Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Aislamiento a base de afinidad de Tagged Núcleos de doi: 10.3791/51418 Published: March 25, 2014

Summary

Tejidos de Drosophila a menudo contienen una mezcla heterogénea de tipos celulares. Para examinar la expresión génica en tipos de células específicas de un tejido particular, los núcleos pueden ser etiquetados genéticamente y aislados posteriormente utilizando un enfoque basado en la afinidad. Núcleos aislados se pueden utilizar para aplicaciones posteriores tales como análisis de la expresión génica y la inmunoprecipitación de la cromatina.

Abstract

Tejidos de embriones y larvas de Drosophila melanogaster a menudo contienen una mezcla altamente heterogénea de tipos de células, lo que puede complicar el análisis de la expresión génica en estos tejidos. Por lo tanto, para analizar los perfiles de expresión de genes específicos de células de tejidos de Drosophila, puede ser necesario aislar los tipos de células específicas con alta pureza y con rendimientos suficientes para aplicaciones posteriores tales como el perfil transcripcional y de inmunoprecipitación de la cromatina. Sin embargo, la morfología celular irregular en tejidos tales como el sistema nervioso central, junto con la población rara de tipos específicos de células en estos tejidos, puede plantear problemas para los métodos tradicionales de aislamiento de células, tales como la microdisección láser y de células activadas por fluorescencia (FACS) . Aquí, un enfoque alternativo para la caracterización de los perfiles de expresión de genes específicos de células usando el aislamiento basado en la afinidad de los núcleos marcados, en lugar de células completas, se describe. Núcleos de la c específicaTipo de interés ell están etiquetados genéticamente con un sobre-localizada etiqueta EGFP nuclear utilizando el sistema de expresión binaria Gal4/UAS. Estos núcleos EGFP-etiquetados se pueden aislar utilizando anticuerpos contra la GFP que están acoplados a perlas magnéticas. El enfoque descrito en este protocolo permite el aislamiento consistente de los núcleos de tipos de células específicas en el sistema nervioso central de Drosophila larvas en alta pureza y en niveles suficientes para el análisis de expresión, incluso cuando estos tipos de células comprenden menos del 2% de la población total de células en el tejido. Este enfoque se puede utilizar para aislar los núcleos a partir de una amplia variedad de Drosophila embrionario y tipos de células de larvas utilizando controladores específicos Gal4, y puede ser útil para el aislamiento de núcleos de tipos de células que no son adecuados para FACS o microdisección por láser.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Tejidos de Drosophila tales como el sistema nervioso central contienen una mezcla compleja de tipos de células. Por lo tanto, para analizar los perfiles de expresión de genes específicos de células de tejidos de Drosophila, es primero necesario aislar una población homogénea de células específicas en cantidades suficientes para permitir que las aplicaciones posteriores. Métodos para aislar células de tejidos intactos incluyen microdisección por láser, y de células activadas por fluorescencia (FACS) de células enteras. Mientras FACS se ha utilizado para aislar las células y los núcleos de embriones de Drosophila y de Caenorhabditis elegans para la expresión génica y la cromatina de perfiles de 1-3, FACS y microdisección por láser puede ser difícil de realizar con éxito en los tejidos que contienen tipos de células altamente mezclados o que las células con contener morfología irregular, tales como neuronas. Para superar esta dificultad, los núcleos en lugar de las células se pueden aislar a partir de tipos de células específicos y se utilizan para la posterior generaciónde perfiles de expresión de correo. Es importante destacar que el análisis de la expresión de mRNA microarrays basado en el uso de muestras de ARN nucleares muestra resultados generalmente comparables con la realizada utilizando ARN total 4, 5. Por otra parte, el análisis de la expresión génica usando ARN nuclear ha sido utilizado con éxito para estudiar la expresión génica en varios organismos, incluyendo C. elegans, Arabidopsis thaliana, Drosophila, y los seres humanos 4, 5 2, 3.

Varios enfoques han sido recientemente descrita para el aislamiento de poblaciones específicas de núcleos marcados de tejidos de Drosophila que son adecuados para el análisis de la expresión génica y / o la inmunoprecipitación de la cromatina. El aislamiento lote de cromatina específica de tejido para el método de inmunoprecipitación (BITS-CHIP) utiliza FACS para aislar los núcleos fijos sobre la base de la expresión específica de tipo celular de GFP-nuclear localizada 2. Este enfoque ha sido doccessfully utilizado para analizar la distribución de las modificaciones de histonas y los factores de transcripción de la cromatina utilizando inmunoprecipitación de núcleos aislados a partir del mesodermo de Drosophila embriones 2. Sin embargo, los enfoques basados ​​en FACS pueden ser menos adecuado para el aislamiento de núcleos marcados que constituyen sólo una pequeña proporción de una población mixta debido al aumento del tiempo de tipo necesario para obtener números adecuados para aplicaciones posteriores. Para superar estas limitaciones, varios grupos han utilizado técnicas de aislamiento basados ​​en afinidad para purificar los núcleos que están etiquetados con un epítopo específico de un tipo de célula particular. El aislamiento de los núcleos marcados en tipos de células específicos de método (INTACTO) desarrollados para su uso en Arabidopsis thaliana 6, 7 ha sido recientemente adaptado para su uso en Drosophila 8. En este método, una proteína de fusión envoltura nuclear que es un sustrato para la biotinilación en vivo es coexpressed con la Escherichia coli biotina ligasa BirA en tipos celulares específicos. Núcleos marcados con biotina pueden ser posteriormente purificados a partir de poblaciones mixtas que utilizan el aislamiento de afinidad basada-estreptavidina. El uso de este enfoque, los núcleos fueron etiquetados con éxito y aislados del mesodermo de embriones de Drosophila en la que una proteína de fusión envoltura nuclear se expresó bajo el control de un promotor-mesodermo específica 8. Los autores también generaron proteínas de fusión de la envoltura nuclear que se pueden expresar en cualquier tipo de célula bajo el control de la secuencia reguladora de Gal4, UAS 9. Este enfoque es capaz de subconjuntos de núcleos marcados de poblaciones mixtas aislar rápidamente, pero requiere tres construcciones transgénicas independientes y por lo tanto puede ser inadecuado para aplicaciones particulares genéticos. Recientemente, un enfoque ha sido descrito en el que dom (S AD1 y de la ONU C-84), las proteínas que contienen el dominio que se localizan en la membrana interna de la envoltura nuclear fueron etiquetados conproteínas fluorescentes y expresado bajo el control del sistema de Gal4/UAS 10. Los núcleos se aislaron en presencia de detergente no iónico para eliminar la membrana externa de la envoltura nuclear, y se purificó por afinidad usando perlas magnéticas acopladas a anticuerpos anti-GFP. Este enfoque ha sido utilizado con éxito para aislar las poblaciones pequeñas de núcleos marcados de subtipos neuronales específicos en el cerebro adulto de Drosophila 10.

Aquí, se describe un protocolo para el aislamiento de núcleos marcados de una población mixta de células de tejido de larvas de Drosophila. Este método fue desarrollado de forma independiente, pero es similar al enfoque descrito por Henry et al. 10 En primer lugar, los núcleos fueron marcadas con una etiqueta fluorescente que se expresa sólo en tipos de células específicos en Drosophila melanogaster para facilitar el posterior aislamiento de los núcleos etiquetados de poblaciones mixtas utilizando un enfoque basado en la afinidad. Para etiquetar núcleos,Se utilizó el dominio KASH (K larsicht / A nc-1 / S ino h omology). El dominio KASH es un dominio transmembrana que se localiza en la membrana externa de la envoltura nuclear, en parte a través de interacciones con proteínas que contienen el dominio dom dentro del espacio perinuclear 11. El dominio KASH C-terminal de las proteínas tales como Drosophila MSP-300 y Klarsicht ancla estas proteínas a la membrana nuclear externa, mientras que sus dominios N-terminal de interactuar con las proteínas del citoesqueleto, tales como actina o los microtúbulos en el citoplasma 12-14. Las construcciones se generaron en el que el dominio KASH de Drosophila MSP-300 se fusiona al C-terminal de EGFP, bajo el control de la secuencia reguladora de Gal4, UAS en el vector pUAST-attB 15, 16. Uso de integración específica de sitio phiC31, se generaron moscas transgénicas en las que los UAS-EGFP :: MSP-300 KASH transgén se inserta en los loci en el cromosoma attP23L 17. La UAS-EGFP :: MSP-300 KASH moscas pueden ser cruzado con moscas que expresan el controlador de Gal4 en un tipo de célula particular, que resulta en la expresión dirigida de EGFP en la membrana nuclear externa en el tipo celular de interés. Núcleos marcado puede entonces purificarse a partir de poblaciones de células mixtas usando anticuerpos frente a GFP acoplados a perlas magnéticas. En este enfoque, no se requiere el uso de detergente no iónico porque la etiqueta EGFP se localiza en el lado citoplásmico de la membrana nuclear externa, y por lo tanto es accesible a los anticuerpos.

El protocolo descrito a continuación se puede utilizar para aislar / enriquecer núcleos EGFP marcado de tipos de células específicas en los tejidos de las larvas de Drosophila, para cuantificar la pureza y el rendimiento de núcleos aislados, y para extraer ARN nuclear adecuado para la transcripción inversa-reacción en cadena de la polimerasa cuantitativa (QRT -PCR), análisis de la expresión génica. El aislamiento y la purificación por afinidad de los núcleos (excluyendo tissue disección) se puede realizar en menos de una hora. Los resultados se presentan mostrando que los núcleos gliales se pueden aislar con éxito desde el lóbulo óptico de las larvas y el ojo disco imaginal, y se utilizaron para el análisis de la expresión génica posterior. Se prevé que este enfoque será útil para el aislamiento / enriquecimiento de núcleos marcados a partir de tejidos de embriones y larvas en el que las células diana constituyen menos del 5% de la población general. Todas las poblaciones de Drosophila y plásmidos generados en este estudio están disponibles a partir de los autores que lo soliciten.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Generación y caracterización de EGFP :: KASH de Drosophila

  1. Controlador Cruz Gal4 vuela a UAS-EGFP :: Msp-300 KASH vuela. Alternativamente, moscas recombinantes que llevan tanto el conductor de Gal4 y el transgén UAS-EGFP :: MSP-300 KASH se pueden generar usando técnicas genéticas estándar. Este segundo enfoque es ventajoso si se requieren un gran número de progenie.
  2. Caracterizar la expresión del marcador EGFP :: KASH usando técnicas de microscopía estándar. Nota: EGFP expresión se puede observar mediante técnicas de microscopía estándar en los tejidos de Drosophila disecadas, fijas o en larvas de conjunto, y no requiere el uso de un anticuerpo.
    1. Determinar el patrón de expresión de la EGFP :: KASH marcador en todo el organismo bajo un microscopio de fluorescencia de disección (véase Materiales PDF). Nota: Muchos conductores Gal4, incluido el conductor repo-GAL4 se muestra en la Figura 1, Anexo Npatrones onspecific de expresión en otros tejidos larvarios, como las glándulas salivales (ver resultados).
    2. Analizar el patrón de expresión de EGFP :: KASH en el tejido diseccionado de interés utilizando microscopía confocal.
      1. Fijar el tejido de interés el uso de formaldehído a una concentración final de 4%, y ADN de manchas usando DAPI a una concentración final de 0,1 mg / ml para visualizar la localización de la EGFP :: KASH etiqueta con respecto a ADN.
      2. Adquirir imágenes usando ya sea un objetivo de 40X / 1,30 aceite de inmersión o un objetivo de 20x / 0,75 de inmersión en aceite, dependiendo del tamaño del tejido de interés. Las siguientes condiciones de excitación / emisión pueden ser utilizados para la adquisición de imágenes: 408 nm/425-475 nm (DAPI); 488 nm / 525-550 nm (GFP).

2. Aislar Núcleos de Drosophila larvas tejidos

  1. Prepare el equipo para la disección de tejidos de las larvas y el posterior aislamiento de núcleos. Tenga en cuenta quedechorionated embriones enteros también podrían ser utilizados como material de partida, si se desea. Se recomienda el uso de tejidos de larvas parcialmente disecados en lugar de larvas todo si el tipo de célula de interés está presente en un tejido específico tal como el disco imaginal. Esto reduce la unión no específica, y también elimina los problemas que pueden ser causados ​​por la expresión de algunos controladores de Gal4 en células no diana.
    1. Prepare dos pares de pinzas cortantes (ver Materiales PDF), una placa de vidrio 9-así siliconado (ver Materiales PDF), y PBT (PBS 1x, pH 7,4; 0,1% de Tween-20).
    2. Prebind la GFP de anticuerpos a las perlas magnéticas. Este paso se debe iniciar antes de comenzar la disección. Añadir 10 l de las perlas magnéticas (Invitrogen, ver Materiales PDF) y 2 g de GFP de anticuerpos (Roche, ver Materiales PDF) a 400 l de tampón de lavado (PBS 1x, pH 7,4; 2,5 mM de MgCl 2) en un tubo de 1,5 ml . La cantidad de perlas y anticuerpo utilizado se puede optimizar si es necesario sobre la base de la cantidad de diana en el Samplo y la afinidad de unión del anticuerpo a las perlas.
    3. Incubar las perlas y el anticuerpo con rotación durante al menos 30 min a temperatura ambiente.
    4. Colocar el tubo de 1,5 ml que contiene las perlas y el anticuerpo en la gradilla magnética (ver Materiales PDF) y permiten que las perlas se unan a la magnética durante aproximadamente 1-2 minutos. Eliminar el sobrenadante que contiene el anticuerpo no unido y tampón de lavado utilizando una pipeta de 1 ml. Las cuentas se mantendrán atados a la pared del tubo de 1,5 ml en el lado adyacente al imán.
    5. Enjuague las perlas dos veces con 1 ml de tampón de lavado cada vez que se describe en la sección 2.1.4. Retire el tubo de 1,5 ml de la rejilla magnética y se invierte brevemente para mezclar los granos y tampón de lavado en cada paso de lavado.
    6. Guarde las perlas de anticuerpo unido en tampón de lavado hasta que esté listo para continuar con el paso 2.7. Las perlas no se debe permitir que se seque en cualquier etapa del protocolo.
  2. Diseccionar los tejidos larvarios en la valoración PBT y transferir los tejidos disecados aun pocillo de la placa de 9 hoyos. Por lo general, la disección del lóbulo óptico y el ojo disco imaginal de 100 larvas de tercer instar proporciona material suficiente para el análisis de la expresión génica aguas abajo después del aislamiento de núcleos.
  3. Enjuague el tejido aislado en tampón de extracción nuclear (10 mM de HEPES-KOH, pH 7,5; 2,5 mM de MgCl 2; KCl 10 mM) en un tubo de 1,5 ml. Transferir los tejidos aislados de larvas a un 1 ml de homogeneizador Dounce (ver Materiales PDF) en hielo que contiene 1 ml de tampón de extracción nuclear fresco. Incubar en hielo durante 5 min. No es necesario añadir inhibidores de la proteasa si es ARN que ser extraído después del aislamiento núcleos.
  4. Interrumpir el tejido por 20 golpes con la mano del mortero suelto y luego incubar la muestra en hielo durante 10 min para permitir que las células se hinchen. Extracto de los núcleos de las células usando 15 golpes con la mano del mortero apretado. El número de golpes con las manos de mortero flojo y apretado debe ser optimizado para diferentes tejidos y tipos de células; exceso de homogeneización puede resultar ennúcleos esquilada, mientras homogeneización insuficiente no extraerá todos los núcleos de los tejidos.
  5. Filtrar el homogenato, que contiene los núcleos y restos celulares, a través de un filtro de tamaño de poro de 40 micras (ver Materiales PDF) que ha sido prerinsed con tampón de homogeneización nuclear. Recoger el homogeneizado filtrado en un tubo nuevo.
  6. Recoger muestras de pre-aislamiento para el análisis posterior para determinar el rendimiento núcleos, la integridad de los núcleos, y para determinar los niveles de transcripción de genes diana anteriores a los núcleos de aislamiento.
    1. Transferencia de 50 l de la homogeneizado filtrado a un tubo de 1,5 ml fresco con una pipeta. Esta es la muestra de pre-aislamiento. Añadir 500 l de reactivo Trizol (ver PDF Materiales, PRECAUCIÓN), invertir para mezclar y almacenar a -20 ° C para el aislamiento de ARN posterior (paso 3.1).
    2. Transferencia de 20 l de la homogeneizado filtrado a un tubo nuevo 1,5 ml.
      1. Añadir DAPI a una concentración final de 0,1 g / ml, y IncUbate muestra en hielo durante 10 min.
      2. Traslado núcleos teñidos con DAPI a un cubreobjetos recubiertos de poli-lisina, y colocar en un portaobjetos de microscopio. Sellar el cubreobjetos utilizando el esmalte de uñas transparente.
      3. Compruebe la integridad núcleos, y la presencia de núcleos de GFP-etiquetados de interés utilizando microscopio de fluorescencia. Nota: No es necesario fijar los núcleos, o para teñir de GFP si estas diapositivas se analizan razonablemente rápido después de la preparación (a menos de 24 horas).
    3. Transferencia de 10 l de la homogeneizado filtrado a un tubo nuevo 1,5 ml y añadir 90 l de tampón de lavado (PBS 1x, pH 7,4; 2,5 mM de MgCl 2). Añadir DAPI a una concentración final de 0,1 g / ml, y se incuba en hielo durante 10 min. Determinar el rendimiento núcleos en la muestra pre-aislamiento usando un hemocitómetro para contar los núcleos con DAPI positiva utilizando epifluorescencia bajo un objetivo de aire 10 veces.
  7. Coloque el tubo de 1,5 ml que contiene las perlas de anticuerpo unido (preparadas en la sección 2.1.6) en un bastidor magnético,y permitir que las perlas magnéticas se unan al imán durante al menos 2 minutos como se describe en la sección 2.1.4. Retirar el tampón de lavado de las perlas de anticuerpo unido utilizando una pipeta de 1 ml, y añadir el homogeneizado filtrado desde el paso 2.5 al tubo de 1.5 ml con una pipeta de 1 ml.
  8. Invertir suavemente el tubo varias veces para mezclar, y se incuba a 4 ° C durante 30 min con el extremo de extremo a agitación. Evitar burbujas en el tubo, si es posible ya que éstos pueden resultar en la formación de grumos de los núcleos.
  9. Coloque el tubo de 1,5 ml que contiene las perlas de anticuerpo unido y homogeneizado en un estante magnético, y permitir que las perlas magnéticas se unan al imán durante al menos 2 minutos como se describe en la sección 2.1.4. Retire el homogeneizado que contiene la fracción de núcleos no unido usando una pipeta de 1 ml.
  10. Lavar la muestra 3x con 1 ml de tampón de lavado en cada ocasión. Retire el tubo de 1,5 ml que contiene los granos, los núcleos unidos y tampón de lavado del bastidor e invierta para mezclar varias veces, y luego colocar el tubo en el soporte magnético como se describeen el paso 2.9 y eliminar el sobrenadante utilizando una pipeta de 1 ml.
  11. Añadir 150 l de tampón de lavado a las perlas, que deben ser enlazados a los núcleos blanco. Esta es la muestra post-aislamiento. Preparar las muestras para el análisis de microscopía y posterior extracción de RNA.
    1. Transferencia de 20 l de la muestra después de la aislamiento a un tubo de 1,5 ml fresco y tinción con DAPI y analizar como se describe en el apartado 2.6.2. Contar el GFP + / DAPI + y + GFP-/DAPI núcleos capturados por perlas magnéticas para determinar la pureza de la GFP enriquecido + núcleos en la muestra de post-aislamiento.
    2. Añadir 1 ml de reactivo Trizol al resto de la muestra después de la aislamiento, invierta para mezclar y almacenar a -20 ° C para el aislamiento de ARN posterior (paso 3.1). Nota: Las muestras en Trizol se pueden almacenar durante varias semanas si es necesario a -20 º C. No es necesario para eluir los núcleos de las perlas magnéticas antes de la extracción de ARN usando reactivo Trizol, pues dee las perlas no interfieran con el aislamiento de ARN posterior.

3. Determinar niveles de transcripción en núcleos aislados de larvas tejidos

  1. Aislar el ARN de las muestras de pre-y post-de aislamiento de aislamiento preparados en las secciones 2.6.1 y 2.11.2 utilizando el protocolo estándar descrito para la extracción de ARN a base de Trizol (ver Materiales PDF) con las siguientes modificaciones:
    1. Después de la precipitación del sedimento de RNA, añadir 19,2 l de agua libre de RNasa y 0,8 l de reactivo RNASecure (ver Materiales PDF) al sedimento y se incuba a 60 ° C durante 20 minutos para inactivar RNAsas.
  2. Determinar la concentración de ARN con un colorante fluorescente de unión a ARN tales como el kit de ensayo de ARN Qubit (ver Materiales PDF) usando el fluorómetro 2,0 QubitR siguiendo el protocolo del fabricante.
  3. Sintetizar cDNA utilizando una transcriptasa inversa tal como la amplificación de la EpiScript kit de transcriptasa inversa y cebadores oligodT siguiendo las instrucciones del fabricante. Nota: Típicamente, 50 a 100 ng de ARN genera suficiente ADNc para llevar a cabo los análisis de la expresión de múltiples genes. Cantidades equivalentes de pre-ARN aislamiento y de post-aislamiento se deben utilizar para generar ADNc.
  4. Añadir 180 l de agua libre de nucleasa a la muestra de cDNA 20 l para diluir este antes de la PCR en tiempo real cuantitativa (qPCR) el análisis de 10 veces. Esta dilución es un paso importante, ya que las muestras de cDNA sin diluir pueden inhibir la qPCR.
  5. Preparar una mezcla maestra de qPCR con polimerasa y dNTPs, 4 pmoles de cada uno de adelante y cebador inverso, compuesto con agua estéril para que el volumen final de reacción de 20 l.
    1. Diseñar cebadores de qPCR a sus genes diana que se espera que se exprese en el tipo celular de interés, y en la etapa de desarrollo en la que se recoge el tejido. Diseño de cebadores abarcar un intrón, si es posible, de manera que genómico yproductos de PCR de ADNc se pueden distinguir. Nota: Si no se conoce el perfil de expresión de genes del tipo de célula diana, cebadores contra eGFP, que debe ser expresada específicamente en la población de núcleos marcados, se pueden usar para optimizar el protocolo para un tipo de célula particular y el tejido (Tabla 1).
  6. Determinar los niveles de transcripción relativos de cada gen de interés en las muestras de pre-y post-de aislamiento de aislamiento por comparación con una serie de dilución de ADNc preparada a partir de todo el tejido. Los niveles de transcripción de los genes diana deberían normalizarse a un gen de referencia, como RPL32 (o preferiblemente varios genes de referencia).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

El conductor repo-GAL4 (Bloomington código RS 7415) se expresa específicamente en las células gliales en el sistema nervioso de Drosophila en múltiples etapas de desarrollo 18. Las moscas se generaron que expresa de manera estable UAS-EGFP :: MSP-300 KASH bajo el control del controlador de repo-GAL4 utilizando técnicas genéticas estándar. Para caracterizar el patrón de expresión de la EGFP :: KASH transgén en estas moscas, se examinó el patrón de expresión de GFP en el lóbulo óptico diseccionado y el ojo disco imaginal de larvas de tercer instar usando microscopía confocal. Tejidos disecados se contratiñeron con DAPI para marcar ADN y con α-chaoptin 19 para etiquetar los axones fotorreceptoras (mAb24B10, ver Materiales PDF). Figura 1A muestra que la EGFP impulsado repo-GAL4 :: KASH transgén se expresa en células gliales en los lóbulos ópticos y del ojo disco imaginal en el patrón de expresión se esperaba. Bajo un aumento mayor,Expresión de EGFP se observa en un patrón circular que rodea el ADN DAPI-positivo, coherente con la localización-envoltura nuclear de la EGFP :: etiqueta KASH (Figura 1B). EGFP expresión se puede detectar tanto en fijo y en los tejidos no fijadas y sin la necesidad de amplificación de la señal usando un anticuerpo frente a GFP; anticuerpos contra la GFP no se utilizan para visualizar la expresión de EGFP :: KASH en las imágenes mostradas en las Figuras 1 y 2. Para determinar si el transgén EGFP :: KASH se expresa de forma no específica en ningún otro tejido en larvas de Drosophila, la expresión de GFP se examinó en larvas de tercer instar conjunto usando un microscopio de disección de fluorescencia. En particular, la expresión no específica de la EGFP :: KASH transgén se observó en niveles altos en las glándulas salivales de las larvas de tercer instar. Esto indica que el controlador de repo-GAL4 tiene actividad en algunos tipos de células distintas de la glía en la etapa larval de desarrollo. Por lo tanto, para aislar específicamente Glicol núcleos, el lóbulo óptico y el ojo disco imaginal de larvas de tercer estadio se aislaron utilizando disección antes de la homogeneización y la afinidad-aislamiento.

Para confirmar que este protocolo es adecuado para la extracción de núcleos a partir de tejidos de Drosophila, y para estimar el porcentaje de núcleos marcados presente en un determinado tejido, la muestra de pre-aislamiento (sección 2.6.2) a partir de homogeneizados obtenidos a partir de la óptica del lóbulo y el ojo disco imaginal de repo-GAL4, UAS-EGFP :: Se examinó Msp-300 KASH larvas de tercer estadio. Figura 2A muestra una imagen representativa de la muestra pre-aislamiento obtenido mediante microscopía confocal. En esta imagen, la presencia de núcleos se indica mediante eventos DAPI-positivo. También se observó un pequeño número de GFP-positivas, los núcleos gliales DAPI-positivo escasamente dispersas. Estimamos que los núcleos GFP-positivas representan menos del 2% de la población total de núcleos en estemuestra (Figura 2A). El rendimiento total de núcleos de lóbulo óptico y del ojo imaginal discos que fueron disecados de 100 larvas se determinó para la muestra pre-aislamiento como se describe en la sección 2.6.3 (Tabla 2). Una muestra de pre-aislamiento típico de 100 disecados lóbulo óptico y oculares imaginal discos contenían entre 0,8 y 1,2 x 10 7 núcleos, de los cuales aproximadamente el 2% fueron GFP-positivo. Figura 2B muestra una imagen representativa de núcleos DAPI-positivos en una región definida del hemocitómetro. Tenga en cuenta que los núcleos están intactos, y mantienen una forma circular consistente en las condiciones de extracción utilizados en el protocolo (Figuras 2A y 2B).

Para determinar si este protocolo se puede utilizar para aislar y / o altamente enriquecer poblaciones específicas de núcleos marcados a partir de tejidos que contienen poblaciones de células mixtas, perlas magnéticas recubiertas con anticuerpo α-GFP fueron el usod aislar núcleos marcados desde homogeneizados obtenidos del lóbulo óptico y el ojo disco imaginal de 100 repo-GAL4, UAS-EGFP :: Msp-300 KASH larvas de tercer estadio. En las figuras 2C y 2D, se puede ver que la EGFP :: KASH etiquetado se unen núcleos gliales a las perlas magnéticas recubiertas α-GFP y se observó en la muestra de post-aislamiento (sección 2.11.1) después de la separación magnética. Aunque las perlas magnéticas presentan algunos autofluorescencia en el canal de GFP, estos pueden ser diferenciados fácilmente a partir de núcleos de talón-obligado por su tamaño más pequeño (2,8 m para las perlas magnéticas en comparación con aproximadamente 5 micras para los núcleos) y la falta de tinción DAPI. Las buenas prácticas agrarias + / DAPI + núcleos representan más del 95% de los eventos positivos DAPI en la muestra post-aislamiento. Por lo tanto, el objetivo marcado población núcleos son altamente enriquecido en la muestra de post-aislamiento relativo a la pre-aislamientomuestra. La mayoría de los núcleos en el post-aislamiento espectáculo muestra fuerte-envoltura nuclear localizada fluorescencia de GFP, y suelen estar rodeados de perlas. Sin embargo, es posible que un pequeño número de núcleos sin etiquetar también podría estar presente en esta muestra. Por lo tanto, aunque los resultados de la Figura 2C y en el análisis de la expresión génica en la figura 3 (ver más abajo) indican que el objetivo marcado población núcleos gliales es altamente enriquecido, la posibilidad de que algunos núcleos de algunos otros tipos de células no específicas también están presentes en la muestra no se puede excluir. Se recomienda que los usuarios a optimizar este protocolo para su tipo de célula particular y tejido de interés para maximizar el enriquecimiento de la población núcleos de destino, y para eliminar los núcleos unión no específica. En particular, la relación de material de partida con relación al anticuerpo y perlas es probable que sea importante para el enriquecimiento óptimo de núcleos blanco. Por esta razón, los rangos del totalnúmeros de núcleos presentes en nuestras muestras típicas de pre-aislamiento se muestran en la Tabla 2. Con base en el total de los números de núcleos presentes en la muestra de pre-aislamiento, y la proporción estimada de las células gliales en la población mixta de la óptica del lóbulo y el ojo disco imaginal, se esperaba que el rendimiento máximo núcleos en la muestra de post-aislamiento para estar entre 1,6 x 10 5 y 2,4 x 10 5 núcleos. Sin embargo, usando el hemocitómetro para determinar el rendimiento de núcleos como se describe en el paso 2.6.3, el rendimiento núcleos real obtenido en la muestra de post-aislamiento fue entre 1,3 x 10 4 y 2,7 x 10 4 núcleos. Estos rendimientos núcleos representan estimaciones muy aproximadas porque las perlas presentes en la muestra de post-aislamiento parecen afectar a la carga exacta de la hemocitómetro. Algunos núcleos GFP-positivas se observan en el homogeneizado sin consolidar, lo que indica que no todos los núcleos GFP-positivas en los samplia unen a las perlas de manera eficiente en las condiciones utilizadas en este protocolo. El aumento del tiempo de la unión o de realizar los pasos secuenciales de aislamiento potencialmente podría aumentar este rendimiento, pero esto podría venir a costa de tanto la pureza y la integridad del ARN. Utilizando las condiciones descritas en este protocolo, cantidades suficientes de ARN se pueden obtener en la muestra de post-aislamiento para el análisis de expresión de genes aguas abajo por QRT-PCR (Tabla 2). Por lo tanto, este protocolo es capaz de forma rápida y rigurosamente aislar núcleos blanco de los tejidos que contienen poblaciones mixtas de células. Por otra parte, es capaz de aislar específicamente núcleos blanco que constituyen sólo una pequeña proporción, menos de 5%, de las células en una población dada.

Para confirmar aún más que la muestra post-aislamiento fue altamente enriquecido para nuestra población núcleos gliales objetivo, los niveles de transcripciones de 4 genes diferentes en el pre-aislamiento post-aislamiento muestras se compararon mediante RT-qPCR. Los niveles de transcripción de elav, nrv2 y eGFP se determinaron en las dos muestras, y se normalizó para el gen de referencia, RPL32, que se expresa a niveles equivalentes en las células gliales y en el sistema nervioso central circundante (Figura 3). La diferencia veces en la muestra de post-aislamiento se muestra en relación con la muestra de pre-aislamiento, que se fija a uno. En la Figura 3, la muestra de post-aislamiento muestra los niveles de transcripción significativamente más bajos de la neuronal específica elav gen relación a la muestra de pre-aislamiento. Esto indica que los núcleos de las células neuronales están insuficientemente representadas en la muestra post-aislamiento. En contraste, los niveles de transcripción más elevados de tanto el gen nrv2 gliales enriquecida 10 y eGFP están presentes en el post-Isolación muestra en relación con la muestra de pre-aislamiento. Este resultado indica que la muestra de post-aislamiento es altamente enriquecido para la población núcleos gliales objetivo. Es importante señalar que los niveles de transcripción medidos en este protocolo representan transcripciones nucleares, y por lo tanto es probable para indicar los niveles de transcripción activa en lugar de ARNm de estado estacionario. Expresión reproducible de repo no se detectó en cualquiera de nuestras muestras de pre-o post-de aislamiento de aislamiento, lo que sugiere que la proteína Gal4 expresada por el conductor repo-GAL4 puede persistir después de la transcripción activa del gen endógeno repo ha cesado. Esto es consistente con los resultados de otros estudios en los que núcleos marcados usando el promotor twi no muestran niveles enriquecidos de transcripciones twi, tal vez debido a las diferencias en el calendario de desarrollo de la transcripción en comparación con la estabilidad de proteínas 8. Taken conjunto, estos resultados demuestran que el protocolo descrito puede ser utilizado con éxito para enriquecer altamente núcleos blanco a partir de tejidos que contienen poblaciones mixtas de células, y que los núcleos aislados son adecuados para el análisis de la expresión génica.

Figura 1
Figura 1. Patrón de expresión de repo-GAL4, UAS-EGFP :: Msp-300 KASH línea de la mosca. (A) En las larvas de tercer estadio, repo-GAL4 conduce la expresión del transgén UAS-EGFP :: Msp-300 KASH en las células gliales en la óptica lóbulo, tallo óptico (os) y el ojo disco imaginal (ed). La envoltura nuclear en las células gliales se etiqueta con EGFP :: KASH (verde). R1 - axones de las células fotorreceptoras R8 están etiquetados con α-chaoptin (mAB24B10, rojo) para la comparación, y el ADN es staINED con DAPI (púrpura). Núcleos gliales GFP-etiquetados son visibles a lo largo de la lámina (la) en el lóbulo óptico (marcados por las flechas). La barra de escala, 50 micras. (B) Imagen Mayor aumento de los ganglios de la lámina del lóbulo óptico que contiene EGFP :: KASH etiquetados núcleos de las células gliales. La barra de escala, 50 micras. Confocal imágenes fueron adquiridas utilizando un   40X / 1,30 aceite o una   20X / 0,75 objetivo de aceite de inmersión, y el uso de longitudes de onda de excitación / emisión de 408 nm nm/425-475 (DAPI); 488 nm/525-550 nm (GFP); 561 nm/595-620 nm (Alexa 5,6,8 ). Haga clic aquí para ver una versión más grande de esta figura.

Figura 2
Figura 2. Caracterización de los núcleosen "pre-aislamiento" y muestras de "post-aislamiento". (A) imagen representativa de una repo-GAL4, UAS-EGFP :: Msp-300 KASH muestra de pre-aislamiento analizó usando un X 20 / 0,75 objetivo de inmersión en aceite y estándar microscopio confocal. ADN se tiñó con DAPI (azul), y EGFP :: KASH etiquetada núcleos gliales se muestran en verde (marcada con flechas). La barra de escala, 50 micras. (B) Imagen representativa de núcleos teñidos con DAPI de una muestra pre-aislamiento en un hemocitómetro utilizando un objetivo de aire X 10 y el microscopio de epifluorescencia estándar. Rejillas hemocitómetro se muestran en gris claro. Sólo los núcleos con DAPI positiva se muestran en esta imagen, como la fluorescencia de GFP no era visible en este objetivo en el microscopio de epifluorescencia. (C) Imagen Representante de una repo-GAL4, UAS-EGFP :: Msp-300 KASH muestra post-aislamientoanalizados como se describe para el panel A. El EGFP aislado :: KASH etiquetada núcleos gliales (marcados con flechas) tinción positiva para DAPI, y están rodeados por las perlas, que autofluoresce en niveles bajos en el canal de las buenas prácticas agrarias. La barra de escala, 50 micras. (D) Imagen Mayor aumento de un típico EGFP aislado :: KASH etiquetados núcleos gliales (marcados por la flecha) rodeada por bolas. La barra de escala, 5 micras. Haga clic aquí para ver una versión más grande de esta figura.

Figura 3
Figura 3. Los datos representativos QRT-PCR de "pre-aislamiento" y las muestras "post-aislamiento". Los niveles de transcripción de los genes diana se determinaron mediante QRT-PCR de pre-aisladormuestras ación y post-aislamiento obtenidos de repo-GAL4, UAS-EGFP :: lóbulos ópticos Msp-300 KASH y discos imaginales de ojo. Todos los niveles de transcripción se normalizaron a los niveles de transcripción RPL32, y la muestra de pre-aislamiento para cada gen diana se pone a uno. Los resultados representativos de un experimento biológico se muestran para los siguientes genes: elav, nrv2 y eGFP.

Gene Secuencia Primer (5 '-3') Tamaño producto de PCR (pb)
eGFP GAGGGATACGTGCAGGAGAG 102
GATCCTGTTGACGAGGGTGT
nrv2 GGCTGGTTGTAGTCGCAGTT 125
GGCACCCAACACGAGAACTA
elav GCACCATTCGGAGCAATAAT 153
TGTGCAGCTGGATGGTGTAG
RPL32 GCTAAGCTGTCGCACAAATG 160
CGTTGTGCACCAGGAACTT

Tabla 1. Los cebadores utilizados para el análisis de QRT-PCR.

Número total de núcleos en la muestra pre-aislamiento Número total estimado de núcleos en la muestra post-aislamiento Rendimiento de ARN a partir de muestras post-aislamiento (ng)
0,8 - 1,2 x 10 7 1.3 a 2.7 x 10 4 160-220 ng

Tabla 2. Núcleos representativos y los rendimientos de ARN obtenidos.Los rangos típicos de los núcleos y de los rendimientos de ARN obtenidos de muestras pre-y post-aislamiento de aislamiento de 100 lóbulo óptico diseccionado y oculares discos imaginales de la repo-GAL4, UAS-EGFP :: Msp-300 KASH genotipo, en el que las células gliales son etiquetados con EGFP :: KASH. Los núcleos se cuantificaron como se describe en 2.6.3 y el ARN se cuantificó como se describe en 3.1.2.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Este protocolo se puede utilizar para aislar o enriquecer altamente específicamente etiquetados núcleos de poblaciones de células mixtas en embriones de Drosophila o tejidos de larvas. Usando este protocolo, los núcleos se pueden aislar a partir de tejidos disecados en aproximadamente 1 hora. La pureza y el rendimiento de los núcleos aislados deben determinarse experimentalmente para cada tipo de célula. Puede ser difícil de cuantificar los núcleos de talón unida en la etapa de post-aislamiento del protocolo usando un hemocitómetro porque de las perlas presentes en la muestra. Por lo tanto, si se requieren números exactos de los núcleos para una aplicación aguas abajo, será necesario para estimar el rendimiento núcleos sobre la base de un método alternativo tal como el contenido de ADN. Los cálculos exactos de rendimiento núcleos no son necesarios para el análisis de la expresión génica si el ARN se puede aislar y se cuantificó con éxito. Se recomienda utilizar un método basado en la fluorescencia para la cuantificación del rendimiento de ARN, ya que hemos encontrado que la determinación espectrofotométrica de la concentración de ARNen estas muestras de baja concentración es muy variable.

Hay dos aspectos importantes del protocolo que influirán en su éxito: la elección de perlas magnéticas y anticuerpos. Las perlas magnéticas que se acoplan a la GFP o la proteína G están disponibles comercialmente de varias fuentes diferentes. Sin embargo, se recomienda encarecidamente el uso de las perlas magnéticas G proteínas disponibles de Invitrogen para el procedimiento que se describe en este protocolo por dos razones principales. En primer lugar, el tamaño de las perlas de Invitrogen a 2,8 micras es ligeramente más pequeño que el tamaño medio de los núcleos en los tipos de células que hemos examinado, que es de aproximadamente 5 micras (Figura 2D). Las perlas magnéticas que son más pequeños (por ejemplo, 50 nm, μMACS α-GFP, Miltenyi Biotech) no se unen rápidamente a los imanes de estilo por lotes-de lavado, y las columnas previstas estas perlas puede obstruir con extractos de tejidos de las larvas. Perlas magnéticas más grandes (por ejemplo, 10 m, proteína PureProteome G ter magnéticaEADS, Millipore) no se unen bien a los núcleos en nuestras pruebas preliminares, y estos también exhiben una fuerte autofluorescencia en los mismos canales que tanto DAPI y GFP, lo que hace difícil identificar los núcleos en la muestra de perlas-obligado por técnicas de microscopía estándar. Además de la elección de perlas magnéticas, es importante utilizar un anticuerpo de GFP que funciona bien para la inmunoprecipitación pero que no tienen un alto fondo no específica. Para ayudar en la reproducibilidad de este protocolo, se ha utilizado un anticuerpo monoclonal de ratón contra la GFP. Anticuerpos policlonales de conejo contra GFP también se probaron con éxito en nuestros estudios preliminares, pero éstas tienden a tener mayor fondo inespecífico. Otros anticuerpos monoclonales también fueron probados (por ejemplo, Estudios del Desarrollo del Banco hibridoma), con diferentes niveles de éxito. Por lo tanto, la elección de anticuerpo es un factor importante en el éxito en el aislamiento de núcleos marcados.

Aunque en este protocolo se describen los métodos para detarmiño niveles de transcripción de genes en núcleos aislados, se prevé que el enfoque descrito en los pasos 2.1 hasta 2.11 también será adecuado para el aislamiento de los núcleos que se pueden utilizar para el análisis de inmunoprecipitación de cromatina posterior. Si el tejido se fija en formol al 1% antes de la homogeneización (paso 2.3), a continuación, los tejidos disecados se pueden recoger durante varios días y el material suficiente aislados para realizar análisis de inmunoprecipitación de la cromatina. Con base en los recuentos obtenidos usando el hemocitómetro, que proporcionan sólo estimaciones aproximadas como se discutió anteriormente, que obtiene típicamente 1,3 x 10 4 y 2,7 x 10 4 núcleos gliales del disco imaginal ojo y lóbulo óptico de 100 larvas (Tabla 2). Por lo tanto, el uso de nuestro enfoque, debería ser posible para obtener material suficiente para realizar el análisis de inmunoprecipitación de la cromatina, dependiendo de la abundancia del tipo de célula diana, y el epítopo de interés.

Una aplicación genética útil de esta técnicaQue es que puede ser utilizada para etiquetar núcleos positivamente en tipos específicos de células en embriones o larvas que son homocigóticos para un alelo mutante letal recesivo. Para lograr esto, dos poblaciones de mosca separados deben ser generadas en la que el alelo mutante de interés se recombina con un controlador específico de Gal4, o con el transgén UAS-EGFP :: MSP-300 KASH en el tercer cromosoma. Si moscas que llevan el alelo mutante y Gal4 conductor se cruzan a las moscas que llevan los alelos mutantes y el transgén UAS-EGFP :: MSP-300 KASH, sólo la progenie que tienen ambas copias del alelo mutante se marcado con GFP en el tejido en el que el controlador de Gal4 se expresa. Así, los efectos específicos de células de alelos letales recesivos pueden ser examinados en las etapas embrionarias o de larvas, antes de la fase de letalidad. Esta técnica genética se ha utilizado previamente para etiquetar positivamente las células en el músculo embrionario que eran homocigotos para mutaciones en la subunidad SAGA, sgf11 1 </ Sup>.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores no tienen nada que revelar.

Acknowledgments

Damos las gracias a Janice Fischer para proporcionar el plásmido UAS-EGFP :: Msp-300 KASH. El anticuerpo mAB24B10 se obtuvo del Estudios del Desarrollo del Banco hibridoma desarrollado bajo los auspicios del NICHD y mantenido por la Universidad de Iowa, Departamento de Biología. El stock de repo-GAL4 (BL7415) se obtuvo del Stock Center Bloomington en Indiana University. El apoyo de la Sociedad Americana del Cáncer Institucional Investigación Grant (IRG # 58-006-53) al Centro de la Universidad de Purdue para la Investigación del Cáncer se agradece. Jingqun Ma se apoya en una Investigación Agrícola de Purdue ayudantía en la Agricultura y la Alimentación de la Universidad de Purdue.

Materials

Name Company Catalog Number Comments
Anti-chaoptin antibody (mouse, monoclonal) Developmental Studies Hybridoma Bank mAB24B10
Anti-GFP antibody (mouse, monoclonal) Roche 11814460001 This specific antibody is recommended for this protocol. However, alternative antibodies could also be used.
2x Bullseye EvaGreen qPCR Mastermix with ROX MidSci BEQPCR-R
DAPI (4',6-diamidino-2-phenylindole, dihydrochloride salt) Biotium 40011
Dounce Homogenizer (1 ml) VWR 62400-595
Dumont #5 Tweezers, 11 cm World Precision Instruments 14095
Dynabeads Protein G for Immunoprecipitation Invitrogen 10003D This specific brand of magnetic beads is recommended for this protocol.
EpiScript Reverse Transcriptase Epicentre ERT12910K http://www.epibio.com/docs/default-source/protocols/episcript-reverse-transcriptase.pdf
Falcon cell strainers, 40 μm pore size VWR 21008-949 Alternative pore sizes could be used, depending on the size of the target cell nuclei.
Magnetic stand (8 x 1.5 ml tubes) Millipore LSKMAGS08 
Mini tube rotator Genemate H-6700
Qubit starter kit Life Technologies Q32871 Similar fluorescence-based methods for quantifying RNA yield could be used. http://tools.invitrogen.com/content/sfs/manuals/mp32852.pdfZ
RNAsecure (Ambion) Life Technologies AM7010 The use of this reagent to inactivate RNAses is optional.
RT-PCR machine Thermal Cycler BioRad CFX Connect Thermal Cycler
Siliconized 9-well glass plate Hampton Research HR3-134
Stereomicroscope Fluorescence Adapter (Royal Blue (440-460 nm) excitation + yellow barrier Nightsea This adaptor enables GFP fluorescence to be examined using a typical dissecting microscope (eg Nikon)
StereoZoom Microscope 83604 Set with 10X Wide Field Eyepieces and Universal Boom Stand Nikon SMZ 745
Thermal Cycler BioRad T100
Trizol reagent Life Technologies 15596018 CAUTION; Alternative RNA extraction methods can be used. http://tools.invitrogen.com/content/sfs/manuals/trizol_reagent.pdf
Tween 20 Amresco 0777-1L

DOWNLOAD MATERIALS LIST

References

  1. Weake, V. M., et al. Post-transcription initiation function of the ubiquitous SAGA complex in tissue-specific gene activation. Genes Dev. 25, 1499-1509 (2011).
  2. Bonn, S., et al. Cell type-specific chromatin immunoprecipitation from multicellular complex samples using BiTS-ChIP. Nat. Protoc. 7, 978-994 (2012).
  3. Haenni, S., et al. Analysis of C. elegans intestinal gene expression and polyadenylation by fluorescence-activated nuclei sorting and 3'-end-seq. Nucleic Acids Res. 40, 6304-6318 (2012).
  4. Barthelson, R. A., Lambert, G. M., Vanier, C., Lynch, R. M., Galbraith, D. W. Comparison of the contributions of the nuclear and cytoplasmic compartments to global gene expression in human cells. BMC Genom. 8, 340 (2007).
  5. Zhang, C., Barthelson, R. A., Lambert, G. M., Galbraith, D. W. Global characterization of cell-specific gene expression through fluorescence-activated sorting of nuclei. Plant Physiol. 147, 30-40 (2008).
  6. Deal, R. B., Henikoff, S. The INTACT method for cell type-specific gene expression and chromatin profiling in Arabidopsis thaliana. Nat. Protoc. 6, 56-68 (2011).
  7. Deal, R. B., Henikoff, S. A simple method for gene expression and chromatin profiling of individual cell types within a tissue. Dev Cell. 18, 1030-1040 (2010).
  8. Steiner, F. A., Talbert, P. B., Kasinathan, S., Deal, R. B., Henikoff, S. Cell-type-specific nuclei purification from whole animals for genome-wide expression and chromatin profiling. Genom. Res. 22, 766-777 (2012).
  9. Brand, A. H., Perrimon, N. Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development. 118, 401-415 (1993).
  10. Henry, G. L., Davis, F. P., Picard, S., Eddy, S. R. Cell type-specific genomics of Drosophila neurons. Nucleic Acids res. 40, 9691-9704 (2012).
  11. Starr, D. A. KASH and SUN proteins. Curr Biol. 21, 414-415 (2011).
  12. Fischer, J. A., et al. Drosophila klarsicht has distinct subcellular localization domains for nuclear envelope and microtubule localization in the eye. Genetics. 168, 1385-1393 (2004).
  13. Patterson, K., et al. The functions of Klarsicht and nuclear lamin in developmentally regulated nuclear migrations of photoreceptor cells in the Drosophila eye. Mol. Biol. Cell. 15, 600-610 (2004).
  14. Yu, J., et al. The KASH domain protein MSP-300 plays an essential role in nuclear anchoring during Drosophila oogenesis. Dev. Biol. 289, 336-345 (2006).
  15. Bischof, J., Maeda, R. K., Hediger, M., Karch, F., Basler, K. An optimized transgenesis system for Drosophila using germ-line-specific phiC31 integrases. Proc. Natl. Acad. Sci. U.S.A. 104, 3312-3317 (2007).
  16. Kracklauer, M. P., Banks, S. M., Xie, X., Wu, Y., Fischer, J. A. Drosophila klaroid encodes a SUN domain protein required for Klarsicht localization to the nuclear envelope and nuclear migration in the eye. Fly. 1, 75-85 (2007).
  17. Markstein, M., Pitsouli, C., Villalta, C., Celniker, S. E., Perrimon, N. Exploiting position effects and the gypsy retrovirus insulator to engineer precisely expressed transgenes. Nat. Genet. 40, 476-483 (2008).
  18. Sepp, K. J., Schulte, J., Auld, V. J. Peripheral glia direct axon guidance across the CNS/PNS transition zone. Dev. Biol. 238, 47-63 (2001).
  19. Fujita, S. C., Zipursky, S. L., Benzer, S., Ferrus, A., Shotwell, S. L. Monoclonal antibodies against the Drosophila nervous system. Proc. Natl. Acad. Sci. U.S.A. 79, 7929-7933 (1982).
Aislamiento a base de afinidad de Tagged Núcleos de<em&gt; Drosophila</em&gt; Los tejidos para análisis de expresión génica
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Ma, J., Weake, V. M. Affinity-based Isolation of Tagged Nuclei from Drosophila Tissues for Gene Expression Analysis. J. Vis. Exp. (85), e51418, doi:10.3791/51418 (2014).More

Ma, J., Weake, V. M. Affinity-based Isolation of Tagged Nuclei from Drosophila Tissues for Gene Expression Analysis. J. Vis. Exp. (85), e51418, doi:10.3791/51418 (2014).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter