Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

בידוד מניפולציה גנטית של Myocytes לב למבוגרים הדמיה confocal

doi: 10.3791/1433 Published: September 17, 2009

Summary

Myocytes לב למבוגרים הם תאים ראשוניים, כי יכול להיות מבודד לבבות בעלי חיים מתורבתים במשך כמה ימים. במהלך תקופה זו תרבות העברת גנים adenoviral ניתן להשתמש בהם כדי להביע biosensors מקודדים גנטית (GEBs) או חלבונים היתוך ניאון. שתי הגישות לאפשר חקירות הסלולר באמצעות מיקרוסקופיה confocal.

Abstract

Myocytes לב מבודד בלב מבוגר הן מקובלת כמודל איפשהו באמצע הדרך בין לתאי שריר עובריים בילוד מצד אחד לב עובד על השני. לפיכך, cardiomyocytes לשמש מודלים טוב פיזיולוגיה פתופיזיולוגיה הסלולר לב, לחקירות התרופות, כמו גם למחקר של מודלים של בעלי חיים מהונדס. כאן אנו מתארים שיטה לבודד את התאים מן הלב. יתר על כן אנו מראים כיצד מניפולציה גנטית על myocytes לב יכול להתבצע ללא גידול חיה מהונדס: זהו שילוב של תרבות ארוכת טווח (1 שבוע) ו - העברת גנים adenoviral. האחד האחרון מתואר מהקמת הנגיף התמרה של התאים. זה יכול לשמש לביטוי של biosensors מקודדים גנטית (GEBs), חלבונים היתוך ניאון, אלא גם על ביטוי החלבון על פני מטה הרגולציה, למשל באמצעות RNAi. כאן אנו מספקים דוגמה לביטוי של חלבון היתוך מכתים מבנה subcellular (Golgi). ביטוי חלבון כזה יכול להיות דמיינו ידי הדמיה confocal של Z-ערימות לשיקום-3D של מבנים subcellular. פרוטוקול מורכב המדינה-of-the-art בתרבות התא, ביולוגיה מולקולרית ביופיזיקה ובכך מספק גישה לחקר אופקים חדשים קרדיולוגיה הסלולר.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

על כל עיצוב של פרוטוקול המכיל ארבעה שלבים גדולים מתואר באיור 1. כל הצעדים מתוארים בפירוט מלא. בידוד נייד, התמרה והתרבות, ואחריו הדמיה confocal כ -24 שעות מאוחר יותר היא זמנים רצופים חובה. הבנייה וירוס צריך להיעשות לפני בידוד התא ומשמש אז עבור התמרה גנטית.

1. בידוד של myocytes הלב המבוגר מהלב עכברוש

  1. למבוגרים חולדות זכרים Wistar כ 250 גרם במשקל (6-12 שבועות הישן) הם anesthetised בזריקה intraperitoneal של פתרון הרדמה μl 170 לכל 100 גרם משקל גוף
  2. בנוסף, פתרון ציטרט (2 μl / משקל גוף ז) מוזרק למנוע קרישת הדם במהלך הניתוח.
  3. זלוף Langendorff הגדרת צריכים להיות מוכנים. כל הפתרונות צריכים להיות רווי חמצן.
  4. כאשר החולדה היא anesthetised, בעלי חיים הוא קבוע על לוח ניתוח את החלק העליון של הגוף לחטא עם אתנול 70%.
  5. בעל חיים הוא נהרג על ידי חיתוך דרך הראש.
  6. בית החזה נפתח באמצעות מספריים. הלב לבין אבי העורקים כעת אמור להיות נגיש. Pericard מוסר.
  7. קר כקרח פתרון A + (5 מ"ל) מוזרק בשני החדרים באמצעות מחט 26-מד לעצור את הלב לשטוף את הדם.
  8. אבי העורקים הוא תפס עם מלחציים ו מקוצץ ב קשת אבי העורקים רק היו הסתעפות הראשון מופיע.
  9. הלב הוא הוסר מהחזה ואת אבי העורקים מחוברת צינורית של זלוף הגדרת ידי מלקחיים מלחציים לאפשר מדרדר Langendorff-זלוף. שים לב שלא foraminate את שסתומי העורקים.
  10. הלב צריך להיות קבוע על ידי ליגטורה סביב האאורטה / קנולה. כלי פתוח גם צריך להיות ligated.
  11. הלב הוא perfused retrogradely עם פתרון חמצן רווי + בטמפרטורת החדר (23 מעלות צלזיוס) במשך 10 דקות בלחץ של כ -70 mbar. ודא שאין בועות אוויר להיכנס באבי העורקים.
  12. הפתרון זלוף מופעלת לפתרון Liberase בטמפרטורה של 37 מעלות צלזיוס למשך כ 25 דקות בקצב של 4 מ"ל / דקה באמצעות משאבה peristaltic. בסוף זלוף הלב צריך להיראות השיש הלבן. זמן העיכול ייתכן שיהיה צורך להתאים מצב מצב / הרקמה.
  13. הלב הוא נלקח זלוף הגדרת והושמו פתרון צלחת פטרי המכילה בטמפרטורה של 37 ° C. כלי הנותרים אטריה מנותקים. כלי מבוטלים ואת הפרוזדורים - במידת הצורך - מטופלים בצורה שונה (לא במסגרת פרוטוקול זה). החדרים מחולקים כ 6 חתיכות.
  14. חתיכות מועברים לתוך בקבוק 100 מ"ל Erlenmeyer המכיל 20 מ"ל פתרון בטמפרטורה של 37 מעלות צלזיוס, נסער מעט אמבטיה 37 מעלות צלזיוס מים 5 דקות. לבסוף supernatant נמחקת.
  15. ההליך המתואר לעיל חוזר על עצמו פעם או פעמיים. Supernatant אמור להופיע מעט אטום.
  16. תוספת של ריכוז סידן תאית היא יזמה ידי הוספת 20 מ"ל של תמיסת B 1 / 2 ב 37 ° C ל תאים ורקמות שנותר עודף פתרון בתוך הבקבוק Erlenmeyer. זהו מזועזע במקצת אמבטיה 37 מעלות צלזיוס מים 5 דקות נוספות. בהמשך supernatant נמחקת.
  17. הוסף עוד 20 מ"ל פתרון B 1 / 2. (Supernatant פתרון / עכשיו צריך להכיל תאים קיימא.) ירידה של התאים מועבר בצלחת פטרי על מיקרוסקופ תא הפוכה תרבות. אם התאים מראים פעילות ספונטנית גבוהה (התכווצויות) צריך לחכות עד התאים לבוא לנוח.
  18. שוב supernatant הוא מושלך ו 20 מ"ל של תמיסת B 1 / 2 מתווספים.
  19. קצה פלסטיק פיפטה פסטר נחתך בצורה כזו כי פיסות הרקמה יכול לעבור בקלות כאשר נסער דרך הפתח. באמצעות טיפול להבה קצוות חדים הם התרככו (נמס).
  20. עכשיו הם פיסות הרקמה מעט triturated בעדינות. פיסות הרקמה צריכים "להתפרק" לתוך התאים.
  21. התא המכיל supernatant הוא יצק ומדולל עם פתרון B להגיע צפיפות התאים הרצויים, אשר תלוי בסוג של ניסויים צריך להיקבע באופן אמפירי.

2. בניית adenovirus עבור התמרה חלבון היתוך

כדי לייצר adenoviruses מערכת לשרבב-Ad-Vector adenoviral מ Biomedicals MP משמש 1. פרוטוקול זה מתחיל עם וקטור הכניסה זמין ונבדקו (pCR259) עבור חלבון היתוך פלורסנט או 2 של GEB.

  1. כמות של 10 ננוגרם של וקטור שהוזכרו לעיל pCR259 הראשוני המכיל את הגן ריבית משתנה עם μl 100 HighQ-1 לשרבב-AD ™ 294 תאים המוסמכות.
  2. תערובת זו מודגרות במשך 20 דקות על הקרח ואחריו הלם החום של 45 על 42 ° C ו מאוחסן על הקרח 2 דקות נוספות.
  3. הוספת 900 & mu; L של C-LB בינוני לגדול ב 37 ° בררנית עם תסיסה עדינה במשך 4 שעות.
  4. 50 μl פלייט, 100 ו - 200 μl μl על צלחות המכילות LB-בינוני עם Chloramphenicol (ס"מ, 20 מיקרוגרם / מ"ל), אמפיצילין (100 מיקרוגרם / מ"ל), טטרציקלין (15 מיקרוגרם / מ"ל), X-Gal (280 מיקרוגרם / מ"ל ) ו IPTG (40 מיקרוגרם / מ"ל). (מכתים אינטנסיבי יותר כחול יותר אפשרי באמצעות צבע יקר יותר Bluo גל עם 300μg/ml. זה אמור לשמש בעיקר כאשר אתה לא מכיר כל כך הכרה והבחנה כחול / לבן המושבות)
  5. לגדול במשך 24 שעות ב 37 ° C. השאירו על 4 מעלות צלזיוס עד זיהוי טובה של מושבות כחול אפשרי. כאשר יש בעיות להחליט איזה מושבה הוא לבן באמת לקחת חלק המושבות לשכפל בצלחת נוספת המכילה את שלושת אנטיביוטיקה, X-גל IPTG ולתת להם לצמוח לאורך הלילה 37 ° C.
    הערה) HighQ-1 לשרבב-AD ™ 294 תאים מכילים שני פלסמידים חשוב: עמוד השדרה adenovirus (לשרבב-Ad ™ 294) ו עוזר פלסמיד להביע transposase, אשר מתווכת הכניסה של הגן של עניין אל אתרי היעד שלה, הממוקם בגן LacZ של 294 לשרבב-לספירה פלסמיד.
  6. כדי לזהות מושבות חיובי המכיל את הגן של עניין עמוד השדרה וירוס לבצע המושבה-PCR כמתואר 2.7-2.9. השתמש primers וקטור איגוף באתר שיבוט מרובים (קדימה 5 "CCCAGTCACGACGTTGTAAAACG 3", הפוכה 5 "GCGGATAACAATTTCACACAGG 3") ולעשות המושבה PCR עם מושבות לבן 100% השתמש באחת המושבה כחול כביקורת על לשרבב-AD 294 פלסמידים ללא הגן מוכנס של עניין. מושבות כחול ייתן לך קטע קצר PCR (~ 200bp), מושבות המכיל גן העניין שלך להראות מוצר גדול PCR (תלוי באורך של הגן העניין שלך) ומושבות עם שני שברים הן מושבות תאים מרובים צריכים להיות מופרדים אם נעשה שימוש נוסף.
  7. על פי הטבלה שלהלן לערבב אמן צריך להיות מוכן.
  8. פיק מושבה אחת לבנה 100% עם קיסם autoclaved והראשון לעשות לשכפל את המושבה הזאת בצלחת-LB עם ס"מ.
  9. העברת המושבה לתערובת-PCR. סלסול זה בתמהיל-PCR פעמים 3-4 מאשר להסיר את קיסם לפני שהוא יכול לספוג הרבה לערבב-PCR. PCR-פרוטוקול תלוי kb של הכנס ואת פולימראז בשימוש. הטמפרטורה חישול של primers היא 57 ° C ו 35 מחזורים השימוש מומלץ.
  10. לגדול על תרבויות הלילה (LB-בינוני עם ס"מ) של שיבוטים חיובית לבודד את פלסמידים עם ערכת זמין מסחריות בלי עמודות ספין, כי הכוח הצנטריפוגלי משבש את וקטור וירוס ענק.
  11. המרה 0.5 מיקרוגרם של פלסמידים מבודדים תאים 100 μl המוסמכת DH5α. דגירה DNA עם תאים על קרח למשך 30 דקות. הלם חום של 45 על 42 ° C ולהגדיר על קרח דק '2.
  12. הוסף 900 ​​μl בררנית LB-בינוני לגדול ב 37 ° C עם תסיסה עדינה במשך שעה 1.
  13. פלייט 50 μl על צלחת המכיל LB-בינוני עם ס"מ, X-גל IPTG. לדגור על 37 מעלות צלזיוס למשך 24 שעות.
  14. פיק לשכפל עד 20% 100 מושבות לבנות על אמפיצילין נפרדים, טטרציקלין וצלחות Chloramphenicol המכיל IPTG ו X-Gal. תנו להם לצמוח לאורך הלילה 37 ° C. בחר מושבות אשר 100% לבן, chloramphenicol עמידים, אמפיצילין ו tetracyclin רגיש.
  15. במושבה-PCR (אופציונלי): שיבוטים חיובי, ניתן לבדוק שוב עם המושבה-PCR כדי לבדוק כי הם מכילים את הכנס.
  16. פיק מושבה אחת של רקומביננטי חיוביים לגדול מ"ל 600 LB-בינוני עם ס"מ.
  17. לבודד את הפלסמיד בעזרת ערכת maxi פלסמיד.
  18. תקציר 5 מיקרוגרם של פלסמיד עם פאק אני שעתיים ב 37 מעלות ולהפסיק את התגובה על 65 מעלות צלזיוס למשך 20 דקות.
  19. לרכז את לעכל שלם SpeedVac בטמפרטורת החדר למשך 30 דקות עד נפח סופי של μl 10 או להשתמש בשיטה פנול, כלורופורם החילוץ.
  20. הפשירי בקבוקון של קפוא QBI-HEK 293 תאים עם תסיסה עדינה בתוך אמבט מים 37 מעלות צלזיוס. יש לשטוף את החלק החיצוני של הבקבוקון עם אתנול 70% והמשך בסביבה נקייה מחיידקים במנדף סטרילית.
  21. העברת התאים צינור סטרילי 15 מ"ל, 10 מ"ל להוסיף dropwise DMEM (10% FCS) בעוד התססה עדין צנטריפוגה 10 דקות ב 250xg כדי גלולה התאים.
  22. בטל supernatant. Resuspend את הכדור ב 10 מ"ל DMEM (10% FCS) על ידי pipetting בעדינות מעלה ומטה.
  23. זרעים של בקבוקון 75 ס"מ 2 ולהוסיף 10 מ"ל DMEM עם FCS 10% על התאים. לדגור על הלילה 37 מעלות צלזיוס של 5% CO 2 באינקובטור.
  24. למחרת לאמת את צפיפות התאים. QBI-HEK 293 תאים יש לפצל ביחס 1:10-01:20.
  25. הסר את המדיום מן התאים trypsinize עם טריפסין מ"ל 2 דקות 1-3. תן 10 מ"ל DMEM אל התאים צנטריפוגות ב 250xg במשך 10 דקות.
  26. הסר בזהירות את המדיום ולתת בינוני 10 מ"ל טרי לתאים, resuspend לספור את התאים.
  27. צלחת של שישה גם אחד מוכר היטב עם 5 2x10, 3x10 5 5 4x10, 5x10 6x10 5 ו - 5 תאים. דגירה את המנה ב 37 ° C ב-CO 2 באינקובטור.
  28. באותו יום לאחר להשתמש גם מפגש עם 50% transfect עם פאק אני מרוכז לעכל. יש לנו ניסיון טוב עם transfection 2000 Lipofectamine, אך גם שיטות אחרות (כגון transfection סידן זרחתי) צריך להיות מתאים.
  29. שנה את בינונית שעות 3-4 היטב לפני transfection כדי לקבל את התאים לתוך גידול מעריכי במהלך ההליך.
  30. מערבבים עם 5 Lipofectamine μl 250 DMEM μl ו דגירה בטמפרטורת החדר למשך 5 דקות.
  31. תן את התערובת Lipofectamine-בינוני ל-DNA (פאק אני לעכל) ומערבבים על ידי הקשה על הצינור תגובה, לא על ידי ערבוב pipetting. דגירה 20 תערובת דקות בטמפרטורת החדר.
  32. זרוק את התערובת transfection לתאי סלע את הצלחת לערבב. לדגור על 37 מעלות צלזיוס עם 5% CO 2. שינוי בינוני לאחר 4-5 שעות.
  33. יומיים לאחר transfection לקחת את המדיום מתאי ולתת אותו לתוך בקבוק תרבות טרי (75 ס"מ 2).
  34. Trypsinize התאים עם טריפסין 500 μl של עד 5 דקות. תן 1 מ"ל DMEM אל התאים, לקחת את התערובת כולה לשים את זה, יחד עם 17 מ"ל בינוני טרי (DMEM עם FCS) לתוך הבקבוק תרבות. טפחו את התאים ב 37 ° C עם CO 2 עד 5% תופעות cytopathic (CPE) יהיו גלויים. ראה איור 2 כדי ללמוד איך CPE אמור להיראות.
  35. איסוף התאים עם המדיום בתוך שפופרת 50 מ"ל ולהקפיא את התאים ב -80 ° C. שוברים את התאים עם שלושה הקפאה / הפשרה מחזורים (-80 ° C/37 ° C אמבט מים).
  36. צנטריפוגה 20 דקות ב 8000xg ו 4 ° C. למזוג supernatant לתוך צלחת בקוטר 100 מ"מ, וזורקים את הכדור. שימוש במסנן סטרילי עם גודל הנקבוביות 0.45μm כדי תסנין supernatant. זהו מלאי וירוס הראשון (קטע 1).
  37. השתמש ב 1 / 3 של מלאי זה transduce בקבוקון 75 ס"מ 2 עם QBI-HEK 293 תאים מפגש עם 70%. לדגור על 37 ° C ו 5% CO 2 עד CPE של גלויות.
  38. אם התאים להראות CPE של לאסוף אותם ולהוציא את הוירוסים כפי שנעשה בעבר. זהו קטע 2 של הנגיף.
  39. חזור על שלבים 2.37 ו 2.38 עם חלוף וירוס 2 וכן הלאה עד הגברה של וירוסים מגיע המניות וירוס מספיק. הווירוס יכול להיות מרוכז עם צינורות צנטריפוגה ספציפי (Amicon Ultra-15 יחידת מסנן צנטריפוגלי עם קרום ultracel 100 מ Millipore) ו מאוחסן במשך מספר חודשים ב -80 ° C. כדי לספור את החלקיקים זיהומיות להשתמש assay פלאק.
  40. שימוש מעבר וירוס 2 ומעלה כדי transduce תאים עבור הגברה נוספת של הנגיף.

3. תא תרבות ראשיים התמרה adenoviral

  1. סטרילי תלושי לכסות עגול בקוטר 20 מ"מ ממוקמים 12 גם צלחות סטנדרטי.
  2. 20 μl פתרון ECM מופץ באופן שווה על להחליק כל כיסוי. שרידי מבוטלים. עבור ייבוש לאפשר מינימום של שעות 1 ב 37 ° C. לחילופין ציפוי יכול מיובש על ידי לילה (12 שעות) בטמפרטורת החדר.
  3. כל טוב מלא בינוני מ"ל 1 M199 עם תוספות הכולל אנטיביוטיקה שלה.
  4. ההשעיה תא (משלב 1.21) של μl 200-400 הוא הוסיף גם כל אחד. Culturing של התאים מתרחשת ב 37 מעלות של 5% CO 2 באינקובטור.
  5. תאים מותר משקעים ואחרי 1 בינוני h משתנה.
  6. מיד לאחר שינוי בינוני כמות נאותה של פתרון המכיל וירוס (מעבר מ 2 או יותר) הוא מעורב ידי מנענעת בעדינות את הצלחת.
  7. במקרה של מדיום לטווח ארוך התרבות משתנה כל 2 ימים.
  8. 24 שעות לאחר הביטוי GEB transfection ניתן לזהות.

4. הדמיה confocal עבור מבנים subcellular 3D ו Ca 2 + איתות

הדמיה Confocal יכול להתבצע על כל confocal מיקרוסקופ. עם זאת, סידן הדמיה ניסויים דורשים מהירות רכישת שיעור לפחות וידאו (25-30 הרץ). זה מגביל טכנולוגיות שמיש לאף סורקים קרן רב (למשל דיסק Nipkow, נסחף שדה או קילו קרן סורק מערך) או סורק מהר מאוד קרן אחת (סורק תהודה למשל או acousto אופטי מטה הטיה (AOD)-סורק). לסקירה לראות שופט. 3. הדמיה 3D-subcellular דורש Z-הכונן. הנה סורק קילו קרן מערך (VTinfinity, VisiTech Int., סנדרלנד, אנגליה) משמש.

  1. המיקרוסקופ וציוד היקפי צריך להיות מוגדר למצב פעולה. במיוחד עבור לייזר זו עשויה לדרוש מתחמם התקופה עד הספק יציב הוא הגיע.
  2. תאים צריכים להיות מועברים לתא ניסיונית (לכסות החלקה ההעברה). Coverslips עם תאים מועברים לתא ניסיונית. 1mL פתרון Tyrode (המכיל 1.8 סידן תאי mM) ואז הוא הוסיף.
  3. תא הניסוי צריך להיות מושם על השלב מיקרוסקופ. אלקטרודות גירוי, זלוף הגדרת ועוד peripheמכשירים RAL, בקרת טמפרטורה למשל, צריכים להיות מסודרים בהתאם.
  4. תאים יהיה ממוקד על נבחרים באמצעות אור לבן ו / או תאורה epifluorescent.
  5. פרמטרים כגון רכישת כוח לייזר, זמן חשיפה וכו 'או פרוטוקול הניסוי כולו צריך להיות הגדרת.
  6. סדרת תמונות זמן ו / או Z-סעיף ניתן לרכוש.
  7. על מדידות multimode הגדרת מתקדמים יותר ניתן לעשות זאת באמצעות electrophysiology (תיקון-clamp) ו / או מניפולציה אופטית כמו חלוקה מחדש הקרינה לאחר photobleach (FRAP) או משחררות רפרוף של חומרים כולל photolysis פוטון השניים.
  8. ניתוח תמונה, במיוחד 3D-השיקום מתבצע על תוכנת ניתוח ייעודיים כגון Imaris (Bitplane AG, ציריך, שוויץ), מהירות (אימפרוביזציה, קובנטרי, בריטניה) או דפדפן Arivis (arivis GmbH, רוסטוק, גרמניה).

5. נציג תוצאות:

התוצאות הסופיות של פרוטוקול הם תמונה sequences כי ניתן להשתמש כדי לחלץ נתונים נוספים.

דוגמה לכך היא חקירה של מבנים האברונים subcellular. איור 3 מתאר את הדוגמה של הסדר 3 מימדי של מנגנוני Golgi. בניגוד במיקרוסקופ אלקטרונים חקירות כל יכול להתבצע על תאים חיים.

איור 1
איור 1: תזרים הכללי של צעדים הניסוי העיקריים.

איור 2
איור 2: תמונה השמאלי מתאר את Q-HEK התאים בתרבית עם confluency 90-95% שאינם transduced. תופעות Cytopatic לאחר התמרה ויראלית מוצגים בחלק הימני. תאים לאסוף ולנתק מהחלק התחתון של הצלחת. בתאים אלה בגרעין התופס את החלק העיקרי של התאים כתוצאה ייצור הווירוס פעיל.

איור 3
איור 3: עכברוש למבוגרים myocyte לב transfected עם חלבון YFP-Fusion מיקוד מנגנון Golgi. Myocytes לב לאחר העברת גנים adenoviral (יום אחד בתרבות) להביע את החלבון היתוך ניאון. לוח מתאר פרוסה confocal יחיד שנלקח מחסנית-z. בלוח ב 'באותו תא מתואר לאחר deconvolution באמצעות נקודה תיאורטית להפיץ פונקציה (כוחות הביטחון הפלסטינים). מחסנית זה דה מטושטשת התמונה לאחר מכן נעשה שימוש כדי להבהיר את התא ולקבל שחזור נפח 3D כפי שמוצג פאנל C או שחזור פני השטח 3D (ד '). בר מייצגת 10 מיקרומטר.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

ההליך המתואר עבור בידוד של עכברוש cardiomyocytes ניתן להתאים מינים אחרים, כגון עכבר 4, במידת הצורך. פרמטר שצריך הסתגלות היא לערבב אנזים לעיכול (ראה להלן), וכן את משך העיכול. שימו לב כי תאים של כמה מינים (עכבר למשל) עשוי להיות שביר יותר מאחרים (למשל חולדה).

הבחירה של collagenase הוא כנראה הצעד החשוב ביותר בהליך בבידוד. אנחנו בוחרים Liberase Blendzyme כי היא תערובת האנזימטית סינתטי עם כמעט ללא אצווה ל-אצווה וריאציות. השיטה המקובלת היא שימוש collagenase גולמי שנקרא מופק Clostridium histolyticum, שגם היא שיטה תקפה. עם זאת, אצווה ל-אצווה וריאציות דורשים אופטימיזציה חדש כל אצווה חדשה.

מלבד חלבונים היתוך ניאון ואת התמרה GEB להעביר את הגן adenoviral יכול לשמש גם לביטוי יתר של חלבונים פונקציונליים או תקנה את שלהם (למשל על ידי RNAi 5). זה נכון כי יעילות גבוהה התמרה (> 95%) ו לשחזור.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgments

עבודה זו נתמכה על ידי הגרמני הקרן הלאומית למדע (DFG) ועל ידי המכון הפדרלי הערכת סיכונים (BFR, גרמניה).

Materials

Name Company Catalog Number Comments
Anesthesia solution Serumwerk Bernburg GmbH (Ursotamin), Bayer Health Care (Rompun) Mixture of 1 ml Ursotamin (100 mg/ml Ketaminhydrochlorid) and 240 μl Rompun (2% Xylazinhydrochlorid)
Citrate solution 117,64 mg sodium citrate in 10 ml 0.9% NaCl solution
Solution A 134 mM NaCl, 4 mM KCl, 11 mM glucose, 1.2 mM MgSO4, 1.2 mM Na2HPO4, 10 mM HEPES, pH adjusted to 7.35 using 10 M NaOH, sterile filtered
Solution A+ Content of solution A plus 0.2 mM EGTA, pH adjusted to 7.35 using 10 M NaOH, sterile filtered
Liberase solution F. Hoffmann‐ La Roche Ltd. 11988476 001 500 μl stock solution in 15 ml solution A (stock solution:10 mg/ml Liberase Blendzyme 4 in aqua dest.)
Solution B Content of solution A plus 200 μM CaCl2 and 0.1% DNase solution
Solution B1/2 1:1 mixture of solution A and solution B
DNase solution Sigma-Aldrich D4527 Deoxyribonuclease I, Type 2 from bovine pancreas, 40 KU (15 mg) are dissolved in 5 ml of 10 mM Tris‐HCl buffer, adjusted to pH=7.35, additional content: 50 mM NaCl, 10 mM MgCl2, 1 mM dithi–rythritol; this solution is mixed with 5 ml glycerol
Extracellular matrix protein (ECM) solution Extracellular matrix protein (ECM) solution E1270 1 ml stock solution as purchased is diluted with 6 mLmedium M199
Culture medium M199 PAA Laboratories E15‐834 Medium M199 supplemented with 1 μl/ml ITS solution and 20 μl/ml penicillin‐streptomycin solution (5000 units/ml)
ITS solution 25 mg Insulin, 25 mg Transferrin and 50 μl Selenite stock solution are dissolved in 5 ml aqua dest. (stock solution: 0.5 mg/ml Sodiumselenite in aqua dest.). Add a few drops of 1 M HCl until one should get a clearsolution. Aliquots can be frozen.
Tyrode 135 mM NaCl, 5.4 mM KCl, 1.8 mM CaCl2, 2mM MgCl2, 10 mM glucose, 10 mM HEPES, pH adjusted to 7.35 using 10 M NaOH, sterile filtered
Master mix 5 μl 10×PCR‐Buffer, 5 μl MgCl2 (25 mM), 2 μl forward primer, 2 μl reverse primer, 1 μl dNTP´s (10 mM each), 33 μl H2O, 1 μl DMSO, 1 μl Taq‐DNA polymerase for each sample
LB‐Medium 10 g/l Tryptone, 5 g/l Yeast extract, 5 g/l NaCl (and 15 g/l Agar if used as solid medium), pH 7.0
Pac I New England Biolabs R0547L preparation: 50 μg DNA, 5 μl 10×buffer, 0.5 μl 100×BSA,0.75 μl Pac I, fill with H2O up to final volume of 50μl

DOWNLOAD MATERIALS LIST

References

  1. Kaestner, L., Ruppenthal, S., S, Molecular Imaging II. Licha, K., Lin, C. P. Vol. 7370, SPIE. Bellingham. 737008-737008 (2009).
  2. Viero, C., Kraushaar, U., Ruppenthal, S. In vivo imaging of Drosophila melanogaster pupae with mesoscopic fluorescence tomography. Cell Calcium. 43, (1), 59-59 (2008).
  3. Shorte, S. L., Frischknecht, F. Imaging Cellular and Molecular Biological Functions. Springer. Berlin Heidelberg. 289-289 (2007).
  4. Kaestner, L., Lipp, P. Optics in Life Science. Popp, J., von Bally, G. Vol. 6633, SPIE. Munich. 66330K-66330K (2007).
  5. Rinne, A., Littwitz, C., Bender, K. Adenovirus-mediated delivery of short hairpin RNA (shRNA) mediates efficient gene silencing in terminally differentiated cardiac myocytes. Methods Mol Biol. 515, 107-107 (2009).
בידוד מניפולציה גנטית של Myocytes לב למבוגרים הדמיה confocal
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Kaestner, L., Scholz, A., Hammer, K., Vecerdea, A., Ruppenthal, S., Lipp, P. Isolation and Genetic Manipulation of Adult Cardiac Myocytes for Confocal Imaging. J. Vis. Exp. (31), e1433, doi:10.3791/1433 (2009).More

Kaestner, L., Scholz, A., Hammer, K., Vecerdea, A., Ruppenthal, S., Lipp, P. Isolation and Genetic Manipulation of Adult Cardiac Myocytes for Confocal Imaging. J. Vis. Exp. (31), e1433, doi:10.3791/1433 (2009).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter