Materials
Name | Company | Catalog Number | Comments |
pCX-OKS-2A pDNA | Addgene | 19771 | Obtained from Addgene as bacterial stab, plasmid production performed in Plasmid Factory (Germany) |
pCX-cMyc | Addgene | 19772 | Obtained from Addgene as bacterial stab, plasmid production performed in Plasmid Factory (Germany) |
0.22 μm filter | Milliopore | SLGP033RS | |
Isoflurane | Abbott | B505 | |
HBSS buffer | Sigma-Aldrich | H6648 | Ca2+ and Mg2+ free, with bicarbonate |
Liver Digest Medium | Gibco | 17703-034 | |
Hepatocyte Wash Medium | Gibco | 17704-024 | |
100 μm cell strainer | BD Biosciences | 352360 | |
Nucleospin RNA II kit | Macherey-Nagel | 740955.25 | Kit for RNA isolation from cells and tissues |
iScript cDNA synthesis kit | Bio-Rad | 170-8890 | |
iO SYBR Green Supermix | Bio-Rad | 170-8880 | |
Oct3/4 forward primer | Sigma | sequence given in comments | TGAGAACCTTCAGGAGATATGCAA |
Oct3/4 reverse primer | Sigma | sequence given in comments | CTCAATGCTAGTTCGCTTTCTCTTC |
Sox2 forward primer | Sigma | sequence given in comments | GGTTACCTCTTCCTCCCACTCCAG |
Sox2 reverse primer | Sigma | sequence given in comments | TCACATGTGCGACAGGGGCAG |
C-myc forward primer | Sigma | sequence given in comments | CAGAGGAGGAACGAGCTGAAGCGC |
C-myc reverse primer | Sigma | sequence given in comments | TTATGCACCAGAGTTTCGAAGCTGTTCG |
Nanog forward primer | Sigma | sequence given in comments | CAGAAAAACCAGTGGTTGAAGACTAG |
Nanog reverse primer | Sigma | sequence given in comments | GCAATGGATGCTGGGATACTC |
Ecat1 forward primer | Sigma | sequence given in comments | TGTGGGGCCCTGAAAGGCGAGCTGAGAT |
Ecat1 reverse primer | Sigma | sequence given in comments | ATGGGCCGCCATACGACGACGCTCAACT |
Rex1 forward primer | Sigma | sequence given in comments | ACGAGTGGCAGTTTCTTCTTGGGA |
Rex1 reverse primer | Sigma | sequence given in comments | TATGACTCACTTCCAGGGGGCACT |
Alb forward primer | Sigma | sequence given in comments | GTTCGCTACACCCAGAAAGC |
Alb reverse primer | Sigma | sequence given in comments | CCACACAAGGCAGTCTCTGA |
Aat forward primer | Sigma | sequence given in comments | CAGAGGAGGCCAAGAAAGTG |
Aat reverse primer | Sigma | sequence given in comments | ATGGACAGTCTGGGGAAGTG |
Trf forward primer | Sigma | sequence given in comments | ACCATGTTGTGGTCTCACGA |
Trf reverse primer | Sigma | sequence given in comments | ACAGAAGGTCCTTGGTGGTG |
B actin forward primer | Sigma | sequence given in comments | GACCTCTATGCCAACACAGT |
B actin reverse primer | Sigma | sequence given in comments | AGTACTTGCGCTCAGGAGGA |
BD Cytofix fixation buffer | BD Biosciences | 560585 | |
1x BD Perm/Wash buffer | BD Biosciences | 560585 | |
anti-mouse OCT4-PerCP-Cy5.5 | BD Biosciences | 560585 | |
anti-mouse Nanog-PE | BD Biosciences | 560585 | |
2-Methylbutane | Sigma-Aldrich | M32631 | |
X100-Triton | Sigma-Aldrich | X100-500ML | |
Goat serum | Sigma-Aldrich | G9023 | |
BSA | Sigma | A2153 | |
rabbit pAb anti-OCT4 | Abcam | ab19857 | Use at a concentration of 3 μg/ml |
rabbit pAb anti-SOX2 | Abcam | ab97959 | Use at a concentration of 1 μg/ml |
rabbit pAb anti-Nanog | Abcam | ab80892 | Use at a concentration of 1 μg/ml |
mouse mAb anti-SSEA1 | Abcam | ab16285 | Use at a concentration of 20 μg/ml |
goat pAb anti-rabbit IgG labeled with Cy3 | Jackson ImmunoResearch Laboratories Inc. | 111-165-003-JIR | Use at a concentration of 1/250 |
goat pAb anti-mouse IgG labeled with Cy3 | Jackson ImmunoResearch Laboratories Inc. | 115-165-003-JIR | Use at a concentration of 1/250 |
VECTASHIELD mounting medium with DAPI | Vector Laboratories | H-1200 | |
BCIP/NBT liquid substrate system | Sigma | B1911 | |
Aqueous mounting medium | Sigma | ||
16% Paraformaldehyde | Fisher | AA433689M | Stock solution is 16%, use it at 4% |
Hematoxylin and eosin | Sigma | GH53/HT110216 | |
PAS staining | Sigma | 395B |
References
- Blelloch, R., Venere, M., Yen, J., Ramalho-Santos, M. Generation Of Induced Pluripotent Stem Cells In The Absence Of Drug Selection. Cell Stem Cell. 1, 245-247 (2007).
- Stadtfeld, M., Nagaya, M., Utikal, J., Weir, G., Hochedlinger, K. Induced Pluripotent Stem Cells Generated Without Viral Integration. Science. 322, 945-949 (2008).
- Takahashi, K., et al. Induction Of Pluripotent Stem Cells From Adult Human Fibroblasts By Defined Factors. Cell. 131, 861-872 (2007).
- Takahashi, K., Yamanaka, S. Induction Of Pluripotent Stem Cells From Mouse Embryonic And Adult Fibroblast Cultures By Defined Factors. Cell. 126, 663-676 (2006).
- Yu, J., et al. Induced Pluripotent Stem Cell Lines Derived From Human Somatic Cells. Science. 318, 1917-1920 (2007).
- Gonzalez, F., et al. Generation Of Mouse-Induced Pluripotent Stem Cells By Transient Expression Of A Single Nonviral Polycistronic Vector. Proc. Natl. Acad. Sci. U.S.A. 106, 8918-8922 (2009).
- Okita, K., Nakagawa, M., Hyenjong, H., Ichisaka, T., Yamanaka, S. Generation Of Mouse Induced Pluripotent Stem Cells Without Viral Vectors. Science. 322, 949-953 (2008).
- Woltjen, K., et al. Piggybac Transposition Reprograms Fibroblasts To Induced Pluripotent Stem Cells. Nature. 458, 766-770 (2009).
- Yusa, K., Rad, R., Takeda, J., Bradley, A. Generation Of Transgene-Free Induced Pluripotent Mouse Stem Cells By The Piggybac Transposon. Nat. Meth. 6, 363-369 (2009).
- Warren, L., et al. Highly Efficient Reprogramming To Pluripotency And Directed Differentiation Of Human Cells With Synthetic Modified Mrna. Cell Stem Cell. 7, 618-630 (2010).
- Kim, D., et al. Generation Of Human Induced Pluripotent Stem Cells By Direct Delivery Of Reprogramming Proteins. Cell Stem Cell. 4, 472-476 (2009).
- Zhou, H., et al. Generation Of Induced Pluripotent Stem Cells Using Recombinant Proteins. Cell Stem Cell. 4, 381-384 (2009).
- Anokye-Danso, F., et al. Highly Efficient Mirna-Mediated Reprogramming Of Mouse And Human Somatic Cells To Pluripotency. Cell Stem Cell. 8, 376-388 (2011).
- Lin, S. -L., et al. Regulation Of Somatic Cell Reprogramming Through Inducible Mir-302 Expression. Nucleic Acids Res. , (2011).
- Miyoshi, N., et al. Reprogramming Of Mouse And Human Cells To Pluripotency Using Mature Micrornas. Cell Stem Cell. 8, 633-638 (2011).
- Subramanyam, D., et al. Multiple Targets Of Mir-302 And Mir-372 Promote Reprogramming Of Human Fibroblasts To Induced Pluripotent Stem Cells. Nat. Biotechnol. 29, 443-448 (2011).
- Dolgin, E. Flaw In Induced-Stem-Cell Model. Nature. 470, 13 (2011).
- Miura, K., et al. Variation In The Safety Of Induced Pluripotent Stem Cell Lines. Nat. Biotech. 27, 743-745 (2009).
- Pera, M. The Dark Side Of Pluripotency. Nature. 471, 46-47 (2011).
- Saha, K., Jaenisch, R. Technical Challenges In Using Human Induced Pluripotent Stem Cells To Model Disease. Cell Stem Cell. 5, 584-595 (2009).
- Okita, K., Ichisaka, T., Yamanaka, S. Generation Of Germline-Competent Induced Pluripotent Stem Cells. Nature. 448, 313-317 (2007).
- Varas, F., et al. Fibroblast-Derived Induced Pluripotent Stem Cells Show No Common Retroviral Vector Insertions. Stem Cells. 27, 300-306 (2009).
- Jia, F., et al. A Nonviral Minicircle Vector For Deriving Human Ips Cells. Nat. Meth. 7, 197-199 (2010).
- Gonzalez, F., Boue, S., Belmonte, J. C. I. Methods For Making Induced Pluripotent Stem Cells: Reprogramming A La. Nat. Rev. Genet. 12, 231-242 (2011).
- Stadtfeld, M., Hochedlinger, K. Induced Pluripotency: History, Mechanisms, And Applications. Genes Dev. 24, 2239-2263 (2011).
- Gore, A., et al. Somatic Coding Mutations In Human Induced Pluripotent Stem Cells. Nature. 471, 63-67 (2011).
- Hussein, S. M., et al. Copy Number Variation And Selection During Reprogramming To Pluripotency. Nature. 471, 58-62 (2011).
- Lister, R., et al. Hotspots Of Aberrant Epigenomic Reprogramming In Human Induced Pluripotent Stem Cells. Nature. 471, 68-73 (2011).
- Yilmazer, A., De Lázaro, I., Bussy, C., Kostarelos, K. In Vivo Cell Reprogramming Towards Pluripotency By Virus-Free Overexpression Of Defined Factors. Plos One. 8, (2013).
- Liu, F., Song, Y. K., Liu, D. Hydrodynamics-Based Transfection In Animals By Systemic Administration Of Plasmid Dna. Gene Ther. 6, 1258-1266 (1999).
- Zhang, G., Budker, V., Wolff, J. A. High Levels Of Foreign Gene Expression In Hepatocytes After Tail Vein Injections Of Naked Plasmid Dna. Hum. Gene. Ther. 10, 1735-1737 (1999).
- Yamanaka, S. Induced Pluripotent Stem Cells: Past, Present, And Future. Cell Stem Cell. 10, 678-684 (2012).
- Therapy Giacca, M. G. ene , Springer. (2010).
- Colella, P., Auricchio, A. Aav-Mediated Gene Supply For Treatment Of Degenerative And Neovascular Retinal Diseases. Curr. Gene Ther. 10, 371-380 (2010).
- Dayton, R. D., Wang, D. B., Klein, R. L. The Advent Of Aav9 Expands Applications For Brain And Spinal Cord Gene Delivery. Expert Opin. Biol. Ther. 12, 757-766 (2012).
- Mccown, T. J. Adeno-Associated Virus (Aav) Vectors In The Cns. Curr. Gene Ther. 11, 181-188 (2011).
- Vandenberghe, L. H., Auricchio, A. Novel Adeno-Associated Viral Vectors For Retinal Gene Therapy. Gene Ther. 19, 162-168 (2012).
- Herweijer, H., Wolff, J. A. Progress And Prospects: Naked Dna Gene Transfer And Therapy. Gene Ther. 10, 453-458 (2003).
- Wolff, J. A., Budker, V. The Mechanism Of Naked Dna Uptake And Expression. Adv. Genet. 54, 3-20 (2005).