ERRATUM NOTICE
Important: There has been an erratum issued for this article. Read more …
Abstract
??? ?? ??? ??? ??? ? (SCC MEC) ??? ?? ? ????? ???? ?? ?? MRSA (CA-MRSA)? ??? ????, ?? ?? ?? ?? ??? ?? (MRSA)? ??? ?? ?? ?? ?? ???? ?? ??? ?? ?????. ?? PCR? ?? ??? ?? MEC? CCR ???? ??? ??? ????? ???? SCC MEC? ?????, ?? ???? ?? ? ?? ?? PCR ??? ??? ??????. ??? ?? ? ?? SCC MEC ?? ? V? ?? I? ???? ??? ?? ??? ?? ??? PCR ??? ????, ??? ?? ??? ????? ??? ?????????. ? ??? ??? ??? ???? ?? SCC ? ??? ???? ???? ?? ????? ? ????? ??????. ???, ??? NAT? ????? ??? ???? ????? ? ??? URE? ??? ?? ???? ??? ?? ?? ???? ????. , MRSA SCC ? ??? ???? ??? ?? ???? ??? ??? ?? ??? PCR ??? ???? ??? ?????, ??? ????? ??? ??? ?? ? ?? ???? ??? ?????.
Introduction
?? ?? ?? ?? ??? ?? (MRSA)? ?? 21-67 - KB ??? ?? ? ??? ?? ????, ?? ?? ?? (MECA) ??? ? ?? ??? ?? ?? 1 ?? ??? ?? ??? ??? ? (SCC MEC)? ?? . SCC MEC? ??? ?? ??? ??, ? ?? ??? ?? ? ?? ?? (MEC ??? ???? CCR ??? ???) ? J-?? (?? 1)? ??? ?? ?????. CCR ??? ?????? SCC MEC? ??? ?? recombinases (CCR / ccrAB)? ? ??? ????? ?? ? ??? ???, 431mec ??, ?? ??? mecR1 ? MECI? ???? ?? ?? IS? ???? ???? ?? ?? ??? 1. ?? ? ?? ??? ? ?? ??? (mecB MECC)? ?? ??? 2?? ??? ?? ??? ???? ?? ???. SCC MEC ??? ???? ?? CCR ?? ??? ??? ??? ??? ??? ?? ??? ???? J ?? (J1, J2, J3?)? ???? ????. ?? ?? ? ??? ??? (? : ??, B, C, D ? E) ? CCR ?? allotypes (? : 1-8 ?)? ????. ??? ??? ???? allotypes? ?? ??? ??? SCC ? ??? ?????. SCC MEC ?? ? ??? ?? ??? ??? ?? (IWG-SCC)? ??? ?? ?? ?? ???? ?? ??? ?? SCC ? ??? ?? CCR ??? ???? ??? ?? ???? ???? ??????? ??? J ?? DNA 1? ??? ?? ?? ???? ??. MRSA??? ????? ?? multilocus ??? ?? (ST) ? / ?? ??? ?? ??? ??? (SPA)? ?? (? : ST8 ? (??? / ??) ?? ?? ?? ??? ?? ????? ?? SCC ? ??? ?? ?? ??? ?? ????? -T008-MRSA-IVa?). ??? SCC ? ??? ?? ? ????? ???? ?? ?? MRSA (CA-MRSA)? ??? ????, MRSA? ??? ?? ?? ?? ?? ???? ?? ??? ?? ?????.
?? PCR? ?? ??? ?? MEC? CCR ???? ??? ??? ????? ???? SCC MEC? ?????, ??? ?? (20 ~ 30) ???? ?? ? ?? ?? PCR ??? ?????. ??? ??. ?? ??, 21 ???? ? SCC MEC I-IVB 3? ?? ?? ?? ?? PCR ??? ????. ?? ?. subsequently CCR, MEC, ??? J-??? ?? ???? ??????? ??? ??? ???? ??? ???? ?? PCR ?? 4? ? ??? ????. SCC ?? ??? ????? ??, ?? ??? PCR (M-PCR) ??? ??? ?? PCR ???? ?? ? ? ??? ?????. ? Lencastre? ??? SCC MEC I-IV? ?? ???? M-PCR? ????, ??? SCC ? IV? ?? 5,6,7? ?????? ??? M-PCR?, SCC ? IV? ?? ?????????. ??? ??? ??? ? SCC ? IV ??? ???? ?? 2 ?? ??? ???? ???, ?? ? typeable ??? ?????. SCC ? ???? ???? ??, ??? ?? ? ?? SCC MEC? ??? V 8 ??? I? ???? ??? ?? ??? ?? ??? PCR ??? ????, ??? ??? ??? ??? B? ??????? 9 ecame. ? ??? ??? ??? ???? ?? SCC ? ??? ???? ???? ??, ????? (SCOPUS?? 337, 2013? 1? 30? ????) ? ????? ??????. ?? ?? ??, ??? ??? ?? MRSA SCC MEC ???? ????? ??? ?? ???? ?? ?? ??? ?????. ??? ??? ???? ????? ??? ??? ???? ?? ??? ?? ???? ??? ?? ?? ???? ????. MRSA SCC ? ??? ???? ??? ?????? ??, ??? ?? SCC MEC ????? M-PCR?? ???, ??? ????? ??? ??? ?? ? ?? ???? ??? ??? ???? ??? ????? ????.
Subscription Required. Please recommend JoVE to your librarian.
Protocol
??? ??? ?? ??? ??? ??? ????? ???????. ??? ??? ? ??? ?? ?? ??? ?? ???????.
1. ?? ??
- MRSA? ??? ??? ???? ??? ?????. PCR? ?????? ???, ?? ?? ???? MRSA? ?? ???? ???? ??? ?? ?? (TSA) ??? ????? ??? ??? ?????. ??? ??? ??? ??? ?? ? ? ????. 37 ?? ??
Subscription Required. Please recommend JoVE to your librarian.
Materials
Name | Company | Catalog Number | Comments |
Tryptic Soy Agar | Fisher (BD) | CA90002-700 (236920) | |
Sterile distilled water | Life Technologies | 10977-015 | |
Platinum Taq: including 10x PCR buffer and 50 mM MgCl2 | Life Technologies | 10966-034 | |
100 mM dNTP | Life Technologies | 10297-018 | |
Tris base | Sigma-Aldrich | T6066 | |
Boric acid | Sigma-Aldrich | B7901 | |
EDTA | Life Technologies | 15576-028 | |
Agarose | Life Technologies | 16500-500 | |
Glycerol | Life Technologies | 15514-011 | |
Bromophenol blue | Sigma-Aldrich | B8026 | |
1Kb+ DNA ladder | Life Technologies | 10787-026 | |
Ethidium bromide | Sigma-Aldrich | E7637 | |
1.5ml Microcentrifuge tubes | VWR (Axygen Scientific) | 10011-700 | |
Culture sticks | VWR | CA10805-018 | |
PCR tubes | Diamed | AD0210-FCN (new #: DIATEC420-1250) | |
Centrifuge | Eppendorf | 5417c | |
Heat block | VWR | 13259-030 / 13259-286 | |
Thermalcycler | Applied Biosystems (2720) | 4359659 | |
Horizontal, submersible gel electrophoresis chamber with gel mold | BioRad | 170-4469 | |
Power supply | BioRad | 164-5050 | |
Rocker shaker | VWR | 40000-300 | |
Molecular Imager Gel Doc System | BioRad | 1708170 |
References
- IWG-SCC. Classification of staphylococcal cassette chromosome mec (SCCmec): guidelines for reporting novel SCCmec elements. Antimicrobial Agents and Chemotherapy. 53 (12), 4961-4967 (2009).
- Ito, T., Hiramatsu, K., Tomasz, A., de Lencastre, H., Perreten, V., Holden, M., et al. Guidelines for Reporting Novel mecA Gene Homologues. Antimicrobial Agents and Chemotherapy. 56 (10), 4997-4999 (2012).
- Okuma, K., Iwakawa, K., Turnidge, J. D., Grubb, W. B., Bell, J. M., O'Brien, F. G., et al. Dissemination of new methicillin-resistant Staphylococcus aureus clones in the community. Journal of Clinical Microbiology. 40 (11), 4289-4294 (2002).
- Kondo, Y., Ito, T., Ma, X. X., Watanabe, S., Kreiswirth, B. N., Etienne, J., et al. Combination of multiplex PCRs for staphylococcal cassette chromosome mec type assignment: rapid identification system for mec, ccr, and major differences in junkyard regions. Antimicrobial Agents and Chemotherapy. 51 (1), 264-274 (2007).
- Oliveira, D. C., de Lencastre, H. Multiplex PCR strategy for rapid identification of structural types and variants of the mec element in methicillin-resistant Staphylococcus aureus. Antimicrobial Agents and Chemotherapy. 46 (7), 2155-2161 (2002).
- Milheirico, C., Oliveira, D. C., de Lencastre, H. Update to the multiplex PCR strategy for assignment of mec element types in Staphylococcus aureus. Antimicrobial Agents and Chemotherapy. 51 (9), 3374-3377 (2007).
- Milheirico, C., Oliveira, D. C., de Lencastre, H. Multiplex PCR strategy for subtyping the staphylococcal cassette chromosome mec type IV in methicillin-resistant Staphylococcus aureus: 'SCCmec IV multiplex'. Journal of Antimicrobial Chemotherapy. 60 (1), 42-48 (2007).
- Zhang, K., McClure, J. A., Elsayed, S., Louie, T., Conly, J. M. Novel multiplex PCR assay for characterization and concomitant subtyping of staphylococcal cassette chromosome mec types I to V in methicillin-resistant Staphylococcus aureus. Journal of Clinical Microbiology. 43 (10), 5026-5033 (2005).
- Zhang, K., McClure, J. A., Conly, J. M. Enhanced multiplex PCR assay for typing of staphylococcal cassette chromosome mec types I to V in methicillin-resistant Staphylococcus aureus. Molecular and Cellular Probes. 26 (5), 218-221 (2012).
- de Lamballerie, X., Zandotti, C., Vignoli, C., Bollet, C., de Micco, P. A one-step microbial DNA extraction method using "Chelex 100" suitable for gene amplification. Research in Microbiology. 143 (8), 785-790 (1992).
- Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. Agarose gel electrophoresis for the separation of DNA fragments. J. Vis. Exp. (62), e3923 (2012).
- McClure, J. A., Conly, J. M., Elsayed, S., Zhang, K. Multiplex PCR assay to facilitate identification of the recently described Staphylococcal cassette chromosome mec type VIII. Molecular and Cellular Probes. 24 (4), 229-232 (2010).
- Zhang, K., McClure, J. A., Elsayed, S., Conly, J. M. Novel staphylococcal cassette chromosome mec type, tentatively designated type VIII, harboring class A mec and type 4 ccr gene complexes in a Canadian epidemic strain of methicillin-resistant Staphylococcus aureus. Antimicrobial Agents and Chemotherapy. 53 (2), 531-540 (2009).
Erratum
Formal Correction: Erratum: Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus
Posted by JoVE Editors on 03/19/2019.
Citeable Link.
An erratum was issued for: Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus. There was a typo in Table 1.
In Table 1, the Oligonucleotide sequence for Type III-F5 was updated from:
TTCTCATTGATGCTGAAGCC
To:
GAAACTAGTTATTTCCAACGG