL הבליטים של SES לתוך הקרח.
    3. הידיים והדגים יבשים ביסודיות, במיוחד סביב הראש ואוורור. מקום בצד הגחוני למעלה, קדמי שמאלה (לאנשים ימניים) במחזיק פוליסטירן מוקצף/ספוג מכוסה MS-222 ספוג, מגבת נייר לח. הראש צריך להיות מקביל עם השולחן ככל האפשר.
      הערה: צעדים 4.4.4 – 4.4.6 צריך להיעשות מהר ככל האפשר, והדגים צריכים להיות רק מחוץ למים עבור 30-60 s.
    4. להפעיל לחץ על הכיוון caudal לrostral עם אור לסחוט מדיום מעל הגונדות לכיוון פתח האוורור. . הדג יכול לגרש בזבוז להיזהר לנקות את הפתח עם מחיקה עדין משימה אם כל בזבוז מסולק. לא לאסוף פסולת עם זרע. בהתאם לגודל של הזכר, 10-60 μL נפוץ.
    5. באמצעות מיקרופיטר עם טיפ, לאסוף בזהירות את הזרע כפי שהוא סחוט מן הזכר בהפרשים של 50 μL. מניחים זרע ישירות לתוך 500 μL הalits של SES על הקרח. זה יכול להיות מועיל שיש חוקר אחר לסייע באיסוף זרע בעוד השני לוחץ. יש להשתמש בזרע מוקדם ככל האפשר, אך נשאר בר קיימא לפחות 1 h.
    6. מיד לאחר איסוף, לשים דגים לתוך מים מערכת טרייה להחלמה. הדגים צריכים להיות מחוץ למים רק בשביל 30-60.
  5. לסחוט נקבות הפריה חוץ גופית של ב. gauderio.
    1. דג מורדם ב-MS-222 (0.4 g/3 L) במשך כמה דקות, עד הדג אינו מסוגל לשמור על היציבה שלה, הוא משותק, אבל ממשיך יש תנועה מבצעית (שלב II53). . מקום בתחנת העבודה
      הערה: סעיפים 4.5.1 – 4.5.5 צריך להיעשות מהר ככל האפשר, הדגים צריכים להיות רק מחוץ למים עבור 30-60 s.
    2. ידיים יבשות, כלים, גיליון פוליטמטאופן, ודגים ביסודיות, במיוחד סביב הראש והאוורור. מניחים בצד עם הראש מול הקדמי (לאנשים בעלי יד ימין).
    3. להפעיל לחץ על הכיוון caudal לrostral עם אור לסחוט מדיום מעל הגונדות לכיוון פתח האוורור. . הדג יכול לגרש בזבוז להיזהר לנקות את הפתח עם מחיקה עדין משימה אם כל בזבוז מסולק. בהתאם לגודל של הדג, 20 – 150 ביצים הוא נפוץ. באמצעות מרית/כלי מצופה polyארבאופן בזהירות לאסוף ביצים כפי שהם לוחצים מן cloaca. הזז במהירות ביצים לצלחת פטרי קטנה וכיסוי. ודא שהביצים נשארות יבשות במהלך תהליך זה. לחילופין, לאחר הסחיטה, גע במסת הביצה לבסיס של צלחת פטרי קטנה או לגיליון הפוליארביואופן כפי שהם מגורשים מן הנקבה.
    4. מיד לאחר איסוף, לשים את הדג לתוך מים מערכת טרייה להחלמה.
  6. לבצע הפריה ביצה עבור הפריה חוץ גופית של ב. gauderio.
    1. הוסף 100 μL של זרע מעורב היטב ב SES (ראה שלב 4.4) ישירות מעל מסת הביצה.
    2. הוסף 1 מ ל של מי המערכת (מסוננים באמצעות מסנן 0.22 יקרומטר) ומערבבים היטב עבור 30 – 60 s.
    3. הוסיפו מים ממערכת בתוספת של 1 – 2 מ ל (השאירו מקום בצלחת פטרי) והניחו בחממה. זמן שיא של IVF על צלחת פטרי ומעבר לאינקובטור 29 ° c. הגדר שעון עצר 50 דקות כדי לבדוק את התקדמות הפיתוח (למשל, היווצרות תא בודד בקוטב החי, ראה איור 6). במהלך הזמן הזה, להכין חומרים להזרקה.

5. תא בודד מיקרוהזרקה

  1. משוך מחטים הזרקת מיקרו לפני ההשמה זריקות הסוכן (שלב 4.2) או טבעי ההשריץ (שלב 4.3). השתמש בורוסיליקט זכוכית נימי עם נימה (מנת יתר 1.0 מ"מ, מזהה 0.58 מ"מ, 10 ס מ אורך) ו פולר מחט למשוך מחטים מיקרו הזרקה. הכינו 2 – 4 מחטים לכל הזרקת הטיפול המתוכנן.
    הערה: מחטי מחטים עם פילמנט הם העדיפו, כי הפילמנט פתילים את התמיסה לכיוון הקצה ומסלקת בועות. עם זאת, לא ניתן להשתמש במחטים ללא פילמנט ובחזית ההטענה אין השפעה על התוצאה. המחט צריכה להתחדד. ארוך, אך חסון השתמש המחט מושך תוכנית עם המפרטים הבאים כנקודת התחלה: חום = 500; משוך = 70; מהירות = 70; ו-Time = 100. מחט ייצוגית מורפולוגיות מוצגות באיור 5A.
  2. הכינו את פתרון ההזרקה והכינו מחט.
    1. הוסף 0.9 μL של sgRNA ו 0.9 μL של אנזים Cas9 (1 מ"ג/mL) כדי 0.2 μL של 10% או 100% פנול אדום (עבור 1% ו-10% בריכוז האחרון של הפנול האדום, בהתאמה) בצינור ה-PCR. ערבב היטב ולתת לשבת על קרח 2-5 דקות כדי לאפשר sgRNA ו Cas9 to מורכבים. חישוב הריכוז הסופי של sgRNA, Cas9, ו פנול אדום בפתרון ההזרקה.
      הערה: אם יש בעיות עם סתימת המחט או יעילות גזירה באמצעות המתכון לעיל, זה עשוי להיות שימושי להשתמש בריכוז 1x הסופי של מלח/מאגר לייצב Cas9 ולמנוע סתימת המחט.
    2. השתמש בטיפ מיקרוטוען לאחור כדי לטעון את 2 μL של הפתרון לתוך המחט מיקרוהזרקה. לגרש את הנוזל קרוב לקצה ככל האפשר.
    3. לטעון את המחט למיקרומניפולציה ולהגדיר הגדרות לחץ (להתחיל עם 775 pi, 0.1-0.2 s, ו 8-12 pc).
    4. תחת היקף, השתמש זוג מלקחיים עדינים כדי לשבור את קצה המחט בזווית משופע. לפרוץ לכיוון שבו להתחדד של המחט מתחיל יש קשיחות. מומלץ לעבור קרוב יותר לקצה, לבדוק את גודל פתרון ההזרקה ולאחר מכן לעבור במידת הצורך. נשא של המחט צריך להישאר קטן ככל האפשר תוך שמירה על להתחדד נוקשה (איור 5A).
    5. השתמש בשמן מינרלי ובמיקרומטר כדי למדוד את הגודל של פתרון ההזרקה. בדרך כלל משתמשים באחד-2 nL; קוטר 0.1 מ"מ 0.5 nL.
    6. כוונן את קצה המחט או את הגדרות הלחץ כדי לקבל נפח הזרקה בתוך מפרטים.
  3. לזהות לפתח זיטים ולהכין את שלב ההזרקה. . הגדר את שלב ההזרקה קח צלחת פטרי בקוטר 100 מ"מ. היפוך התחתון ומקום תחת למעלה הפוכה. מניחים שקופית מיקרוסקופ זכוכית בתוך החלק העליון הפוך. בהתאם לאופן הטעינה של המיקרומניפולציה לטווח, ייתכן שהגובה המוסף מהבסיס ההפוך יהיה לא נחוץ.
    1. הביטו בביצים המתפתחות והזדהו לזהות זיטים מופרות משוער 50 – 60 דקות לאחר הפריה חוץ גופית. מוט החיות יתחיל להיווצר ויהיה עודף של טיפות שומן קטנות סביב חלמון/בעלי חיים ממשק התא (איור 6).
    2. לאסוף 10 – 20 ביצים עם מעט מים ככל האפשר באמצעות פיפטה העברה פלסטיק (לחתוך את העצה מעט כדי לאפשר ביצים לעבור) ומקום על קצה השקופית. מים יהיו רשעים מתחת למגלשה ולמשוך ביצים נגד הקצה.
    3. השתמש בניגוב משימה עדינה ולחץ בעדינות על השקופית כדי להסיר את עודפי המים ולאפשר לביצים לדבוק בחוזקה בקצה השקופית. צריך להיות רק מספיק מים כדי לשמור על הביצים לח תוך שמירה על לחות עמידה קטנה כדי למנוע תנועת ביצה במהלך ההזרקה.
  4. הכנס ישירות לתא בודד.
    1. יישר את הביצים כנגד השקופית אנכית, אנכית אל המחט המתקרבת (איור 5B).
    2. באמצעות המיקרומניפולציה, הצב את המחט נגד הצ. בערך 45 מעלות זווית, להכניס את המחט לתוך chorion, ואז לתוך התא היחיד. זה יכול להיות מועיל להיכנס לתא בודד דרך החלמון. מעבר הן את שלב ההזרקה עם היד החופשית והמיקרומניפולציה עשויים לספק שליטה רבה יותר על תהליך ההזרקה (איור 5B).
    3. הכנס sgRNA/Cas9/פנול אדום הפתרון לתא בודד. הסר בזהירות את המחט. המשך לביצה הבאה וחזור על שלבים 5.4.1 – 5.4.3 עד כל הביצים מוזרק.
    4. להסיר את כל הביצים שבור במהלך ההזרקה עם מלקחיים עדינים. השתמש 0.22 יקרומטר של מערכת מסוננים מים בבקבוק השפריץ כדי להסיר בעדינות ביצים משלב ההזרקה לתוך צלחת חדשה 100 מ"מ בקוטר פטרי.
    5. חזור על שלבים 5.3.3 – 5.4.6 עד שכל הביצים הזריקו או פיתחו לשלב שני התאים. הקפידו להניח בצד כ -20 ביצים מופרות כבקרת ללא הזרקה כדי לקבוע את שיעורי הדישון ואת הצלחת ההזרקה. לגבי מצמדים גדולים יותר משתמשים בעוברים לא מוזרקים שפיתחו לשלב שני התאים, ולצמדים קטנים יותר הניחו בצד ביצים מופרות.
    6. בנוסף, לשקול שליטה sgRNA/הזרקה על ידי הזרקת 15-25 עוברים עם Cas9 משלימה עם sgRNA נגד גן שאינו נוכח הגנום. הגן GFP מומלץ עבור עוברי סוג פראי. הקלט את מספר הביצים, הורים, זמן IVF, ותאריך על כל צלחת פטרי. כלול יעד או תווית של sgRNA כבלתי מוזרק. מעבר לאינקובטור של 29 ° c.

6. גידול בעלי חיים

  1. . תשמרי על הביצים
    1. בדוק הכדאיות ביצה 4 – 6 h בעקבות זריקות.
    2. הקלט את מספר הביציות המתות, כמו גם את כל אלה שלא הופרות. הביציות הבלתי מופרות יעצרו סביב הבמה של שמונה התאים ותהיה תבנית של שושנת התאים במוט החיות (איור 6). בהתאם למספר ביצים מתות וכמות של פסולת ביצה במים, להסיר לפחות 50%-80% מהמים ולהחליף עם מים מערכת מסוננים. זה יכול להיות מועיל לקרצף את החלק התחתון של צלחת פטרי אם סרט פסולת סלולרית או צורות ביוilm.
    3. במשך 2 – 3 ימים, בדוק ביצים 1 – 2x מדי יום. חזור על שלבים 6.1.2 – 6.1.3 בכל פעם את הביצים נבדקים.
    4. אחרי 2-3 ימים הזחלים יבקע. להסיר את כל תרמילי ביצה כפי שהם לבקוע. ליטוף עדין יכול לעזור לשחרר זחלים בעלי חצי מקווקו.
  2. . לטפל בזחלים
    1. בדיקת ביצי 1-2x מדי יום. חזור על שלבים 6.1.2 – 6.1.3 בכל פעם שהזחלים נבדקים.
    2. מ 6 – 14 DPF, להאכיל את הזחלים צלופחים. עודף מזון קטן הוא טוב, כי צלופחים החומץ יישארו בחיים במנה. מוסיפים צלופחים של חומץ בכל פעם שהתבשיל נבדק ומנוקה.
    3. מ -11 – 14 DPF, להוסיף 5-10 מקווקו מבקע טרי לזחלים בנוסף צלופחים חומץ. במהלך הזמן הזה הזחלים ילמדו לאכול את השחייה בחינם ארטמיה.
    4. ב-15 DPF, הזיזו את הזחלים לכוסות ביצים (ראו סעיף 6.2.5) במיכל עם מים זורמים, סינון והשקה. לא צריך להיות יותר מאשר 25 עוברים לכל גביע. כוסות ביצים הן כוסות פלסטיק עם רשת רשת שינוי בתחתית. 100 מ"מ צלחת פטרי העליון/התחתון ניתן להוסיף לתחתית של גביע הביצה כדי לעזור להפסיק את המזון מליפול דרך הרשת. כוסות ביצים מאפשרות לדגים להיות שוכנו בנפח גדול יותר של מים מסיבות באיכות המים, תוך שמירה על קבוצות נפרדות. המשיכו להוסיף צלופחים של חומץ ו-15-30 לזחלים המבקע הטרי בימים 15 – 18. ניקוי כלי פטרי מדי יום ולהשתמש בפיפטה כדי להסיר המוני ארטמיהמתים.
    5. החל מימים 18 – 30, האכילו את המבקע הטרי רק ארטמיה. להגדיל את כמות האכלה כמו הדג לגדול, אם לנשוך זנב נראה.
    6. לאחר כ 30 ימים, להעביר דגים כדי 10 L (2.5 ליטר) טנקים, כ 25 אנשים לכל טנק. ודא שיש סינון, האנטנה, ומקומות להתחבא. שקלו את המדיה הגלימטור וצינורות PVC בקוטר קטן.
    7. האכילו את התולעים הטריות בתוך כ -30-45 יום. שמירה על ניקוי תקני ושינויי מים למיכל (כלומר, במינימום של 10% – 20% שינוי מים לשבוע אחד).
    8. לאחר ~ 45 DPF, להאכיל רק תולעים שחורות עד ~ 60 DPF.
    9. לאחר ~ 60 DPF, להעביר קבוצות של כ 15 דגים כדי 40 L (10 ליטר) טנקים ולהתחיל נוהלי הגידול למבוגרים. הוספת צינורות PVC וחוט "מגב" (מסה של חוט חום הקשור יחד עם פקק) למקומות מסתור (איור 3 ג). על הדגים להיות מתקרבים לגודל הרבייה (10 עד 12 ס מ) לאחר כ -3-4 חודשי הפריה.

7. גידול בוגרים

  1. להאכיל דגים מדי יום עם תולעים שחורות מספיק כך כמות קטנה של תולעים שחורות נוכחים בהזנה הבאה. האכלה זו מאפשרת צמיחה מקסימלית.
  2. מספר פעמים בשבוע, זה יכול להיות מועיל כדי להשלים את האכלה התולעים השחורות עם תולעי דם.
  3. טנקים נקיים כל 2 – 4 שבועות עם 20% – 30% שינוי מים. אם מנקה החוטים מתמלא באצות, שפשף אותו נקי תחת מים.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

אתרי היעד sgrna זוהו בתוך אקסון 1 של scn4aa בשני ב. gauderio ו -b. ברכסינטיוס כפי שמתואר בסעיף 1. SgRNAs נוצרו כמתואר בסעיף 2. בעקבות בחירה מוצלחת sgRNA וסינתזה (איור 1), במחשוף מבחנה נבדק (איור 2). SgRNAs הפגינו חיתוך מחוץ לכאן נבחרו לאחר מכן עבור מיקרוזריקות תא בודד.

דגים מבוגרים היו ממוזגים עבור רבייה (סעיף 4.1), ולאחר מכן הוזרק עם סוכן השאיפה (סעיף 4.2) ולאחר מכן לחצה (ב. gauderio) עבור IVF כמתואר בסעיף 4.4 או מותר להשריץ באופן טבעי (ב. ברכסיטיוס) כמו מתואר בסעיף 4.3. מאמצים אלה הניבו עוברי תאים בודדים להזרקת מיקרו בשני המינים. כפי שמתואר בסעיף 5, 1.5-2.0 nL של scn4aa Sgrna/Cas9/פנול המורכב האדום (65-190 Ng/Ul sgrna, 450 Ng/ul Cas9, 1%-10% פנול אדום, ריכוזי הסופי) הוזרק בשלב תא אחד. ביצים מאותו מצמד שימשו כפקדים שלא הזריקו. כל העוברים היו מטופלים כמתואר בסעיף 6. בעקבות הפריה חוץ גופית, 40%-90% מהביצים הופרות, ו-70%-90% מהעוברים שרדו לבקיעה בעקבות ההזרקה.

כ 75% מהדגים שרדו ל 6-עד 11 DPF ולאחר מכן פנוו. דגי הזחל הושמו בצלחת פטרי 35 מ"מ המוטבעת במנה גדולה יותר עם Sylgard מקיבוע אלקטרודות הקלטה (איור 7A). תנועת העובר הוגבלה באמצעות 3% העלה בתבניות שנעשו עם מים המערכת וחתכו כדי להתאים את העובר (איור 7B). אותו חדר הקלטה שימש עבור שני המינים והעובש אותו צמח שימש בין השוואות המינים. עוברים נרשמו עבור 60 s, אשר מספיק כדי ללכוד מאות EODs. שולטת בהתאמה לא מוזרקים של גיל וגודל. בשלב זה, 10% – 30% של עוברים ששרדו להראות משרעת מופחתת EOD. עוברים המציגים ירידה משרעת EOD עם פגמים מורפולוגיים ברורים ושליטה בלתי מוזרק העוברים שלמים התעכלו עבור חילוץ DNA ו-PCR הבאים של אתר היעד scn4aa . לעתים קרובות היה מגוון של חדירה של הפנוטיפים, עם אנשים מסוימים יש ירידה חזקה יותר בשרעת EOD מאשר אחרים.

לאחר ה-PCR לנקות ושיבוט, 30 + שיבוטים מכל עובר נבחרו לקביעת רצף של סנגר. CRISPR/Cas9 המושרה מוטציות זוהו ב -gauderio (איור 8 א,ב) ו -b. ברכיכינטיוס (איור 9a,b) אנשים עם הפחתת משרעת חזקה eod (איור 8a ואיור 9a , בהתאמה), היכן שפקדים שלא הוזרקו התייחס רק ל-גנוסוגים. ויזואליזציה של משרעת EOD בין מוטציות מאושרות ("CRISPR") והגיל/גודל בולט לא הוזרק שולטת הראו כי הן scn4aa מוטציה b. brachyistius (איור 10a) ו B. gauderio (איור 10a ) העוברים באופן משמעותי נמוך יותר EOD משרעת מאשר פקדים (p < 2.2 x 10-16, וולש שני לדגום t-test). כCas9 המטרה של scn4aa הייתה מוצלחת בשני הצדדים ב. ברכסינטיוס ו ב גאודראיו ובסבך scn4aa בזחל/הפרשות מוקדמות בשני המינים.

Figure 1
איור 1: הסינתזה של תבנית sgRNA ותמלול. (A) ג'ל תמונה של סינתזה של התבנית sgRNA. תוויות תואמות sgrnas שונים עבור אלוהים (MYO2, MYO1) ושלושה sgrnas עבור scn4aa (S1-S3). לאחר ריפוי oligomers, תבנית ~ 120 bp מופק. (ב) ג'ל לדימוי של שעתוק sgRNA עבור שלושה Sgrna עבור b. gauderio (bg2017) ושניים עבור b. ברכסינטיוס (bb2016, 2017). SgRNA יופיע כשתי להקות בשל מבנה משני ויהיה בין 50-150 bp בעת שימוש בסולם dsDNA. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 2
איור 2: התמונה המייצגת ג'ל של מוצלח (sg1) ולא הצליח (sg2) בשנת מבחנה CRISPR assays. כמות מקבילה של תבנית ללא רכיבי CRISPR מוצגת בנתיב scn4aa. שים לב לרצועות הכפולות ב-sg1 המתציגות שהחיתוך התרחש. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 3
איור 3: הגדרות מיכל הרבייה עבור דגים חשמליים חלש. (א) סכמטי של הכיוונון האופייני לניטור וידאו אלחוטי של התנהגות ההשמה. שלוש מצלמות מסחריות הזמינות מסחרית (סוואן, Inc.) מסוגל לייצר אור אינפרא אדום מכוונים לחלק העליון של המים מחובר מקליט וידאו דיגיטלי (DVR). הווידיאו מפוקח בזמן אמת את ההתנהגות בחדר סמוך ממחשב המחובר לרשת (PC). (ב) הבעת התנהגות שנלכדה בכיוונון כזה ב -B. ברכסינטיוס. (ג) מלכודת רבייה טיפוסית עבור B. gauderio עם שפופרות הסתרת PVC וחוטי חוט. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 4
איור 4: זכרים ונקבות רבייה. (א) ב. ברככינטיוס ו-(ב) ב. גאודרוו. שני המינים הם מבחינה מינית ומובחנים בקלות ויזואלית כאשר הם בוגרים מינית. שתי הנקבות הינן מבושלות בתמונות האלה, ומציגה בבטן נפוחה כאופיינית, המלאה בביצים בשלות. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 5
איור 5: מיקרוהזרקה. (א) המחט זכוכית טיפיםמחטיםחייב להיות שבור כדי לספק נפח מתאים מיקרוהזרקה. . הקצה בצד שמאל לא נשבר הטיפים באמצע וימין מנותקים עם שיקוע זוויתי מעט כדי לנקב את chorion הביצה. (ב) ביצים מרופדת נגד שקופית זכוכית (1% – 10% פנול אדום נכלל כנותב כדי להמחיש את מסירת ההזרקה) והוזרק עם מחטים נימי זכוכית. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 6
איור 6: שלבים התפתחותיים. (א) b. gauderio ו (ב) ב. ברככינטיוס. מניחים את כל הביצים מופרות וההתפתחות מנוטרת ל -24 HPF. בין 12 לבין 24 העוברים HPF גלויים ביצים קיימא, אחרת ביצים התערוכה השפלה. מספר חטיבות מופיעות על הפעלת ביצים, ללא קשר להפריה. ביצים לא מופרות מציגים דפוסי מחשוף יוצאי דופן הרבה יותר סימטריים בביצים מופרות. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 7
איור 7: צילום של חדר זחל הקלטה בשימוש במחקר זה. (א) האלקטרודות מוטבעים בתוך sylguard אבל להאריך לתוך המנה 35 מ"מ המכיל העובר מוגבל באמצעות עובש 3% העלה. (ב) תמונת ההגדלה הגבוהה יותר מארת את התנועה המוגבלת של העובר עקב הנפת הצמח. שימו לב לפיסות האגנה שניתן להסירו כגודל שינוי העובר. ב. gauderio העובר הוא מול האלקטרודה החיובית. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 8
איור 8: CRISPR/Cas9 מוטציות המושרה ב -gauderio(A) 32 שיבוטרצפים מ-DNA גנומית של מוטציות Cas9-המושרה ב יחיד scn4aa ממוקד F0B. gauderio העובר (11 dpf). רצף הייחוס מסומן בקו תחתון עם אתר היעד sgRNA המסומן באפור, המוטיב מוטיב הסמוך (פאם) רצף מודגש באדום, ואת Cas9 cut האתר מסומן עם "|". השינוי מתוך רצף מסוג פראי צפוי מוענק ואת מספר שיבוטים עבור כל רצף נתון בסוגריים. (קיצורים: + = הוספה,-= מחיקה, ± = indel) כל וני רצף משויך שאינו CRISPR מודגשים. איור עוצב לאחר Jao et al.60. (ב) חומצת אמינו רצף החזוי משיבוטיםברצף של scn4aa , ב. gauderio מ (א). שינויים המושרה Cas9 מתוך רצף סוג פראי מודגשים באדום ואת מספר השינוי המושרה נוקלאוטיד ניתנת. (ג) עשרים ושתיים הקלטות חשמל מחמישה הזחלים בהתאמה, כולם נרשמו 6 dpf באותו תא הקלטה. הגדרות הרווח זהות עבור כל העקבות. עקבות באדום הם מ B. gauderio הזחלים עם מוטציות מאושרות (אדם אחד המוצג באיור 8a, B לעיל), עקבות בשחור הם מן הזחלים בלתי מוזרק B. gauderio . הכולל, CRISPR/Cas9 עריכה של scn4aa הראה ירידה בשרעת eod, למרות ההשפעה היתה הטרוגנית. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 9
איור 9: CRISPR/Cas9 המושרה מוטציות ב ב ברכסינטיוס(A) 42 שיבוטרצפים מ-DNA גנומית של מוטציות Cas9-המושרה ב יחיד scn4aa ממוקד F0B. brachyistius עובר (11 dpf). רצף הייחוס מסומן בקו תחתון עם אתר היעד sgRNA המסומן באפור, המוטיב מוטיב הסמוך (פאם) רצף מודגש באדום, ואת Cas9 cut האתר מסומן עם "|". השינוי מתוך רצף מסוג פראי צפוי מוענק ואת מספר שיבוטים עבור כל רצף נתון בסוגריים. (קיצורים: + = הוספה,-= מחיקה, ± = indel) כל וני רצף משויך שאינו CRISPR מודגשים. איור עוצב לאחר Jao et al.60. (ב) חומצת אמינו רצףהחזוי מ שיבוטיםרצף מ scn4aa , ב. ברכסינטיוס ב (א). שינויים המושרה Cas9 מתוך רצף סוג פראי מודגשים באדום ואת מספר השינוי המושרה נוקלאוטיד ניתנת. (ג) עשר הקלטות חשמליות שניות מארבעת הזחלים התואמים, כולם נרשמו 10 dpf באותו תא הקלטה. הגדרות הרווח זהות עבור כל העקבות. עקבות באדום הם מ B. ברכסינטיוס הזחלים עם מוטציות מאושרות (אדם אחד המוצג ב, b לעיל), עקבות שחור הם מתוך הזחלים המוזרקים b. ברכסינטיוס . הכולל, CRISPR/Cas9 עריכה של scn4aa הראה ירידה בשרעת eod, למרות ההשפעה היתה הטרוגנית. EODs הפוכה הם מכיוון הדג שינוי אוריינטציה במהלך ההקלטה. אין הבדל בין דגים ניסיוניים לבין שולטת למרות זאת. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 10
איור 10: חלקות קופסה של משרעת EOD ממוצעת של CRISPR ו מוזרקנו בגודל/גיל בהתאמה אחים. (א) משרעת של ב. ברכסיטיוס הזחלים ב-10 dpf. הוקלט עם רווח של 100, CRISPR n = 56 EODs משני אנשים, uninjected וזרק n = 114 EODs משלושה אנשים. (ב) משרעת הזחלים של B. gauderio ב 6 dpf. הוקלט עם רווח של 500, CRISPR n = 34 EODs משני אנשים, uninjected וזרק n = 148 EODs משלושה אנשים. משרעת של דג CRISPR היה באופן משמעותי פחות מאשר בקרות uninjected (p < 2.2 x 10-16, וולש 2-לדגום t-test). כל האנשים נרשמו עם חדר ההקלטה המתואר באיור 7. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

תיאור/ רצף
אולייומר קבוע 5 '-AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGC טאטטCCTAAAC-3 '
המטרה של היעד אוליגומר (GG-N18, אין פאם) 5 '-מN18-הגנה מפני הליכה-שלוש '
שידרה של המטרה (N20, בלי פאם) 5 '-מN20-הגנה מפני הליכה-3 '
ברימיקו ברככינטיוס
scn4aa Bb sgRNA היעד (N18, עם פאם): 5 '-הגנה מפני 3 '
Scn4aa Bb sgrna אוליגומר (GG-N18): 5 '-לחלופין, להיות מאוד מאוד מ, מאוד מאוד מאוד מאוד מאוד מהנה.
scn4aa Bb PCR (218 bp)
Scn4aa_bb_exon1_F: 5 '-הגנה מפני 3 '
Scn4aa_bb_exon1_R: 5 '-הגנה מפני משחק 3 '
ברככיופאומיה גאודרוו
Scn4aa Bg sgRNA היעד (N17, עם פאם): 5 '-הקאגגונגג -3 '
Scn4aa Bg sgrna אוליגומר (GG-N17): 5 '-בטאטאטבאג ' מגאגאכגאגטקג ' 3 '-שלוש '
Scn4aa Bg (204 bp)
scn4aa_bg_exon1_F: 5 '-CGCCTTGTCCCTCCTTCAG -3 '
scn4aa_bg_exon1_R: 5 '-מדריך שלוש '

שולחן 1: מחלת האוגורונול. הכרחית לפרוטוקול

Subscription Required. Please recommend JoVE to your librarian.

Discussion

העושר פנוטילי של דג חשמלי חלש, יחד עם התפשטות האחרונות של משאבי גנומיקה, מניע צורך חזק עבור כלים גנוטים פונקציונלי במודל של דגים חשמליים חלש. מערכת זו היא אטרקטיבית במיוחד בשל האבולוציה מתכנסת של תכונות פנויואיות רבות בתוך ליננים מקבילים של דגים, אשר נשמרים בקלות במעבדה.

הפרוטוקול המתואר כאן ממחיש את היעילות של טכניקת CRISPR/Cas9 בזמן שורה של דג חשמלי חלש שפיתח אלקטרוגנזה והתפשלות חשמלית במקביל, ולכן מייצג צעד משמעותי עבור ההבטחה של המודל הזה עבודה עתידית בגנומיקה השוואתית של אבולוציה פנוטימית.

גישה מתודולוגיים פשוטה זו דורשת רק כישורים והדרכות ביולוגיים מולקולריים בסיסיים, בעקבות אימוץ בסיסי של פרוטוקול Gagnon38, המשמש באופן נרחב לדגי הזברה. ראוי לציין כי כמו טכנולוגיה מתקדמת, יש ערכות מסחריות יותר עבור הפקה sgRNA, כמו גם חברות שיכולות לסנתז RNAs מדריך, מה שהופך את הפרוטוקול הזה נגיש יותר למעבדות כי חוסר ניסיון בביולוגיה מולקולרית וציוד. אנו מודעים תחילה כי יעילות מוטגנזה גבוהה מאפשרת פנוטיפים ישירים של הזחלים מוזרק. עם זאת, נראה שיש מידה ניכרת של פנוטיציזם מפסיפס, שאינו נדיר ומתאים לספרות41,42,43,44. לדוגמה, במחקר scn4aa זה, אנשים מסוימים נושאים מוטציות הציגו הרבה יותר המשרעת הגדול יותר eods מאשר אחרים היו שקטים יחסית (איור 7, איור 8). כרגע לא ברור כמה מוטציות אלה מתבצעות אל germline. מאמצים עתידיים מיידיים יהיו מכוונים ליצירת קווי מוטציה יציבים.

ניצול מסלול nhej עבור הסתרה הוא רק אחד היישומים הפוטנציאליים מספר של crispr/Cas9 gene עריכה: השיטות המתוארות כאן הם קרש קפיצה עבור יישומים מתקדמים יותר55,56. מאמצים עתידיים צריך להיות מכוון בעיצוב שיתוף מוזרק DNA התורמים תבניות עם מתחם sgRNA/Cas9. שינוי פשוט זה היה למנף מנגנוני תיקון מבוססי תבנית אנדודוגני (כלומר, הומולוגיה תיקון מכוון, או HDR) ולאפשר מדויק להקיש-ins. למרות HDR מתרחשת ביעילות נמוכה יותר מאשר nhej גישות, ההתקדמות נעשתה כדי להגדיל את יעילותה57,58. זה היעילות הנמוכה ידרוש מאמצים כדי לייעל את העיצוב של התבנית של התורם DNA/CRISPR/Cas9 לבנות, להפוך את מנגנוני תיקון אנדוגניים יעיל יותר, ולהגדיל את ייצור העובר (ראה להלן). אם בעיה זו של יעילות ניתן לפתור, knockins יכול להיות מנוצל כדי להוסיף תגי פלורסנט, לבטא צורה מוטציה של המוצר הגן, או לשנות את המקדם או רצפי שיפור.

בעוד הביולוגיה המולקולרית מאחורי טכניקה זו היא פשוטה למדי, דרישות הטיפול הן משמעותיות, אך לא בלתי-הרבה. ב. gauderio הם רבים זמינים ומתרבים במהירות מספיק עבור כל תוכנית מחקר יש מושבה בתוך פחות משנה. לעומת זאת, ב. ברכסיטיוס להתפתח לאט, ומוזרויות אנטומיים הוכיחו ניסיונות הפריה חוץ גופית עד כה לא הצליחו. אחרים, מינים גדולים יותר, כגון Campylomormyrus59 יכול להיות יותר תורם לגישה זו. עבור B. ברכסינטיוס, כל העוברים הזריקו נאספו ניצול הגישה הטבעית ההשאיפה, אשר באופן משמעותי יותר עבודה אינטנסיבית. מאמצים עתידיים כדי להגביר את היעילות ב -B. ברכסינטיוס IVF יאפשר תשואה גבוהה יותר של עוברים לבעיות יעילות שתוארו לעיל.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

. למחברים אין מה לגלות

Acknowledgments

המחברים מכירים את המאמצים ההרואיים של מוניקה לוקאס, קת'רין שאו, ריאן טיילור, ג'ארד תומפסון, ניקול רוביצ'ד, ותקווה הילי לעזרה עם גידול דגים, איסוף נתונים, ופיתוח פרוטוקולים מוקדם. כמו כן, אנו רוצים להודות לשלושת הבודקים על הצעותיהם לכתב היד. אנו מאמינים שהמוצר הסופי יהיה באיכות טובה יותר לאחר התייחסות לערותיהם. עבודה זו ממומנת על ידי תמיכה של הקרן הלאומית למדע #1644965 ו#1455405 ל-JRG, ואת מדעי הטבע ומועצת המחקר ההנדסה DG מעניקים VLS.

Materials

Name Company Catalog Number Comments
20 mg/mL RNA grade Glycogen Thermo Scientific R0551
50 bp DNA ladder NEB N3236L
Borosilicate glass capillary with filament Sutter Instrument BF100-58-10 (O.D. 1.0 mm, I.D. 0.58 mm, 10 cm length)
Cas9 protein with NLS; 1 mg/mL PNA Biology CP01
Dneasy Blood & Tissue Kit Qiagen 69506
Eppendorf FemptoJet 4i Microinjector Fisher Scientific E5252000021
Eppendorf Microloader Pipette Tips Fisher Scientific 10289651
Hamilton syringe Fisher Scientific 14-824-654 referred to as "precision glass syringe" in the protocol
Kimwipe Fisher Scientific 06-666 referred to as "delicate task wipe" in the protocol
MEGAscript T7 Transcription Kit Invitrogen AM1334
NEBuffer 3 NEB B7003S used for in vitro cleavage assay
OneTaq DNA kit NEB M0480L
Ovaprim Syndel USA https://www.syndel.com/ovaprim-ovammmlu010.html referred to as "spawning agent" in the protocol
Parafilm Fisher Scientific S37440 referred to as "thermoplastic" in the protocol
Pipette puller WPI SU-P97 sutter brand
QIAquick PCR Purification Kit Qiagen 28106
Reusable needle- requires customization Fisher Scientific 7803-02 Customize to 0.7 inches long; point style 4 and angle 25
T4 DNA polymerase NEB M0203L Use with the 10x NEB buffer that is included
Teflon coated tools bonefolder.com T-SPATULA4PIECE referred to as "polytetrafluoroethene" in the protocol

DOWNLOAD MATERIALS LIST

References

  1. Gallant, J. R., et al. Genomic basis for the convergent evolution of electric organs. Science. 344, (6191), 1522-1525 (2014).
  2. Zakon, H. H., Lu, Y., Zwickl, D. J., Hillis, D. M. Sodium channel genes and the evolution of diversity in communication signals of electric fishes: convergent molecular evolution. Proceedings of the National Academy of Sciences of the United States of America. 103, (10), 3675-3680 (2006).
  3. Arnegard, M. E., Zwickl, D. J., Lu, Y., Zakon, H. H. Old gene duplication facilitates origin and diversification of an innovative communication system--twice. Proceedings of the National Academy of Sciences of the United States of America. 107, 22172-22177 (2010).
  4. Lissmann, H. W. Continuous electrical signals from the tail of a fish. Gymnarchus niloticus Cuv. Nature. 167, (4240), 201-202 (1951).
  5. Cuellar, H., Kim, J. A., Unguez, G. A. Evidence of post-transcriptional regulation in the maintenance of a partial muscle phenotype by electrogenic cells of S. macrurus. FASEB Journal. 20, (14), 2540 (2006).
  6. Modrell, M. S., Baker, C. V. Evolution of electrosensory ampullary organs: conservation of Eya4 expression during lateral line development in jawed vertebrates. Evolution & Development. 14, (3), 277-285 (2012).
  7. Hopkins, C. D. Design features for electric communication. Journal of Experimental Biology. 202, Pt 10 1217-1228 (1999).
  8. Kawasaki, M. Sensory hyperacuity in the jamming avoidance response of weakly electric fish. Current Opinion in Neurobiology. 7, (4), 473-479 (1997).
  9. Bell, C. C., Han, V. Z., Sugawara, Y., Grant, K. Synaptic plasticity in a cerebellum-like structure depends on temporal order. Nature. 387, (6630), 278-281 (1997).
  10. Heiligenberg, W. Neural Nets in Electric Fish. (1991).
  11. Ban, Y., Smith, B. E., Markham, M. R. A highly polarized excitable cell separates sodium channels from sodium-activated potassium channels by more than a millimeter. Journal of Neurophysiology. 114, (1), 520-530 (2015).
  12. Markham, M. R., Kaczmarek, L. K., Zakon, H. H. A sodium-activated potassium channel supports high-frequency firing and reduces energetic costs during rapid modulations of action potential amplitude. Journal of Neurophysiology. 109, (7), 1713-1723 (2013).
  13. Gavassa, S., Stoddard, P. K. Food restriction promotes signaling effort in response to social challenge in a short-lived electric fish. Hormones and Behavior. 62, (4), 381-388 (2012).
  14. Sinnett, P. M., Markham, M. R. Food deprivation reduces and leptin increases the amplitude of an active sensory and communication signal in a weakly electric fish. Hormones and Behavior. 71, 31-40 (2015).
  15. Salazar, V. L., Stoddard, P. K. Sex differences in energetic costs explain sexual dimorphism in the circadian rhythm modulation of the electrocommunication signal of the gymnotiform fish Brachyhypopomus pinnicaudatus. Journal of Experimental Biology. 211, Pt 6 1012-1020 (2008).
  16. Lewis, J. E., Gilmour, K. M., Moorhead, M. J., Perry, S. F., Markham, M. R. Action potential energetics at the organismal level reveal a trade-off in efficiency at high firing rates. Journal of Neuroscience. 34, (1), 197-201 (2014).
  17. Salazar, V. L., Krahe, R., Lewis, J. E. The energetics of electric organ discharge generation in gymnotiform weakly electric fish. Journal of Experimental Biology. 216, (13), 2459-2468 (2013).
  18. Hopkins, C. D., Bass, A. Temporal coding of species recognition signals in an electric fish. Science. 212, (4490), 85-87 (1981).
  19. Arnegard, M. E., Jackson, B. S., Hopkins, C. D. Time-domain signal divergence and discrimination without receptor modification in sympatric morphs of electric fishes. The Journal of Experimental Biology. 209, Pt 11 2182-2198 (2006).
  20. Sullivan, J. P., Lavoue, S., Arnegard, M. E., Hopkins, C. D. AFLPs resolve phylogeny and reveal mitochondrial introgression within a species flock of African electric fish (Mormyroidea: Teleostei). Evolution. 58, (4), 825-841 (2004).
  21. Crampton, W. G. R. Effects of anoxia on the distribution, respiratory strategies and electric signal diversity of gymnotiform fishes. Journal of Fish Biology. 53, 307-330 (1998).
  22. Pinch, M., Guth, R., Samanta, M. P., Chaidez, A., Unguez, G. A. The myogenic electric organ of Sternopygus macrurus: a non-contractile tissue with a skeletal muscle transcriptome. PeerJ. 4, 1828 (2016).
  23. Lamanna, F., Kirschbaum, F., Waurick, I., Dieterich, C., Tiedemann, R. Cross-tissue and cross-species analysis of gene expression in skeletal muscle and electric organ of African weakly-electric fish (Teleostei; Mormyridae). BMC Genomics. 16, 668 (2015).
  24. Traeger, L. L., et al. Unique patterns of transcript and miRNA expression in the South American strong voltage electric eel (Electrophorus electricus). BMC Genomics. 16, 243 (2015).
  25. Salisbury, J. P., et al. The central nervous system transcriptome of the weakly electric brown ghost knifefish (Apteronotus leptorhynchus): de novo assembly, annotation, and proteomics validation. BMC Genomics. 16, 166 (2015).
  26. Lamanna, F., Kirschbaum, F., Tiedemann, R. De novo assembly and characterization of the skeletal muscle and electric organ transcriptomes of the African weakly electric fish Campylomormyrus compressirostris (Mormyridae, Teleostei). Molecular Ecology Resources. 14, (6), 1222-1230 (2014).
  27. Mate, S. E., Brown, K. J., Hoffman, E. P. Integrated genomics and proteomics of the Torpedo californica electric organ: concordance with the mammalian neuromuscular junction. Skeletal Muscle. 1, (1), 20 (2011).
  28. Swapna, I., et al. Electrostatic Tuning of a Potassium Channel in Electric Fish. bioRxiv. (2017).
  29. Futuyma, Evolution. Third Edition. Sinauer Associates Inc. (2013).
  30. Thompson, A., Vo, D., Comfort, C., Zakon, H. H. Expression Evolution Facilitated the Convergent Neofunctionalization of a Sodium Channel Gene. Molecular Biology and Evolution. 31, (8), 1941-1955 (2014).
  31. Pitchers, W. R., Constantinou, S. J., Losilla, M., Gallant, J. R. Electric fish genomics: Progress, prospects, and new tools for neuroethology. Journal of Physiology Paris. (2016).
  32. Liang, X., et al. Rapid and highly efficient mammalian cell engineering via Cas9 protein transfection. Journal of Biotechnology. 208, 44-53 (2015).
  33. Jung, C. J., et al. Efficient gene targeting in mouse zygotes mediated by CRISPR/Cas9-protein. Transgenic Research. 26, (2), 263-277 (2017).
  34. Liu, K., Petree, C., Requena, T., Varshney, P., Varshney, G. K. Expanding the CRISPR Toolbox in Zebrafish for Studying Development and Disease. Frontiers in Cell and Developmental Biology. 7, (13), (2019).
  35. Zu, Y., et al. Biallelic editing of a lamprey genome using the CRISPR/Cas9 system. Scientific Reports. 6, 23496 (2016).
  36. Crispo, M., et al. Efficient Generation of Myostatin Knock-Out Sheep Using CRISPR/Cas9 Technology and Microinjection into Zygotes. PLoS One. 10, (8), 0136690 (2015).
  37. Sun, D., Guo, Z., Liu, Y., Zhang, Y. Progress and Prospects of CRISPR/Cas Systems in Insects and Other Arthropods. Frontiers in Physiology. 8, 608 (2017).
  38. Gagnon, J. A., et al. Efficient mutagenesis by Cas9 protein-mediated oligonucleotide insertion and large-scale assessment of single-guide RNAs. PLoS One. 9, (5), 98186 (2014).
  39. Kok, F. O., et al. Reverse genetic screening reveals poor correlation between morpholino-induced and mutant phenotypes in zebrafish. Developmental Cell. 32, (1), 97-108 (2015).
  40. Morcos, P. A., Vincent, A. C., Moulton, J. D. Gene Editing Versus Morphants. Zebrafish. 12, (5), 319 (2015).
  41. Mehravar, M., Shirazi, A., Nazari, M., Banan, M. Mosaicism in CRISPR/Cas9-mediated genome editing. Developmental Biology. 445, (2), 156-162 (2019).
  42. Yen, S. T., et al. Somatic mosaicism and allele complexity induced by CRISPR/Cas9 RNA injections in mouse zygotes. Developmental Biology. 393, (1), 3-9 (2014).
  43. Singh, P., Schimenti, J. C., Bolcun-Filas, E. A Mouse Geneticist's Practical Guide to CRISPR Applications. Genetics. 199, (1), 1-15 (2015).
  44. Mianné, J., et al. Analyzing the outcome of CRISPR-aided genome editing in embryos: screening, genotyping and quality control. Methods. 121-122, 68-76 (2017).
  45. van der Emde, G. Encyclopedia of Animal Behavior. Breed, M. D., Moore, J. 1, Academic Press. 16-23 (2010).
  46. Carlson, B. A. Encyclopedia of Neuroscience. Binder, M. D., Hirokawa, N., Windhorst, U., Hirsch, M. C. Springer. 4039-4044 (2009).
  47. Hopkins, C. D. Neruoethology of Electric Communication. Annual Reviews of Neuroscience. 11, 497-535 (1988).
  48. Arnegard, M., Zwickl, D., Lu, Y., Zakon, H. H. Old gene duplication facilitates origin and diversification of an innovative communication system- twice. Proceedings of the National Academy of Sciences of the United States of America. 107, (51), 22172-22177 (2010).
  49. Doench, J. G., et al. Rational design of highly active sgRNAs for CRISPR-Cas9-mediated gene inactivation. Nature Biotechnology. 32, (12), 1262-1267 (2014).
  50. Concordet, J. P., Haeussler, M. CRISPOR: intuitive guide selection for CRISPR/Cas9 genome editing experiments and screens. Nucleic Acids Resarch. 46, 242-245 (2018).
  51. Haeussler, M., et al. Evaluation of off-target and on-target scoring algorithms and integration into the guide RNA selection tool CRISPOR. Genome Biology. 17, (1), 148 (2016).
  52. Kirschbaum, F. Environmental factors control the periodical reproduction of tropical electric fish. Experientia. 31, (10), 1159-1160 (1975).
  53. Iwama, G. K., McGeer, J. C., Pawluk, M. P. The effects of five fish anaesthetics on acid-base balance, hematocrit, cortisol and adrenaline in rainbow trout. Canadian Journal of Zoology. 67, 2065-2073 (1989).
  54. Westerfield, M. The zebrafish book. A guide for the laboratory use of zebrafish (Danio rerio). 4th ed. Univ. of Oregon Press. (2000).
  55. Barrangou, R., Doudna, J. A. Applications of CRISPR technologies in research and beyond. Nature Biotechnology. 34, (9), 933-941 (2016).
  56. Adli, M. The CRISPR tool kit for genome editing and beyond. Nature Communications. 9, (1), 1911 (2018).
  57. Maruyama, T., et al. Increasing the efficiency of precise genome editing with CRISPR-Cas9 by inhibition of nonhomologous end joining. Nature Biotechnology. 33, (5), 538-542 (2015).
  58. Liu, M., et al. Methodologies for Improving HDR Efficiency. Frontiers in Genetics. 9, 691 (2018).
  59. Kirschbaum, F., et al. Intragenus (Campylomormyrus) and intergenus hybrids in mormyrid fish: Physiological and histological investigations of the electric organ ontogeny. Journal of Physiology Paris. 110, 3 Pt B 281-301 (2016).
  60. Jao, L. E., Wente, S. R., Chen, W. Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system. Proceedings of the National Academy of Science of the United States of America. 110, (34), 13904-13909 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics