שורש עגבניות המרה ואחריו חיסונים עם Ralstonia Solanacearum ניתוח גנטי פשוט של מחלת וילט חיידקי

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

כאן, אנו מציגים שיטה רב-תכליתית לשינוי בשורש העגבניות ולאחריה החיסון לביצוע ניתוח גנטי פשוט לחקר מחלות וילט בקטריאלי.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Morcillo, R. J. L., Zhao, A., Tamayo-Navarrete, M. I., García-Garrido, J. M., Macho, A. P. Tomato Root Transformation Followed by Inoculation with Ralstonia Solanacearum for Straightforward Genetic Analysis of Bacterial Wilt Disease. J. Vis. Exp. (157), e60302, doi:10.3791/60302 (2020).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Ralstonia solanacearum היא אדמה הרסנית הנישאים פתוגן כלי דם שיכולים להדביק מגוון רחב של מינים צמח, גורם איום חשוב על החקלאות. עם זאת, מודל Ralstonia הוא באופן משמעותי בהשוואה למודלים אחרים מעורבים פתוגנים צמח חיידקי, כגון פסאודומונס Syringae ב arabidopsis. מחקר ממוקד כדי להבין את האינטראקציה בין Ralstonia וצמחים יבול חיוני לפתח פתרונות קיימא להילחם נגד מחלת וילט חיידקי אבל מפריע כיום על ידי חוסר הניסיוני הנסיוני הפשוט לאפיין את המרכיבים השונים של האינטראקציה צמחים מארחים יליד. בתרחיש זה, פיתחנו שיטה לבצע ניתוח גנטי של זיהום Ralstonia של עגבניה, שורה טבעית של ralstonia. שיטה זו מבוססת על Agrobacteriumמתווכת הטרנספורמציה של שורשי עגבניות, ואחריו ralstonia קרקע-drenching החיסון של הצמחים כתוצאה מכך, המכיל שורשים שהפכו המבטא את המבנה של עניין. הרב-תכליתיות של השינוי הבסיסי מאפשר ביצוע או ביטוי היתר גנטית או גנים השתקה על ידי RNAi. כהוכחה למושג, השתמשנו בשיטה זו כדי להראות כי RNAi-תיווך השתקה של SlCESA6 בשורשי עגבניות הענקת עמידות לראסטוניה. כאן, אנו מתארים את השיטה הזאת בפרוטרוט, המאפשר גישות גנטיות להבין מחלות וילט חיידקי בזמן קצר יחסית, עם דרישות קטנות של ציוד ומרחב הצמיחה צמח.

Introduction

Ralstonia solanacearum, הסוכן הסיבתי של מחלת וילט חיידקי, היא קרקע הרסנית הנגרמת פתוגן כלי דם עם התפלגות עולמית שיכולה להדביק מגוון רחב של מינים צמח, כולל תפוחי אדמה, עגבניות, טבק, בננה, פלפל וחציל, בין השאר1,2. תשואה הפסדים שנגרמו על ידי Ralstonia יכול להגיע 80-90% של הייצור עגבניות, תפוחי אדמה או בננה, בהתאם זנים, אקלים, אדמה וגורמים אחרים3. עם זאת, מודל Ralstonia הוא באופן משמעותי בהשוואה למודלים אחרים מעורבים פתוגנים צמח חיידקי, כגון פסאודומונס syringae או קסטומונס spp. בנוסף, רוב המחקרים באינטראקציות הצמח-חיידק מתמקדים צמח המודל Arabidopsis thaliana. למרות שמחקרים המשתמשים במודלים אלה תרמו במידה רבה להבנת האינטראקציות של הצמחים-חיידקים, הם אינם מטפלים בצורך הנוכחי להבנת האינטראקציות הללו בצמחי היבול. מחקר ממוקד להבנת האינטראקציה בין Ralstonia וצמחים יבול חיוני כדי לפתח פתרונות קיימא להילחם נגד מחלת וילט חיידקי אבל מפריע כיום על ידי חוסר הניסיוני הנסיוני הישיר לאפיין את הרכיבים השונים של האינטראקציה. במיוחד, עגבניה, מארח טבעי עבור Ralstonia, הוא יבול הירקות השני החשוב ביותר ברחבי העולם והוא מושפע שפע של מחלות4, כולל מחלת וילט חיידקי. בעבודה זו, פיתחנו שיטה קלה לבצע ניתוח גנטי של זיהום Ralstonia של עגבניה. שיטה זו מבוססת על Agrobacteriumמתווכת הטרנספורמציה של שורשי עגבניות, באמצעות הפלואורסצנטית dsred כסמן בחירה5, ואחריו ralstonia קרקע-drenching של הצמחים וכתוצאה מכך, המכיל שורשים שהפכו לבטא את המבנה של עניין. הרב-תכליתיות של השינוי הבסיסי מאפשר ביצוע או ביטוי היתר גנטית או גנים השתקה על ידי RNAi.

מגבלה פוטנציאלית של שיטה זו מורכבת מגידול שיורית של שורשים שאינם משתנים. זה חשוב במיוחד במקרים שבהם השתמשו בפלסטלינה חסר גן עיתונאי המאפשר את הבחירה של שורשים שהפכו. כדי לפתור בעיה זו, פיתחנו שיטה חלופית המבוססת על בחירה אנטיביוטית, אשר מעכב את הצמיחה של שורשים שאינם משתנים תוך מתן אפשרות לצמיחה של שורשים בריאים עמידים לאנטיביוטיקה השתנה. מאז ה -ריזוזוגנים לא מזרז את הטרנספורמציה של נצרי, הם רגישים לאנטיביוטיקה, ולכן הם צריכים להיות מופרדים ממדיום המכיל אנטיביוטיקה.

למרות התנגדות הצמח נגד ralstonia אינו מובן היטב, דיווחים מספר יש הקשורים קיר תא שינויים התנגדות משופרת חיידקיםוילט 6,7,8,9.6 הוצע כי אלה שינויים קיר התא משפיעים על פיתוח כלי דם, היבט חיוני לאורח החיים של Ralstonia בתוך הצמח10. מוטציות בגנים קידוד התאית סטנדרטים CESA4, CESA7 ו CESA8 ב arabidopsis thaliana הוכחו לפגוע שלמות הקיר התא המשני, גרימת עמידות משופרת RALSTONIA, אשר נראה קשור ל-ABA איתות8. לכן, כהוכחה למושג של השיטה שלנו, ביצעת גן RNAi-תיווך השתקה של SlCESA6 (Solyc02g072240), תא משני הקיר תאית סטנדרטים, ו אורתולוג של AtCESA8 (At4g18780). בעקבות הקרקע-drenching החיסון עם Ralstonia הראה כי השתקה SlCESA6 התנגדות משופרת לתסמינים וילט בקטריאלי, הרומז כי התא התנגדות מתווכת כדי ralstonia סביר להניח בעגבניה, ולאמת את השיטה שלנו כדי לבצע ניתוח גנטי של התנגדות וילט חיידקי בשורשי עגבניות. כאן, אנו מתארים את השיטה הזאת בפרוטרוט, המאפשר גישות גנטיות להבין מחלות וילט חיידקי בזמן קצר יחסית, עם דרישות קטנות של ציוד ומרחב הצמיחה צמח.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

הערה: חלקים חשובים של שיטה זו כרוכים בטיפול בחומרים צמחיים, ולכן חשוב לשמור על התנאים הסטריליים במהלך כל ההליכים הללו, כולל ההדמיה של הקרינה הפלואורסצנטית של Dsred . במהלך כל תהליך השינוי, שתילי עגבניות לגדול ב 25-28 ° צ' ו 16 h/8 h אור/כהה (130 μm בפוטונים מ-2s-1 אור). הצלחות חתומות בסרט מיקרונקבוביות כדי להקל על החלפת הדלק והדיות.

1. הכנת צמחי עגבניות ואגרואכטריום

  1. לחטא זרעי עגבניות (Solanum lycopersicum Cv. MONEYMAKER, LA2706, עגבניה מרכז משאבים, TGRC) עם 5% (v/v) היפוכלוריט נתרן עבור 5 דקות. לשטוף 4-5 פעמים עם מים סטרילי מזוקקים ולשמור את הזרעים לרעוד לאט במים סטרילי לאורך הלילה כדי להקל על נביטה.
  2. להעביר את זרעי עגבניות מורראשיג בחצי כוח ו Skoog (1/2 MS) בינונית ללא סוכרוז (2.21 g/L MS, 8% w/v אגר). שמרו את הזרעים בחשיכה ב -25 עד 28 ° צ' במשך שלושה ימים (איור 1א).
    הערה: סביב 40 הזרעים נדרשים בדרך כלל עבור כל מבנה.
  3. אוטוקלב 8.5 ס מ2 מסנן משבצת מסמכים. מניחים את הניירות מסנן ריבוע בתוך 9 ס מ2 מנות פטרי מרובע המכיל 1/2 MS בינונית (במקום את הנייר על גבי אגר) ובמקום שש זרעי עגבניות מונבטים על כל צלחת (איור 1B). לאטום את הצלחת עם סרט מיקרונקבוביות ו מודקת את הזרעים מונבטים ב 25-28 ° c עבור 3 לארבעה ימים.
  4. גדל Agrobacterium MSU440 בינונית LB מוצק (עם אנטיביוטיקה המתאים) ב 28 ° c יומיים לפני שינוי הצמח.
    הערה: מסופק על ידי ד ר חואן אנטוניו לופז RÁEZ, EEZ-Csic, גרנדה, ספרד. בניסוי המתואר במאמר זה, שימשו את הpK7GWIWG2_II-RedRoot:: CESA6 או וקטור ריק, כפקד, בשימוש. pK7GWIWG2_II-RedRoot מכיל גן עיתונאי, Dsred, מונע על ידי האריידרופסיס thaliana היזם (pAtUBQ10), ו לדון התנגדות Spectinomycin (50 μg/mL). ניתן להשתמש בווקטורים אחרים להבעת גנים, כפי שדווח לפני5. בעבודה זו, הגברה של הקטע הספציפי עבור SlCESA6 השתקה הושגה על ידי שעתוק הפוכה (RT) PCR באמצעות RNA מבודדים מעגבניות (S. Lycopersicum cv. moneymaker) ו להכניס לתוך p-ENTR/D-topo וקטור (שולחן 1). לאחר מכן, המקטע SlCESA6-RNAi שוכפל בווקטור הבינארי של PK7GWIWG2_II-RedRoot.

2. התמרת ובחירת צמחים

  1. באמצעות אזמל סטרילי, לחתוך את הרדילה ואת החלק התחתון של ההיפוטיל של שתילי עגבניות (איור 1ג, ד).
  2. בציר A. ריזוזוגנים ביומסה מפני השטח של מדיום LB באמצעות עצות פלסטיק או להב אזמל ולטבול בזהירות את שתילי עגבניות לחתוך ביומסה חיידקי (איור 1E).
  3. לאחר החיסון עם . ריזוזוגנס, כסו את שתילי העגבניות בנייר מעגלי בגודל 2 ס"מ וחצי עגול (איור 1F), על מנת לשמור על לחות גבוהה ולהקל על ההישרדות ופיתוח השורש החדש.
  4. לאחסן את שתילי העגבניות השתנו במשך 6-7 ימים. לאחר מכן, השתמש באזמל סטרילי כדי לחתוך את השורשים המתעוררים החדשים (איור 1G, H; בשלב זה, השורשים אינם משתנים עדיין) ולאפשר לשתילים לייצר שורשים חדשים שעירים.
  5. לאחר הדור השני של השורשים השעירים החדשים מופיעים (איור 1I), להסיר את נייר הסינון על גבי השתילים, ולחתום את הצלחת עם קלטת מיקרונקבובית שוב.
    הערה: בשלב זה, הנוכחות של סמן הפלורסנט DsRed בווקטור השינוי מאפשרת להמחיש את יעילות השינוי בשורשים החדשים.
  6. כדי להמחיש את הקרינה הפלואורסצנטית האדום, השתמש stereomicroscope או כל ציוד אחר עבור המפעל vivo הדמיה (איור 1J). סמן את חיובי (פלואורסצנטית אדום) הופך שורשים ולהסיר את השורשים הלא משתנה שלילית (אין זריחה אדומה) באמצעות אזמל סטרילי.
  7. להעביר את השתילים מראה פלואורסצנטית אדום לצלחת חדשה המכילה 1/2 MS בינונית, כדי להקל על פיתוח של השורש ההפוך כמו השורש הראשי (איור 1K). שמור את השתילים שאינם מראים ניאון אדום באותה צלחת כדי לבדוק את הופעתה של שורשי פלורסנט (איור 1L) בנקודות זמן מאוחרות יותר.
  8. שיטה חלופית המבוססת על בחירה אנטיביוטית
    1. חלופה לשלב 2.5, להכין חצי מלא9 ס מ לוחיות הריבוע המכיל 1/2 MS בינוני עם אנטיביוטיקה המתאים. שיפוע לוחות כ 5 ° במהלך תהליך ההכנה כדי ליצור חלל ריק ללא בינונית (איור 2א), המאפשר נצרי לצמוח להימנע ממגע עם אנטיביוטיקה.
    2. חלופה לשלב 2.6, לאחר חיתוך השורשים השעיר הראשון שאינו שינוי התפתחה (שלב 2.4), להעביר את השתילים ללא שורשים הצלחות חצי מלא באמצעות ניירות מסנן עם הגודל המתאים (איור 2B).
      הערה: בתור שליטה חיובית, מומלץ להפוך מספר שתילים עם פלסטלינה המכיל את העמידות לאנטיביוטיקה זהה גן עיתונאי (בפרוטוקול זה, pK7GWIWG2_II-RedRoot; כולל 50 μg/mL).
    3. חלופה לשלב 2.7, לתת לשתילים לפתח שורשים שעירים חדשים ולגזור אלה שורשים שאינם במגע ישיר עם פני השטח של מסנן סנדוויץ הניירות, מאז שורשים אלה יכולים להימנע בחירה אנטיביוטית.
      הערה: בשל אפקט האנטיביוטיקה, פיתוח השורש עשוי להיות איטי יותר מאשר בצלחות ללא אנטיביוטיקה. שורשים שעירים חדשים מופיעים בתוך 14 עד 18 ימים לאחר העברת השתילים ללא שורשים ללוחות חצי מלאים (שלב 2.8.2) (איור 2ג-ה).
  9. מכסים את השתילים עם נייר 2 ס"מ x 4 ס מ מסנן לחצי עיגול, לאטום את הצלחת ואת השתילים שתילים לתת להם לפתח שורשים חדשים שעירים.
    הערה: אין צורך לחסל את הא. ריזוזוגנים באמצעות אנטיביוטיקה. נייר הסינון על גבי המדיום הטרשת הנפוצה והיעדר הסוכות מעכבים את התפשטות החלק העליון של מבנה ה-"לוחית 5".
  10. חמישה עד שבעה ימים לאחר בחירת השורש הראשונה, חזור על תהליך הבחירה כדי לבחור שורשים חדשים שעברו טרנספורמציה ולהסיר שורשים שאינם משתנים. להעביר את השתילים המכילים שורשים השתנה לצלחת חדשה המכילה 1/2 MS מדיום.

3. העברה לחיסונים

  1. הכינו את משטח השורשים לפני שהמשטחים ייחשפו לחיידק החיידקי: משרים את כלי החיסונים במים, יוצקים את כל המים העודפים, ומניחים אותם במגש לזריעת פלסטיק. העבירו את השתילים הנבחרים עם שורשים שהפכו לחיסונים בעזרת מלקחיים (איור 3א).
  2. כסו את המגש עם עטיפת ניילון או מכסה שקוף ושמרו אותם בגובה 25 עד 28 ° צ' ו 65% לחות (16 h/8 שעותאור/ כהה; 130μ:00), כדי לשמור על רמה גבוהה של לחות באיור 3B). הסירו את הכיסוי. לאחר חמישה או שישה ימים
    הערה: צמחי העגבנייה הפכו להיות מוכנים לחיסונים שבועיים-שלושה לאחר העברתם לקרקע (איור 3ג). במהלך הגידול על הקרקע, צמחי עגבניות עשויים לייצר שורשים חדשים שאינם משתנים. כדי לקבוע את מידת התופעה, הפלואורסצנטית האדום היה דמיינו בשורשים של שלושה שבועות בן צמחים עגבניות שהפכו. רוב השורשים (80%-100%) הראה פלואורסצנטית אדום, המציין כי הם אכן הפכו (איור 3D, E).

4. אדמה-החיסון

  1. לגדול ר solancearum (זן GMI1000 בפרוטוקול זה) במדיום נוזלי פי (שולחן 211) ב שייקר מסלולית (200 rpm) ב 28 ° צ' עד השלב הנייח.
  2. לקבוע מספרים חיידקיים על ידי מדידת הדחיסות האופטית של התרבות החיידקית ב 600 ננומטר (OD600). לדלל את התרבות החיידקית עם מים כדי OD600 של 0.1 (בתנאים המשמשים כאן, זה מתאים כ 108 יחידות המושבה ויוצרים [cfu]/ml).
  3. מניחים 16-20 מפעלי עגבניות שעברו שינוי במגש (29 ס מ x 20 ס מ; איור 4א).
  4. יוצקים 300 mL (~ 15 מ"ל לכל מפעל) של חיידקים (OD600 של 0.1) לתוך המגש המכיל את החיסונים. תנו להם לטבול באינוסינה במשך 20 דקות (איור 4ב').
  5. הכינו מגש חדש עם שכבה של אדמת השתילה. להעביר את הסירים מחוסן לתוך המגש החדש (איור 4ג) ומניחים את המגשים בחדר הגידול עם 75% לחות, 26-28 ° c, ו photoperiod של 12 h אור ו 12 h החושך (130 μ:4 מתוך הפוטונים m-1 אור).

5. קביעת פרמטרים לזיהום וניתוח סטטיסטי

  1. ציון תסמיני המחלה כפי שתוארו בעבר12,13, באמצעות סולם החל מ -0 (אין סימפטומים) כדי 4 (להשלים ווילטינג) (איור 4D-H), כל יום אחרי ralstonia החיסון לשבועיים.
    הערה: נתוני אינדקס המחלה נאספים מאותה יחידה ניסיונית (כל צמח) לאורך זמן.

6. ביטוי גנטי ניתוח

הערה: הביטוי של הטרנסוגן או השתקה של גן היעד ניתן לקבוע על ידי RT-PCR או על ידי RT-pcr כמותי (רביעיית-PCR).

  1. לאסוף דגימות ולחלץ RNA מחלק נציג של מערכת השורש השתנה (כדי להעריך את ההשפעה על הגן היעד) ועלים (כמו שליטה פנימית).
  2. לסנתז cDNA באמצעות 1 μg של הכולל מטופלים DNase-RNA.
  3. לנתח את הביטוי הגנטי של גנים היעד על ידי רביעיית-PCR. לחשב את רמות התמלול יחסית באמצעות 2-ΔΔCT שיטה14, באמצעות slefα-1 כתחזוקת גן15.
    הערה: רצף תחל מופיע בטבלה 1.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

איור 5 מראה את ההתפתחות של תסמיני המחלה של צמחי עגבניות עם שורשים שהפכו עם וקטור ריק (EV), וצמחים עם שורשים השתנה עם בניית rnai מיקוד SlCESA6 (Solyc02g072240). נתוני מדד המחלה (איור 5א) נאספים מאותה יחידה ניסיונית (כל צמח) לאורך זמן, בהתאם לקנה מידה שרירותי מ -0 ל-4, ואינם עוקבים אחר התפלגות גאוסיאנית, ומשנה את השימוש במבחנים סטנדרטיים לנתונים פרמטרית. יתר על כן, יש מפעל מהותי לצמח וריאציה בסוג זה של ניסויים, בשל הקולוניזציה ודינמיקה הזיהום. להלן שקלנו שיטות שונות לייצוג וניתוח סטטיסטי של סימפטומים הקשורים לזיהום Ralstonia .

כגישה סטנדרטית, בדיקה לא פרמטרית של U מאן-ויטני להשוואת שני הפקדים (EV) ו- SlCESA6-rnai עקומות הזיהום נעשה שימוש. לפי ניתוח זה, ההפרש בין המדיאנים של שני העיקולים נראה כבלתי משמעותי (P = 0.16).

ניתן גם לכמת את האזור תחת עקומת התקדמות המחלה (AUDPC), אשר מאפשר שילוב של תצפיות מרובות של התקדמות המחלה לערך אחד. AUDPC הראה ערך גבוה יותר עבור מפעלי בקרה (EV; 28.75 ± 4.75) לעומת SlCESA6-rnai (21.01 ± 4.74) צמחים בסוף תהליך הדלקת, המציין כי צמחים SlCES6מושתקים עמידים יותר לזיהום ralstonia מאשר צמחים שליטה (איור 5B).

מרווחי ביטחון (CI) מציעים דרך להעריך, עם סבירות גבוהה, טווח של ערכים שבהם נמצא ערך האוכלוסיה (או הפרמטר) של משתנה נתון. כפי שהוא מוצג באיור 5C, האזור של 95% CI עבור control (EV) ו- SlCESA6-rnai עקומות זיהום מעריכים סיכוי גבוה יותר של התנגדות כאשר SlCESA6 מושתקים.

ניתן להפוך ערכי אינדקס מחלות לנתונים בינאריים, בהתחשב באינדקס מחלות נמוך מ-2 המתאימים ל-"0", ואינדקס מחלות שווה או גבוה מ-2 המתאים ל-"1"12. זה מאפשר ייצוג של עקומת הישרדות אחרי Ralstonia החיסון. שינוי זה מבוסס על התבוננות כי, ברגע הצמחים להתחיל לפתח סימפטומים ברורים (מדד המחלה של 2), הם נחשבים "נגועים" וימותו כתוצאה של זיהום זה. ההבדלים בשיעור ההישרדות בין הצמחים EV ו- SlCESA6-rnai לא היו משמעותיים מבחינה סטטיסטית על פי מבחן סטטיסטי Gehan ברז-Wilcoxon (P = 0.13) (איור 5ד).

בנוסף לביצוע ניתוח סטטיסטי, וללא קשר לערכי P שהושגו, כדאי לפרש נתונים אלה בהתבסס על הנטייה המושבעת של הנטיות הצפות בתוך משכפל שונה (איור משלים 1). בשמירה על הרעיון הזה, מספר גדל והולך של מדענים לאחרונה הגיב על הסיכונים של יתר באמצעות סף סטטיסטי קפדנית (כגון ≤ P סטנדרטי 0.05)16.

הביטוי של SlCESA6 נותח בשני שורשים שנבחרו באופן אקראי לפני שלב החיסונים, מראה כי ההתנגדות המשופרת של ralstonia התואם את הביטוי המוקטן של SlCESA6 (איור 5E). שימוש בשיטה זו, שיעור טרנספורמציה של 35 לערך של 40 לאחר שני סיבובים של בחירה ניתן להשיג (איור 5F). ניתן להגדיל ערך זה על-ידי ביצוע סיבובים נוספים של בחירה5.

Figure 1
איור 1: הכנת הצמח, טרנספורמציה ובחירה. (א) נביטה של זרעי עגבניות בחצי כוח MS (1/2) בינוני. (ב) מונבטים זרעי עגבניות להציב על נייר סינון שוכב על צלחת המכילה 1/2 MS מדיום. שתילי עגבניות לפני (C) ואחרי (ד) חותכים את הרדילה והחלק התחתון של ההיפוקוטיל. (ה) התמרה שתיל המרה על ידי טבילה ביומסה חיידקי. (ו) שתילי עגבניות שהפכו מכוסים נייר סינון כדי לשמור על לחות. הופעתה (G) והסרה (H) של שורשים חדשים (שאינם משתנים) השעיר. (I) הופךשורשים. (J) מבחר של שורשי עגבניות משורשנות על ידי ויזואליזציה של הזריחה של dsred. החיצים האדומים מצביעים על שורשים חיוביים שהפכו לביטוי. (K) התפתחות השורשים הפכו לשורשים העיקריים. (L) ויזואליזציה של הקרינה הפלואורסצנטית בשורשים הופכים בוגרים. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 2
איור 2: שיטה חלופית המבוססת על בחירה אנטיביוטית. (A) צלחת חצי מלאה מרובע המכיל 1/2 MS בינוני. (ב) לגזור שתילים שסולק על נייר סינון שוכב על 1/2 MS בינונית עם אנטיביוטיקה, לאחר הסרת שורשים שעירים הראשון שאינו שינוי. (ג) שורשים מכוסים נייר סינון נוסף. (ד) עגבנייה שורשים השתנה גדל על 1/2 MS בינונית עם אנטיביוטיקה. (ה) שתילים השתנו עם PK7GWIWG2_II-RedRoot (kanamycin 50 μg/mL), ביטוי dsred, כשליטה חיובית. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 3
איור 3: העברת עגבנייה שהפכה לכלי החיסונים. (א) עגבניות המועברות בשורש הועברו לחיסונים ספוגים מלא. (ב) עגבניות שהפכו את החיסונים המכוסים במכסה פלסטיק כדי לשמור על רמת לחות גבוהה. (ג) שניים עד שלושה שבועות של עגבניות שעברו שורש, לאחר העברה לחיסונים, מוכן להיות מחוסן. (ד) צמחי עגבניות בני שלושה שבועות לאחר הסרת הקרקע. (ה) שורש הקרינה הפלואורסצנטית בשורשים של שלושה שבועות בן שהפך צמחים עגבניות. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 4
איור 4: ראסטוניה-אדמת החיסון. (א) חומרים הנחוצים למחקר GMI1000 חיסון. (ב) האדמה-drenching של עגבניות שהפכו בתוך החיסונים עם ר. סולאלארנום GMI1000 ניות. (ג) עגבניות מחוסן מונח על שכבה של אדמת השתילה. (ד-ח) מחלת Ralstonia הסימפטומים בקנה מידה החל 0 (אין סימפטומים) כדי 4 (להשלים ווילטינג). אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 5
איור 5: SlCESA6 השתקה מגבירה את ההתנגדות ל -R. solanacearum. (א) תסמיני המחלה של RNAi-תיווך SlCESA6-מושתקים(CESA6-rnai) ושורש וקטור ריק (EV) שעבר צמחים עגבניות על החיסון עם R. solanacearum. ערכים מקבילים לאמצעים ± SE של שמונה צמחים. (ב) אזור תחת עקומת התקדמות המחלה של צמחים המוצגת בלוח A. (ג) 95% מרווח ביטחון של צמחים המוצגים בפאנל a. (ד) אחוז הצמחים ששרדו המוצגים בלוח א. (ה) ביטוי גנטי ניתוח על ידי רביעיית-PCR של Rnai-תיווך SLCESA6-מושתקים (CESA6i) ו-EV שורש השני צמחי עגבניות בשורשים (1, 2) ו לירות (ים). ערכים מקבילים לאמצעים ± SE של שלושה משכפל טכני. (ו) שיעור הטרנספורמציה של צמחי עגבנייה בשורש EV ו- CESA6-rnai של שני ניסויים עצמאיים. ערכים מקבילים לאמצעים ± SE, לאחר שני סיבובים של בחירה. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

שם תחל תחל רצף (5 '-3 ')
EFα-1-F מיכל ברקת
EFα-1-R מיכל הלוי
qCESA6-F GATCTGGTTCGCTTTCTCGT
qCESA6-R TCCCTCCCTTTCATACCTTG
CESA6-RNAi-F מיכאל ברקת
CESA6-RNAi-R המנון בלבד

שולחן 1: פריימר רצפים.

רכיבים עבור 1 ליטר
באקול משחק 10
תמצית שמרים מיכל הג
חומצות אמינו מיכל הג

טבלה 2: Phi (Ø) הרכב בינוני.

איור משלים 1: הבנת התוצאה המוצגת באיור 5A. תסמיני המחלה של RNAi-בתיווך SlCESA6-מושתקים (CESA6-RNAI) ו-EV צמחים עגבניות שעברו השורש על החיסון עם R. solanacearum. ערכים מקבילים לאמצעים ± SE של שמונה צמחים. ביטוי גנטי ניתוח בוצע על ידי רביעיית ה-PCR של RNAi-תיווך SlCESA6-מושתקים (CESA6i) ו ריק וקטור (EV) שינתה את צמחי עגבניות בשורש שורשים (1, 2) ו לירות (ים). ערכים מקבילים לאמצעים ± SE של שלושה משכפל טכני. אנא לחץ כאן כדי להוריד את האיור.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Ralstonia סולאליום מהווה איום חשוב לחקלאות; עם זאת, האינטראקציה שלה עם המארחים הטבעי של החשיבות החקלאית הוא עדיין הבין באופן גרוע לעומת פתוגנים חיידקיים אחרים, במיוחד בגידולים מינים צמח. ברוב המקרים, ניתוח גנטי מפריע הזמן וההוצאות הדרושות כדי לשנות גנטית צמחים מארחים. כדי לטפל בבעיה זו ולהקל על ניתוח גנטי של הזיהום של R. sol, בעגבניה, פיתחנו שיטה קלה המבוססת על Agrobacteriumהתמרת-מתווך של שורשי עגבניות (איור 1), ואחריו מנקבים אדמה (איור 3). השורשים שעברו טרנספורמציה נבחרים באמצעות כתב פלורסנט (DsRed בפרוטוקול זה) (איור 1). בנוסף, פיתחנו גם שיטה חלופית המבוססת על בחירת אנטיביוטי שאינה מזיק לחלק האווירי שאינו משתנה (איור 2).

פרוטוקול השינוי מבוסס על המתואר על ידי הו-Plágaro et al.5, עם מספר שינויים. הרב-תכליתיות של שיטה זו מאפשרת מספר רב של מוצרים נוספים בשורשים משתנים, כגון אלה לנתח את הפיזיולוגיה של הצמח, תגובה לטיפולים כימיים ו/או תגובות ללחצים ביוטיים וביופטיים שונים.

לאחר העברת הצמחים שהפכו לקרקע, אנו שקלנו את האפשרות שצמחים עשויים לפתח שורשים חדשים שאינם יכולים להשתנות. בחנו אפשרות זו על ידי התבוננות על הזריחה מ-DsRed במערכת השורש של צמחים שהפכו שבועיים לאחר העברתם לקרקע (לפני Ralstonia החיסון). התוצאות הראו זריחה אדומה ברוב השורשים (איור 3ד).

T-DNA העברה על ידי Agrobacterium משולב הגנום המארח באופן אקראי, ולכן, שיטה זו מייצרת אוכלוסיה הטרוגנית של צמחי עגבניות עם רמת ביטוי שונה של הגן היעד. בדרך כלל מדבקת המחלה מעוררת את מותם של הצמחים, שלאחר מכן מעכבת את אוסף דגימות השורש לאחר הניסוי לניתוח הביטוי הגנטי של כל צמח. כדי לנתח את רמת הביטוי של הגן היעד במהלך הניסויים, אנו בוחרים שניים עד שלושה צמחים שהפכו שורש לפני שלב החיסונים, כמדגם מייצג של האוכלוסייה כי יהיה מחוסן. איור 5 מראה כי הפחתת תסמיני המחלה בצמחי עגבניות הקשורים ליעילות של SlCESA6 השתקה לפני שלב החיסונים. לכן, ולמרות מגבלות הפרוטוקול, תוצאות הנציג שלנו להפגין בבירור כי שיטה זו היא כלי רב עוצמה כדי ללמוד גנים המועמדים המעורבים התנגדות או רגישות ל -R. solanacearum בעגבניה. הדוגמה המוצגת במאמר זה אפשרה לנו לקבוע כי דפיקות למטה SlCESA6, תא משני הקשורים לקיר תאית סטנדרטים, מגביר עמידות לזיהום על ידי R. solanacearum, הדומה לתצפיות קודמות באמצעות האורתוקציה AtCESA8 (At4g18780) מ arabidopsis thaliana8.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

. למחברים אין מה לגלות

Acknowledgments

אנו מודים לכל חברי המעבדה של המעבדה המאצ לדיונים מועילים, אלווארו לופז-גרסיה לייעוץ סטטיסטי, ולקסיג'יו ג'יאן לסיוע טכני ומנהלי במהלך עבודה זו. אנו מודים PSC Cell ביולוגיה מתקן הליבה לסיוע עם הדמיה פלואורסצנטית עבודה זו נתמכת על ידי תוכנית מחקר עדיפות אסטרטגית של האקדמיה הסינית למדעים (גרנט XDB27040204), מרכז שנגחאי עבור ביולוגיה לחץ הצמח (סינית האקדמיה למדעים ותוכנית הכשרונות הסינית 1000.

Materials

Name Company Catalog Number Comments
90 mm square Petri-dishes
Agar powder Sigma-Aldrich
Bacto peptone BD (Becton and Dickinson)
Casamino acids Sigma-Aldrich
Filter paper
In Vivo Plant Imaging System NightShade LB 985 Berthold Technologies
Jiffy pots Jiffy Products International A.S.
Micropore tape 3M
Murashige and Skoog medium (M519) Phytotechlab
Pindstrup substrate Pindstrup Mosebrug A/S
Scalpel and blade
Sodium hypochlorite Sigma-Aldrich
Sterile clean bench
Tweezers
Wahtman paper Wahtman International Ltd. Maldstone
Yeast extract OXOID

DOWNLOAD MATERIALS LIST

References

  1. Jiang, G., et al. Bacterial Wilt in China: History, Current Status, and Future Perspectives. Frontiers in Plant Science. 11, (8), 1549 (2017).
  2. Mansfield, J., et al. Top 10 plant pathogenic bacteria in molecular plant pathology. Molecular plant pathology. 13, (6), 614-629 (2012).
  3. Elphinstone, J. G. The current bacterial wilt situation: a global overview. In: Bacterial Wilt Disease and the Ralstonia solanacearum Species Complex. Allen, C., Prior, P., Hayward, A. C. American Phytopathological Society Press. St Paul, MN. 9-28 (2005).
  4. Jones, J. B., Jones, J. P., Stall, R. E., Zitter, T. A. Compendium of Tomato 1094 Diseases. APS Press. St Paul, MN. (1991).
  5. Ho-Plágaro, T., Huertas, R., Tamayo-Navarrete, M. I., Ocampo, J. A., García-Garrido, J. M. An improved method for Agrobacterium rhizogenes-mediated transformation of tomato suitable for the study of arbuscular mycorrhizal symbiosis. Plant Methods. 14, 34 (2018).
  6. Wydra, K., Beri, H. Structural changes of homogalacturonan, rhamnogalacturonan I and arabiogalactan protein in xylem cell walls of tomato gentoypes in reaction to Ralstonia solanacearum. Physiological and Molecular Plant Pathology. 68, 41-50 (2006).
  7. Wydra, K., Beri, H. Immunohistochemical changes in methyl-ester distribution of homogalacturonan and side chain composition of rhamnogalacturonan I as possible components of basal resistance in tomato inoculated with Ralstonia solanacearum. Physiological and Molecular Plant Pathology. 70, 13-24 (2007).
  8. Hernández-Blanco, C., et al. Impairment of cellulose synthases required for Arabidopsis secondary cell wall formation enhances disease resistance. Plant Cell. 19, (3), 890-903 (2007).
  9. Denancé, N., et al. Arabidopsis wat1 (walls are thin1)-mediated resistance to the bacterial vascular pathogen, Ralstonia solanacearum, is accompanied by cross-regulation of salicylic acid and tryptophan metabolism. Plant Journal. 73, (2), 225-239 (2013).
  10. Digonnet, C., et al. Deciphering the route of Ralstonia solanacearum colonization in Arabidopsis thaliana roots during a compatible interaction: focus at the plant cell wall. Planta. 236, (5), 1419-1431 (2012).
  11. Sang, Y., et al. The Ralstonia solanacearum type III effector RipAY targets plant redox regulators to suppress immune responses. Molecular Plant Pathology. 19, (1), 129-142 (2018).
  12. Remigi, P., Anisimova, M., Guidot, A., Genin, S., Peeters, N. Functional diversification of the GALA type III effector family contributes to Ralstonia solanacearum adaptation on different plant hosts. New Phytologist. 192, 976-987 (2011).
  13. Wang, K., et al. Functional assignment to positively selected sites in the core type III effector RipG7 from Ralstonia solanacearum. Molecular Plant Pathology. 17, 553-564 (2016).
  14. Livak, K. J., Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods. 25, (4), 402-408 (2001).
  15. León-Morcillo, R. J., Martín-Rodríguez, J. A., Vierheilig, H., Ocampo, J. A., García-Garrido, J. M. Late activation of the 9-oxylipin pathway during arbuscular mycorrhiza formation in tomato and its regulation by jasmonate signalling. Journal of Experimental Botany. 63, (10), 3545-3558 (2012).
  16. Amrhein, V., Greenland, S., McShane, B. Retire statistical significance. Nature. 567, 305-307 (2019).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics