Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

جيل من الحمض النووي الريبي / الحمض النووي DNA في الجينوم الهجائن التي تحول باستخدام الحمض النووي الريبي التي تحتوي على [أليغنوكليوتيد]

doi: 10.3791/2152 Published: November 24, 2010

Summary

هذا العمل يوضح كيفية تكوين الحمض النووي الريبي الهجين / الحمض النووي على مستوى الكروموسومات وتكشف عن نقل المعلومات الوراثية من الحمض النووي الريبي لالجيني في خلايا الخميرة.

Abstract

البوليمرات الاصطناعية قصيرة الحمض النووي ، [أليغنوكليوتيد] (oligos) ، هي أكثر الأدوات الفنية وعلى نطاق واسع في علم الأحياء الجزيئية. يمكن أن تنتج Oligos لاحتواء أي الحمض النووي الريبي أو التسلسل المطلوب ، ويمكن أن تكون على استعداد لتشمل طائفة واسعة من التعديلات الأساسية والسكر. وعلاوة على ذلك ، يمكن أن تكون مصممة لتقليد oligos محددة التعديلات الحمض النووي ، وبالتالي ، يمكن أن تكون بمثابة أدوات مهمة للتحقيق في آثار الحمض النووي من التلف وآليات الإصلاح. وجدنا أن الحرارية العلمية التي تحتوي على الحمض النووي الريبي Dharmacon oligos بطول يتراوح بين 50 و 80 النيوكليوتيدات يمكن مناسبة بشكل خاص للدراسة ، في الوظائف ، والمجراة ونتائج الحمض النووي الريبي الكروموسومات / الهجينة من الحمض النووي وribonucleotides المضمنة في الحمض النووي. يمكن RNA / DNA الهجينة شكل بسهولة خلال إصلاح الحمض النووي ، والنسخ والنسخ ، ومع ذلك ، فإن القليل جدا هو المعروف عن الاستقرار من الحمض النووي الريبي / الحمض النووي في الخلايا الهجينة وإلى أي مدى يمكن أن تؤثر هذه الهجينة سلامة الوراثية للخلايا. المحتوية على الحمض النووي الريبي oligos ، وبالتالي ، تمثل ناقلات مثالية لإدخال الحمض النووي في الكروموزومات ribonucleotides وتوليد RNA / DNA الهجينة طول اختيار وتكوين قاعدة. هنا نقدم بروتوكول لدمج ribonucleotides في جينوم الخميرة نموذج النظام حقيقية النواة / السكيراء الجعوية /. حتى الآن ، استخدمت مختبرنا الحرارية العلمية التي تحتوي على الحمض النووي الريبي Dharmacon oligos لتوليد RNA / DNA الهجينة على مستوى الكروموسومات في الخلية أنظمة مختلفة ، من البكتيريا إلى الخلايا البشرية.

Protocol

المنطق

الاستفادة من استخدام Dharmacon الحرارية oligos العلمية ، من 50 إلى 80 السائدة ، وهنا نقدم الداخلي ، على أساس الجينات مقايسة التصحيح ، التي oligos يمكن نقل المعلومات الوراثية إلى الحمض النووي الجيني للخلايا الخميرة ، وبعد الصلب على الحمض النووي المستهدف الكروموسومات. وأحرز نجاحا استهداف oligos بظهور مستعمرات الخميرة عرض النمط الظاهري هو متوقع. إذا نفذ التعديل المطلوب الجينية داخل واحد أو أكثر ribonucleotides تدرج في التسلسل بنسبة ضئيلة ، وتدفق المعلومات الجينية مباشرة من الجهاز على الحمض النووي الريبي الهدف الكروموسومات ، وبالتالي ، وأشكال RNA / DNA الهجين على مستوى الكروموسومات أثناء عملية الاستهداف. يمكن للريبونوكليوتيد / ثانية من العلم الحرارية بنسبة ضئيلة المحتوية على الحمض النووي الريبي Dharmacon بمثابة قالب لاستهداف الجينات عبر توليف إصلاح الحمض النووي أو يمكن أن تكون جزءا لا يتجزأ في الحمض النووي ويكون بمثابة قالب خلال تكرار الحمض النووي. في هذه التجارب نستخدم الخميرة / السكيراء الجعوية / حقيقية النواة النظام النموذجي ، ولكن يمكن أيضا أن يطبق نهج مماثل في الكائنات الحية الأخرى أو أنواع الخلايا. في هذا الفيديو ، نستخدم العلم الحرارية بنسبة ضئيلة Dharmacon مصممة مع التماثل الجيني لمكان الهدف والخميرة تحتوي على واحد في منتصف ريبونوكليوتيد لتصحيح طفرة في الجين المستهدف. بعد التحول بنسبة ضئيلة مع المحتوية على الحمض النووي الريبي ، نلاحظ تصحيح الموقع المستهدف على تردد معين ، مما يدل على أن من الممكن إدراج المسالك RNA بنسبة ضئيلة من الحمض النووي في الكروموزومات وتكون بمثابة قالب لتخليق الحمض النووي DNA أثناء النسخ المتماثل. تبث ستابلي المعلومات الجينية نفذت داخل المسالك الحمض النووي الريبي للأجيال التالية الخلية. هنا نحن تصف الخطوات للتحول خلية الخميرة من العلم الحرارية بنسبة ضئيلة المحتوية على الحمض النووي الريبي Dharmacon والنهج للكشف عن المعلومات في الحمض النووي الريبي نقل الكروموسومات.

أ. تصميم للأليغو المحتوية على الحمض النووي الريبي المستخدمة في هذه التجربة

وقد صممت لدينا خبير بنسبة ضئيلة المحتوية على الحمض النووي الريبي لتصحيح الخلل الجيني في الخميرة س. الحمض النووي الصبغي الجعوية في مكان الجريمة trp5. سلالة الخميرة المستخدمة في بروتوكول يحتوي على الجينات الطافرة trp5 مع حذف اثنين قاعدة واحدة الطفرة هراء (الشكل 1A). هذه السلالة هي الخميرة متحولة عونية التغذي التربتوفان ولا شكل مستعمرات على وسائل الإعلام دون التربتوفان. تسلسل الحمض النووي للجينات TRP5 يتوفر في قاعدة بيانات الجينوم السكيراء (http://www.yeastgenome.org/). والحرارية العلمية التي تحتوي على الحمض النووي الريبي Dharmacon بنسبة ضئيلة المستخدمة في هذا البروتوكول هو 65 ميه مع الإدراج الحمض النووي 2 - القاعدة ، تهدف إلى تصحيح طفرة الحذف واحد ريبونوكليوتيد مصممة لتصحيح طفرة هراء من أليل trp5 (الشكل 1A). صمم تسلسل بنسبة ضئيلة على النحو التالي :
5' - AAAAGGGTTTTGATGAAGCTGTCG - CG - GATCCCACATTCTG - RG - GAAGACTTCAAATCCTTGTATTCT. ويتم تصنيع هذه جزئية من قبل الحرارية العلمية Dharmacon (لافاييت ، أول أكسيد الكربون) على نطاق واسع نانومتر 200 ، وغير المحلاة ، واستخدامها دون deprotected تنقية PAGE.

باء إعداد أليغو المحتوية على الحمض النووي الريبي لتحويل الخميرة (معدلة من Storici وآخرون ، 2007 1)

  1. مسح المواد التي سيتم استخدامها لهذه التجربة بما في ذلك أنابيب بنسبة ضئيلة ، ماصات ، الدوامة ، ورفوف ، منطقة تجريبية والقفازات التي يرتديها المحقق بمحلول تطهير ريبونوكلياز لإزالة التلوث المحتمل ريبونوكلياز قبل بدء كل شيء. استخدام ريبونوكلياز خالية من المياه ، والكواشف الكيميائية ، ونصائح أنابيب ماصة في جميع الخطوات. وينبغي أن كل خطوة في هذه التجربة أن تكون خالية من ريبونوكلياز.
  2. Resuspend العلمية الحرارية التي تحتوي على الحمض النووي الريبي Dharmacon جزئية وردت من الشركة إلى 250 pmoles / ميكرولتر حل الأسهم مع ريبونوكلياز خالية من المياه ، ودوامة بقوة بحل بيليه. المحل في -80 درجة مئوية.
  3. مباشرة قبل التحول ، وذوبان الجليد والتي تحتوي على الحمض النووي الريبي بنسبة ضئيلة على الجليد وتمييع إلى 50 pmoles / ميكرولتر مع ريبونوكلياز خالية من المياه في ريبونوكلياز خالية من الأنابيب. كل التحول يتطلب 1 nmole من الحمض النووي الريبي التي تحتوي على oligos.
  4. تفسد كمية المختار من الحمض النووي الريبي oligos المحتوية على حرارة 100 درجة مئوية لمدة كتلة 2 دقيقة للقضاء على البنى الثانوية للoligos.
  5. مباشرة بعد وضع أنبوب تمسخ على الجليد. تبقي على الجليد حتى التحول.
  6. كما تحكم في التجربة الحمض النووي فقط يتم استخدام المقابلة بنسبة ضئيلة. هذا هو إذابة بنسبة ضئيلة من -20 درجة مئوية ، وعلى استعداد للتحول بنسبة ضئيلة كما تحتوي على الحمض النووي الريبي ، على النحو المبين أعلاه.

جيم تحويل خلايا الخميرة باستخدام الحمض النووي الريبي أليغو المحتوية

  1. تلقيح 5 مل من السائل YPD الغنية المتوسطة مع خلايا الخميرة trp5 وتنمو متحولة إلى 30 درجة مئوية خلال الليل (انظر المواد).
  2. نقل 1.5 مل من الثقافة بين عشية وضحاها الى 50 مل من السائل YPD المتوسطة.
  3. احتضان خلايا شاكر في 30 درجة مئوية (225 دورة في الدقيقة) ل4H.
  4. إعداد والحل الحل 1 2 IMMediately قبل التحول في ريبونوكلياز خالية من أنابيب (انظر المواد).
  5. نقل ثقافة خلية إلى أنبوب 50 مل ريبونوكلياز خالية وتدور بسرعة 3000 دورة في الدقيقة ، الموافق 1562 غرام ، لمدة 2 دقيقة. وبيليه لهطول الأمطار الخلية تقريبا. 0،3 سم 3.
  6. إزالة الخلايا طاف وتغسل مع 50 مل من الماء الخالي من ريبونوكلياز وتدور بسرعة 3000 دورة في الدقيقة لمدة 2 دقيقة.
  7. كرر الخطوة 6 لمدة 5 مرات للتخلص من ثقافة والمتوسطة RNases التي يمكن أن تكون موجودة في المتوسط ​​إلى أقصى حد ممكن.
  8. إزالة الخلايا وطاف resuspend في 5 مل من محلول (1) وتدور في 3000 دورة في الدقيقة لمدة 2 دقيقة.
  9. إزالة الخلايا وطاف resuspend في 250 ميكرولتر من الحل 1. هذه الكمية من الخلايا غير كافية ل7-8 التحولات.
  10. قسامة 50 ميكرولتر لتعليق خلية في أنابيب microcentrifuge ريبونوكلياز خالية ، إضافة 20 ميكروليتر من الحمض النووي الريبي التي تحتوي على جزئية حل العاملة (1 nmole) ، أو 20 ميكروليتر من محلول الحمض النووي بنسبة ضئيلة فقط تعمل (1 nmole) ، أو 20 ميكروليتر من الماء المعقم مع أي بنسبة ضئيلة للسيطرة سلبية. ثم يضاف 300 ميكرولتر من محلول 2 لكل رد فعل التحول. ليست هناك حاجة لإضافة السلمون الحمض النووي في الحيوانات المنوية في عملية التحول ، كما فعل oligos كناقل أنفسهم.
  11. دوامة بقوة على مزيج متجانس المكونات.
  12. احتضان تفاعلات التحول عند 30 درجة مئوية لمدة 30 دقيقة في شاكر.
  13. الصدمة الحرارية على درجة حرارة 42 درجة مئوية لمدة 15 دقيقة.
  14. تدور أسفل الخلايا في 5000 دورة في الدقيقة ، الموافق 2236 غرام ، لمدة 4 دقائق.
  15. إزالة الخلايا وطاف resuspend في 100 ميكرولتر من الماء المعقم.
  16. يأخذ قسامة من هذا التعليق الخلية وتمييع مع الماء المعقم بواسطة 100000 أضعاف ، وخلايا لوحة لوحة واحدة YPD به تقريبا. 15 الخرز الزجاجي معقمة واحتضان عند 30 درجة مئوية لمدة 2 ايام.
  17. لوحة كافة الخلايا معلق من كل رد فعل التحول على طبق بتري واحدة من المتوسطة الاصطناعية الصلبة كاملة دون التربتوفان (SC - التربتوفان) باستخدام تقريبا. 15 الخرز الزجاجي معقمة واحتضان عند 30 درجة مئوية لمدة 4-5 أيام (الشكل 2).

دال تحليل تصحيح الجينات التي تحتوي على الحمض النووي الريبي أليغو

  1. حساب عدد المستعمرات نمت على انتقائية المتوسطة (الشكل 2) فضلا عن YPD المتوسطة لحساب وتيرة تصحيح الجين بنسبة ضئيلة للالمحتوية على الحمض النووي الريبي ، وبنسبة ضئيلة فقط الحمض النووي للرقابة وعدم بنسبة ضئيلة. قارن عدد الحصول عليها. معدل انعكاس تلقائي للالأليلات trp5 مع اثنين قاعدة الحذف والطفرة هراء أقل من 09/10 في سلالة الخميرة المستخدمة ، وبالتالي فإننا لا نتوقع تشكيل مستعمرات في المتوسط ​​انتقائية عند إضافة أي oligos إلى الخلايا.
  2. مسحة من عدة التقطت بشكل عشوائي على مستعمرات transformant YPD المتوسطة للحصول على عزل مستعمرة واحدة. انتظر يومين لنمو مستعمرة ، ثم تأخذ عدة (ما لا يقل عن 5) مستعمرات واحدة وجعل بقع على YPD والمتوسطة على أساس انتقائي.
  3. تصميم زوج من المشارع لتضخيم المنطقة (250-1،000 بي بي) التي يستهدفها بنسبة ضئيلة المحتوية على الحمض النووي الريبي التي PCR مستعمرة (1B الشكل). إجراء PCR مستعمرة هي على النحو التالي (وتعديلها من Storici ريسنيك ، 2006 2).
    1. خلايا Resuspend (حوالي 1 MM3) المأخوذة من بقع الفردية في 50 ميكرولتر من الماء وإضافة 1 وحدة من lyticase. يحضن في درجة حرارة الغرفة لمدة 10 دقيقة ، تليها الحضانة في كتلة الحرارة عند 100 درجة مئوية لمدة 5 دقائق لكسر الخلايا والحمض النووي الإفراج الجينومية في الحل.
    2. شروط PCR : رد الفعل PCR يضم 10 ميكرولتر من الخلية الحل إعادة تعليق ، 50 pmoles كل من الاشعال إلى الأمام والعكس ، يتم تعديل 1 ميكرولتر من 10 dNTPs ملم ، 1 وحدة من بوليميريز طق ، 5 ميكرولتر من العازلة مع 10x والماء المعقم ل نهائي حجم 50 ميكرولتر. برنامج PCR هو 3 دقائق و 95 في درجة مئوية ، 30 دورات من 30 ثانية الى 95 درجة مئوية ، 30 ثانية عند درجة حرارة 55 مئوية ، و 1 في 72 دقيقة درجة مئوية ؛ وقت التمديد النهائي ل7 دقائق عند 72 درجة مئوية ، ثم العينات يتم الاحتفاظ بها في 4 درجات مئوية. ويفترض تمديد الوقت من 1 دقيقة / كيلو لهذا التفاعل.
    3. PCR التالية ، يتم تشغيل عينات على agarose هلام 1 ٪ أو 2 ٪ (اعتمادا على الحجم المتوقع للمنتج PCR) لمراقبة المنتج PCR (الشكل 3).
  4. إذا كان نقل المعلومات الوراثية من الحمض النووي الريبي التي تحتوي على جزئية بإنشاء موقع قيود جديدة في المنطقة المستهدفة الخميرة الجينوم (1B الشكل) ، فمن الممكن للتحقق من النقل الصحيح للمعلومات من قبل هضم المنتج PCR مع انزيم التقييد المناسب. إذا لم يتم إنشاء موقع التقييد بنسبة ضئيلة من الحمض النووي الريبي التي تحتوي على ، انتقل إلى الخطوة 6. هضم منتجات PCR باستخدام انزيم قيود محددة. رد الفعل الهضم تشمل 6 ميكرولتر من الناتج PCR ، العازلة ، BSA (قد لا تكون هناك حاجة لبعض الانزيمات ، انظر تعليمات للانزيم المستخدمة) ، و 0.5 ميكرولتر من أنزيم التقييد ، والمياه المعقمة إلى 15 ميكرولتر. يتم تحضين العينات لمدة 1 ساعة عند درجة حرارة معينة لانزيم المستخدمة.
  5. تشغيل العينة عسر الهضم مع عينات هضمها في نفس الصف من هلام agarose 2 ٪ لمراقبة نقل التعديل الوراثي بذ المسالك الرنا RNA بنسبة ضئيلة من المحتوية على (الشكل 3).
  6. تنقية المنتجات PCR باستخدام طقم تنقية PCR وإعدادهم لتسلسل الحمض النووي. تقديم عينات للتسلسل مع الاشعال نفسها التي استخدمت لتضخيم المنتج.
  7. تحليل النتائج تسلسل الحمض النووي باستخدام البرمجيات التي تسمح محاذاة سلاسل متعددة مع تسلسل المرجعية المختارة (الشكل 4).

هاء قلوي معالجة جزئية للالمحتوية على الحمض النووي الريبي (الشكل 5)

  1. لكل رد الفعل ، إضافة 1 nmole (4 ميكرولتر من 250 pmoles / ميكرولتر حل سهم) بنسبة ضئيلة من الحمض النووي الريبي التي تحتوي على ، أو بنسبة ضئيلة من الحمض النووي في أنبوب مل 1.5.
  2. إضافة 4 ميكرولتر من هيدروكسيد الصوديوم M 1 لالتحلل ، أو إضافة أو بدلا من 4 ميكرولتر H 2 O ومراقبة سلبية ، واحتضان عند 65 درجة مئوية في حمام ماء لمدة 1 ساعة. ثم ينتقل من حمام الماء إلى جليد.
  3. تحييد مع 2 ميكرولتر من حمض الهيدروكلوريك 1.2 M ، 4 ميكرولتر من ميكرولتر M - تريس حمض الهيدروكلوريك ، و 4 1 من H 2 O ، أو بدلا من 6 ميكرولتر من H 2 O و 4 ميكرولتر من 1 M - تريس حمض الهيدروكلوريك للسيطرة سلبية. تبقي على الجليد حتى التحول.

الشكل 1
الشكل 1. الرسم التخطيطي للجينات معيبة trp5 والأليل TRP5 تصحيح بنسبة ضئيلة من الحمض النووي الريبي التي تحتوي على ألف) والجين الطافر trp5 يحتوي على قاعدة الحذف 2 (مثلثات سوداء) و 1 قاعدة هراء الطفرة (النجمة). وحيد الجديلة التي تحتوي على الحمض النووي الريبي تتحول بنسبة ضئيلة مع 2 قاعدة الإدراج (الأزرق حلقة) و 1 - RNA استبدال قاعدة (أحمر المستطيل) توليد Van91 انزيم التقييد أنا الموقع (الذي أبداه قوس) في خلايا الخميرة لتصحيح عيوب وراثية من الجين trp5. ب) بعد إصلاح الجينات TRP5 بنسبة ضئيلة من الحمض النووي الريبي التي تحتوي على (يشار إلى قواعد المصوبة المستطيلات الأزرق) ، يتم إنشاء موقع الأول في Van91 TRP5 الجينات. 278 ألف سنة مضت بما في ذلك جزء واحد فقط Van91 أنا التقييد في موقع TRP5 الجين هو تضخيم PCR بواسطة زوج من الاشعال (P1 و P2). غليان في 177 و 101 سنة مضت شظايا ولدت بعد هضم P1 و P2 منتج PCR بواسطة Van91 تظهر لي أيضا.

الشكل 2
الشكل 2. نتيجة التحول بنسبة ضئيلة مع المحتوية على الحمض النووي الريبي. A) خلايا الخميرة تحول دون أي بنسبة ضئيلة لا تشكل أي مستعمرة على المتوسط ​​SC - التربتوفان ، انظر لوحات من أساسها. ب) يتم تحويلها لوحات تظهر مستعمرات الخميرة CG المتزايد على SC - التربتوفان بعد الخلايا مع 1 nmole بنسبة ضئيلة من الحمض النووي الريبي التي تحتوي على. ج) يتم تحويلها لوحات تظهر مستعمرات الخميرة HL - SC المتزايد على التربتوفان بعد الخلايا مع 1 nmole من الحمض النووي فقط المناظرة بنسبة ضئيلة السيطرة.

الشكل 3
الشكل 3. الكشف عن نقل المعلومات الوراثية من الحمض النووي الريبي التي تحتوي على الحمض النووي بنسبة ضئيلة الخميرة الكروموسومات التي الهضم تقييد للمنتج PCR تضخيم المنطقة المستهدفة الجينومية 2 ٪ هلام إستشراد agarose عينات تضخيم PCR بواسطة P1 و P2 ويتفاعل مع انزيم Van91 القيد الأول. وأشار الممرات 1 و 8 و 15 ، وسلم الحمض النووي مع أحجام 100 ، 200 ، 300 ، 400 و 500 سنة مضت على اليسار ، 2 لين ، PCR نتاج trp5 موضع تضخيمها من الحمض النووي الجيني لسلالة طافرة trp5 ؛ حارة 3 ، PCR المنتج تضخيمها من الحمض النووي الجينومي المستمدة من مستعمرة + التربتوفان التي يستهدفها بنسبة ضئيلة الحمض النووي فقط ؛ حارة 4-7 ، والمنتجات PCR تضخيمها من الحمض النووي الجينومي المستمدة من مستعمرات + التربتوفان التي يستهدفها بنسبة ضئيلة المحتوية على الحمض النووي الريبي ؛ حارة 9 إلى 14 ، أنا Van91 الهضم تقييد المنتجات PCR من الممرات 2-7. ويمكن تفسير وجود عصابات غير المصقول منتج PCR في الممرات 10-14 قبل الهضم الجزئي Van91 أنا في مكان الجريمة TRP5 (CCACATTCTGG). معتبرا ان موقع القطع لأني Van91 (CCANNNN NTGG) يمكن أن يكون تسلسل متعددة ، قد ولدت في موقع TRP5 لا يكون الهدف الأمثل لهذا الأنزيم. في الواقع ، بعد تسلسل الحمض النووي كل المنتجات المذكورة أعلاه PCR اكتشفنا أي تغييرات إضافية غير تلك التي يحملها oligos (انظر الشكل 4). الفرقة 278 PCR الغليان التي تضخمت P1 و P2 الاشعال ونطاقات المنتج الهضم بواسطة Van91 ترد الأول من غليان 177 و 101 سنة مضت بواسطة الأسهم على اليمين.

الرقم 4Thumb
الشكل 4. نتائج الحمض النووي تظهر التسلسل الجيني لتصحيح جزئية تحتوي على الحمض النووي الريبي. مخطط رحلاني A DNA) في المنطقة التي يستهدفها الجينومية بنسبة ضئيلة المحتوية على الحمض النووي الريبي. مجموعة في تسلسل الحمض النووي (الأزرق محاصر) مستمد من النمو الحقيقي على جزئية تحتوي على الحمض النووي الريبي. كما هو محاصر من قواعد الإدراج CG. تسلسل النتائج من جميع المنتجات PCR الأخرى هي أيضا واضحة مثل هذه واحدة ، مع إشارات الفلورسنت أعلى بكثير من الخلفية. ب) تسلسل المنطقة TRP5 من transfo + التربتوفانتتم مقارنة rmants المستهدفة بنسبة ضئيلة من الحمض النووي فقط (T1) والتي تحتوي على الحمض النووي الريبي بنسبة ضئيلة (T2 - T5) تطابق في الآراء بشأن تسلسل أعلى ومع ان من الخلايا الطافرة trp5 قبل استهداف oligos (DNA الجينوم ، أحمر مظللة). إصلاح الحمض النووي الريبي التي تحتوي على الجزء السفلي بنسبة ضئيلة اثنين من قاعدة الإدراج الحمض النووي واحد قاعدة (G) RNA استبدال باللون الأحمر. في المناطق محاصر في الظل الأزرق مع الأصفر تظهر أن الحمض النووي الريبي التي تحتوي على جزئية وكذلك الحمض النووي بنسبة ضئيلة فقط تصحيح بدقة الطفرة الحذف والتغيير هراء في جميع العينات التي تم اختبارها. خطوط متقطع علامة موقف تسلسل الحمض النووي الريبي المحتوية بنسبة ضئيلة. الرجاء انقر هنا لرؤية نسخة أكبر من الرقم 4.

الشكل 5
الشكل 5. القلوي علاج يمنع تصحيح الجين بنسبة ضئيلة من الحمض النووي الريبي المحتوية. يظهر التردد التحول بنسبة ضئيلة من الحمض النووي الريبي التي تحتوي على (R) في شريط أحمر ، وأنه بحلول جزئية فقط الحمض النووي (د) يظهر في أشرطة زرقاء. أشرطة الخطأ تمثل الخطأ المعياري للمتوسط ​​لمدة 3 التحولات مستقلة لكل جزئية. الحمض النووي فقط بنسبة ضئيلة يعرض مشابهة تحول دون تردد ، وهيدروكسيد الصوديوم مع العلاج. بشكل مختلف ، والتردد التحول بنسبة ضئيلة من الحمض النووي الريبي التي تحتوي على قطرات إلى 0 بعد العلاج مع هيدروكسيد الصوديوم. ولذلك ، لا يتم إعداد الملوثة بنسبة ضئيلة مع الحمض النووي الريبي التي تحتوي على الحمض النووي مع بنسبة ضئيلة من فقط ، وبالتالي ، فإن وتيرة التحول وحظ تقتصر على جزئية تحتوي على الحمض النووي الريبي.

Discussion

تم اكتشاف حقيقة أن الحمض النووي الريبي يمكن نقل المعلومات الوراثية DNA الجينومية مباشرة إلى الخلايا في الاستفادة من استخدام الحمض النووي الريبي oligos المحتوية الاصطناعية (oligos Dharmacon توليفها) 1. وكان هذا دليل على مبدأ أن الخلايا يمكن استخدامها التي تحتوي على جزيئات الحمض النووي الريبي أو تسلسل الحمض النووي الريبي فقط كقوالب لتخليق الحمض النووي. استخدام الحمض النووي الريبي التي تحتوي على oligos لم يؤد فقط إلى المظاهرة التي يمكن نقل المعلومات الوراثية من الحمض النووي الريبي لمباشرة الحمض النووي الجيني دون الحاجة لعكس كتب الحمض النووي نسخة وسيطة ، ولكن أيضا لإثبات أنه يمكن استخدام RNA كقالب مثلي في إصلاح الحمض النووي من التلف من 1،3. يمكن جعل oligos من الحمض النووي الريبي فقط أو تحتوي على مجرد ريبونوكليوتيد احد مضمن في تسلسل الحمض النووي ، كما في المثال قدمنا ​​هنا. والمحتوية على الحمض النووي الريبي بنسبة ضئيلة واحد ريبونوكليوتيد جزءا لا يتجزأ من تصميم لتصحيح طفرة هراء في أليل trp5 معيبة الجيني. وكشفت عن نقل المعلومات الوراثية من الحمض النووي لريبونوكليوتيد الجينومية عن تغيير في النمط الظاهري (الخلية تنمو على المدى المتوسط ​​تفتقر التربتوفان) من الخلايا المستهدفة. ويقاس تردد تصحيح الجينات التي تم الحصول عليها مع جزئية تحتوي على الحمض النووي الريبي ، وذلك بالمقارنة مع من الحمض النووي فقط السيطرة بنسبة ضئيلة. قبل تنفيذ هذا الاختبار تصحيح الجينات في الخلية خلفيات مختلفة ، حيث أننا تحور جينات الخميرة مختلفة ، يمكننا الكشف عن أي عامل / ثانية تؤثر على وجه التحديد استهداف oligos المحتوية على الحمض النووي الريبي. وبالتالي ، لا يمكننا الكشف عن آليات كيفية خلايا تنظيم استقرار RNA / DNA الهجينة. ببساطة عن طريق تصميم أنواع مختلفة من الحمض النووي الريبي oligos المحتوية يمكننا تحديد احتمال لالمسالك RNA خاص ليكون بمثابة القالب في تعديل الحمض النووي ويمكننا تحديد تسلسل الحمض النووي الريبي استقرار محددة المضمنة في الحمض النووي. وعلاوة على ذلك ، يمكننا تحديد ما هي المفضلة في الجسم الحي لعوامل ركائز التفاعل مع الحمض النووي الريبي / الهجينة الحمض النووي.

في حين أجريت دراسات عدة في المختبر ، وذلك باستخدام الحمض النووي الريبي أساسا قصيرة تحتوي على oligos ، لتوصيف وظيفة من العوامل التي يمكن التعرف على الحمض النووي الريبي في مختلطة مع الحمض النووي ، مثل الانزيمات H ريبونوكلياز 4 ، في وظائف الجسم الحي من H فضلا RNases كهوية من البروتينات الأخرى التي يمكن أن تؤثر على الحمض النووي الريبي / DNA الاستقرار الهجينة لا تزال مجهولة في معظمها. إمكانية الاستفادة من الحمض النووي الريبي التي تحتوي على oligos بطول كبيرة (50 إلى 80 السائدة) وجودة أفضل (مثل الحمض النووي الريبي oligos المحتوية الحرارية العلمية Dharmacon) قد يفتح الطريق لدراسة طائفة واسعة من العمليات الجزيئية مباشرة في الجسم الحي في خلايا الفائدة. كما هو مبين في هذا التحول ، والفيديو باستخدام الحمض النووي الريبي التي تحتوي على oligos يتطلب أساسا سوى بضع خطوات إضافية بالمقارنة مع التحول باستخدام جزيئات الحمض النووي ، لمنع تدهور بواسطة RNases. وبالتالي ، يمكن تطبيق التحويل باستخدام الحمض النووي الريبي التي تحتوي على oligos لا يقتصر على نظام الخميرة ، ولكن إلى أي نوع من الخلايا أو الكائن الحي حيث تحول بواسطة الحمض النووي oligos متمكنا.

في الختام ، واستهداف الخلايا التي تحتوي على الحمض النووي الريبي oligos يتيح الفرصة لتوليد RNA / DNA الهجينة وribonucleotides المضمنة في الحمض النووي في الجسم الحي في الخلايا. الاستقرار والوظيفة وعواقب هذه في الجسم الحي ولدت رنا / يمكن تحليل الحمض النووي الهجينة ، وتميزت ، من المحتمل الكشف عن آليات غير معروف من إصلاح الحمض النووي والكشف عن استراتيجيات جديدة لاستهداف الجينات.

Disclosures

وقد رعت إنتاج الفيديو لهذه المادة الحرارية فيشر العلمية ، التي تنتج الكواشف والأداة المستخدمة في هذا المنشور.

Acknowledgments

وأيد هذا العمل من جانب التحالف لمكافحة السرطان جورجيا المنح R9028.

Materials

A. Transformation reagents and media (modified from Storici and Resnick, 2006

  1. YPD (Yeast Peptone Dextrose): For 1 L, 10 g yeast extract, 20 g soy peptone, 20 g dextrose. Add 15 g agar to make YPD solid media. Autoclave before use. Store at room temperature.
  2. Solution 1: 0.1 M of lithium acetate. Prepare immediately before transformation. Solution 1 is a working solution, thus it is prepared directly from the powder. No stock solution is made. Keep at room temperature. LiAc increases the yeast cell wall permeability to DNA.
  3. Solution 2: 0.1 M of lithium acetate and 50 % of polyethylene glycol 4000. Also solution 2 is a working solution and it is made directly from the powder. No stock solution is prepared. Keep at room temperature. PEG deposits oligos onto yeast cells.
  4. RNA-containing oligos (Thermo Scientific Dharmacon), 50-80-mers, desalted, deprotected and non-purified. Resuspend to 250 pmoles/μl. Store at -80 °C.
  5. DNA-only oligos, 50-80-mers, desalted and non-purified. Resuspend to 50 pmoles/μl. Store at -20 °C.
  6. SC-Trp (Synthetic complete media lacking tryptophan) solid media.
  7. 0.5 cm diameter glass beads, sterilized by autoclaving.
  8. RNase-off: RNase decontamination solution.
  9. DNase/RNase-free, sterile centrifuge tubes.
  10. DNase/RNase-free, sterile conical tubes.
  11. DNase/RNase-free, sterile aerosol pipette tips with ZAP: 1-200 ml, 100-1000 ml.

B. Colony PCR materials.

  1. DNA primers, desalted and non-purified. Dissolve in sterile water to 50 pmoles/μl. Store at -20 °C.
  2. Taq DNA polymerase, buffer, dNTPs.
  3. PCR tubes.

C. PCR purification.

  1. PCR purification kit.

D. Gel Electrophoresis.

  1. Agarose.
  2. 1 x TBE running buffer (45 mM Tris-borate and 1 mM ethylenediamine tetraacetate) diluted from 10x TBE.
  3. Prestained molecular weight marker.
  4. DNA loading dye.

E. Restriction digestion.

  1. Restriction enzymes, 10x buffers, BSA.

F. Alkali treatment for the RNA-containing oligo.

  1. 1 M of NaOH solution.
  2. 1.2 M of HCl solution.
  3. 1 M of Tris-HCl, pH 7.4 solution.

DOWNLOAD MATERIALS LIST

References

  1. Storici, F., Bebenek, K., Kunkel, T. A., Gordenin, D. A., Resnick, M. A. RNA-templated DNA repair. Nature. 447, 338-3341 (2007).
  2. Storici, F., Resnick, M. The delitto perfetto approach to in vivo site-directed mutagenesis and chromosome rearrangements with synthetic oligonucleotides in yeast. Methods Enzymol. 409, 329-345 (2006).
  3. Storici, F. RNA-mediated DNA modifications and RNA-templated DNA repair. Curr Opin Mol Ther. 10, 224-230 (2008).
  4. Cerritelli, S. M., Crouch, R. J. Ribonuclease H: the enzymes in eukaryotes. FEBS J. 276, 1494-1505 (2009).
جيل من الحمض النووي الريبي / الحمض النووي DNA في الجينوم الهجائن التي تحول باستخدام الحمض النووي الريبي التي تحتوي على [أليغنوكليوتيد]
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Shen, Y., Storici, F. Generation of RNA/DNA Hybrids in Genomic DNA by Transformation using RNA-containing Oligonucleotides. J. Vis. Exp. (45), e2152, doi:10.3791/2152 (2010).More

Shen, Y., Storici, F. Generation of RNA/DNA Hybrids in Genomic DNA by Transformation using RNA-containing Oligonucleotides. J. Vis. Exp. (45), e2152, doi:10.3791/2152 (2010).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter