Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

से टैग्ड नाभिक की आत्मीयता के आधार पर अलगाव doi: 10.3791/51418 Published: March 25, 2014

Summary

ड्रोसोफिला ऊतकों अक्सर सेल प्रकार की एक विषम मिश्रण होते हैं. एक विशेष ऊतकों से विशेष प्रकार की कोशिकाओं में जीन की अभिव्यक्ति की जांच करने के लिए, नाभिक आनुवंशिक रूप में चिह्नित है और बाद में एक समानता आधारित दृष्टिकोण का उपयोग कर अलग किया जा सकता है. पृथक नाभिक ऐसे जीन अभिव्यक्ति विश्लेषण और chromatin immunoprecipitation रूप में बहाव के अनुप्रयोगों के लिए इस्तेमाल किया जा सकता है.

Abstract

ड्रोसोफिला मेलानोगास्टर भ्रूण और लार्वा ऊतकों अक्सर इन ऊतकों में जीन की अभिव्यक्ति का विश्लेषण जटिल हो सकता है, जो सेल प्रकार की एक अत्यधिक विषम मिश्रण होते हैं. इस प्रकार, ड्रोसोफिला ऊतकों से सेल विशिष्ट जीन की अभिव्यक्ति प्रोफाइल का विश्लेषण करने के लिए, यह उच्च शुद्धता के साथ और ऐसे transcriptional रूपरेखा और chromatin immunoprecipitation रूप में बहाव के अनुप्रयोगों के लिए पर्याप्त पैदावार पर विशेष प्रकार की कोशिकाओं को अलग करने के लिए आवश्यक हो सकता है. हालांकि, इन ऊतकों में विशिष्ट प्रकार की कोशिकाओं के दुर्लभ आबादी के साथ मिलकर इस तरह के केंद्रीय तंत्रिका तंत्र के रूप में ऊतकों में अनियमित सेलुलर आकारिकी,, छँटाई ऐसी लेजर microdissection और प्रतिदीप्ति सक्रिय सेल के रूप में सेल अलगाव के पारंपरिक तरीकों के लिए (FACS) चुनौतियां खड़ी कर सकते हैं . इधर, में चिह्नित नाभिक की समानता के आधार पर अलगाव, बजाय पूरे कोशिकाओं का उपयोग सेल विशिष्ट जीन की अभिव्यक्ति प्रोफाइल निस्र्पक के लिए एक वैकल्पिक दृष्टिकोण वर्णित है. विशिष्ट सी में नाभिकब्याज के पक्ष प्रकार आनुवंशिक रूप Gal4/UAS द्विआधारी अभिव्यक्ति प्रणाली का उपयोग कर एक परमाणु लिफाफा स्थानीय EGFP टैग के साथ चिह्नित कर रहे हैं. ये EGFP टैग नाभिक चुंबकीय मोतियों के लिए मिलकर कर रहे हैं कि GFP के खिलाफ एंटीबॉडी का उपयोग कर अलग किया जा सकता है. इस प्रोटोकॉल में वर्णित दृष्टिकोण इन प्रकार की कोशिकाओं में कुल सेल की आबादी का कम से कम 2% शामिल है, जब भी उच्च शुद्धता पर ड्रोसोफिला लार्वा केंद्रीय तंत्रिका तंत्र में और अभिव्यक्ति विश्लेषण के लिए पर्याप्त स्तर पर विशिष्ट प्रकार की कोशिकाओं से नाभिक की लगातार अलगाव में सक्षम बनाता है ऊतक. यह दृष्टिकोण ड्रोसोफिला भ्रूण और विशिष्ट Gal4 ड्राइवरों का उपयोग लार्वा सेल प्रकार की एक विस्तृत विविधता से नाभिक को अलग करने के लिए इस्तेमाल किया जा सकता है, और FACS या लेजर microdissection के लिए उपयुक्त नहीं हैं कि सेल प्रकार से नाभिक अलग करने के लिए उपयोगी हो सकता है.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

इस तरह के केंद्रीय तंत्रिका तंत्र के रूप में ड्रोसोफिला ऊतकों प्रकार की कोशिकाओं का एक जटिल मिश्रण होते हैं. इस प्रकार, ड्रोसोफिला ऊतकों से सेल विशिष्ट जीन की अभिव्यक्ति प्रोफाइल का विश्लेषण करने के लिए, यह बहाव के अनुप्रयोगों को सक्षम करने के लिए पर्याप्त मात्रा में विशिष्ट कोशिकाओं का एक समरूप जनसंख्या को अलग करने के लिए पहली आवश्यक है. बरकरार ऊतकों से कोशिकाओं को अलग तरीके लेजर microdissection, और पूरे कोशिकाओं की छंटनी (FACS) प्रतिदीप्ति सक्रिय सेल शामिल हैं. FACS 1-3 रूपरेखा जीन अभिव्यक्ति और chromatin के लिए ड्रोसोफिला भ्रूण से और Caenorhabditis एलिगेंस से कोशिकाओं और नाभिक अलग करने के लिए प्रयोग किया गया है, FACS और लेजर microdissection अत्यधिक intermixed प्रकार की कोशिकाओं या कि होते कोशिकाओं के साथ होते हैं कि ऊतकों में सफलतापूर्वक प्रदर्शन करने के लिए मुश्किल हो सकता है ऐसे न्यूरॉन्स के रूप में अनियमित आकृति विज्ञान,. इस कठिनाई को दूर करने के लिए, बल्कि कोशिकाओं की तुलना में नाभिक विशिष्ट प्रकार की कोशिकाओं से अलग किया और बाद में जनरल के लिए इस्तेमाल किया जा सकता हैई अभिव्यक्ति की रूपरेखा. महत्वपूर्ण बात है, परमाणु शाही सेना के नमूने का उपयोग माइक्रोएरे आधारित mRNA अभिव्यक्ति विश्लेषण कि कुल शाही सेना 4, 5 का उपयोग कर प्रदर्शन के साथ आमतौर पर तुलनीय परिणाम से पता चलता है. इसके अलावा, परमाणु शाही सेना का उपयोग जीन अभिव्यक्ति विश्लेषण सफलतापूर्वक सी. सहित कई जीवों में जीन की अभिव्यक्ति का अध्ययन करने के लिए इस्तेमाल किया गया है एलिगेंस, Arabidopsis thaliana, ड्रोसोफिला, और मनुष्यों 4, 5, 2, 3.

कई तरीकों हाल ही में जीन अभिव्यक्ति विश्लेषण और / या chromatin immunoprecipitation के लिए उपयुक्त हैं कि ड्रोसोफिला ऊतकों से लेबल नाभिक के विशिष्ट आबादी के अलगाव के लिए वर्णित किया गया है. immunoprecipitation (बिट्स चिप) विधि के लिए ऊतक विशेष chromatin के बैच अलगाव परमाणु स्थानीयकृत GFP 2 के सेल प्रकार विशिष्ट अभिव्यक्ति के आधार पर तय नाभिक अलग करने के लिए FACS का इस्तेमाल करता. यह दृष्टिकोण सु किया गया हैccessfully ड्रोसोफिला भ्रूण 2 की mesoderm से अलग नाभिक की chromatin immunoprecipitation का उपयोग histone संशोधनों और प्रतिलेखन कारक के वितरण का विश्लेषण करने के लिए प्रयोग किया जाता है. हालांकि, FACS आधारित दृष्टिकोण के कारण बहाव के अनुप्रयोगों के लिए उपयुक्त संख्या प्राप्त करने के लिए आवश्यक वृद्धि की तरह समय के लिए एक मिश्रित आबादी के केवल एक छोटे से अनुपात है कि गठन लेबल नाभिक अलग करने के लिए कम उपयुक्त हो सकता है. इन सीमाओं को पार करने के लिए, कई समूहों को एक विशेष सेल प्रकार में एक विशिष्ट मिलान के साथ चिह्नित कर रहे हैं कि नाभिक को शुद्ध करने के लिए समानता के आधार पर अलगाव की तकनीक का उपयोग किया है. Arabidopsis thaliana 6, 7 में इस्तेमाल के लिए विकसित विशिष्ट प्रकार की कोशिकाओं (अक्षुण्ण) विधि में टैग नाभिक का अलगाव हाल ही में ड्रोसोफिला 8 में इस्तेमाल के लिए अनुकूलित किया गया है. इस विधि में, vivo biotinylation के लिए एक सब्सट्रेट है कि एक परमाणु लिफाफा संलयन प्रोटीन coexpres हैविशिष्ट प्रकार की कोशिकाओं में ई. कोलाई बायोटिन ligase बीरा के साथ SED. बायोटिन लेबल नाभिक बाद में streptavidin आधारित आत्मीयता अलगाव का उपयोग मिश्रित आबादी से शुद्ध किया जा सकता है. इस दृष्टिकोण का प्रयोग, नाभिक सफलतापूर्वक एक परमाणु लिफाफा संलयन प्रोटीन एक mesoderm विशेष बढ़ाने 8 के नियंत्रण में व्यक्त की गई थी जिसमें ड्रोसोफिला भ्रूण की mesoderm से लेबल और अलग थे. लेखकों को भी Gal4 विनियामक अनुक्रम, यूएएस 9 के नियंत्रण में किसी भी कोशिका प्रकार में व्यक्त किया जा सकता है कि परमाणु लिफाफा संलयन प्रोटीन उत्पन्न. यह दृष्टिकोण तेजी से मिश्रित आबादी से लेबल नाभिक के सबसेट अलग करने में सक्षम है, लेकिन तीन अलग ट्रांसजेनिक निर्माणों की आवश्यकता है और इसलिए विशेष रूप से आनुवंशिक अनुप्रयोगों के लिए अनुपयुक्त हो सकती है. हाल ही में, एक दृष्टिकोण रवि (एस AD1 और संयुक्त राष्ट्र के सी -84) परमाणु लिफाफा के भीतर की झिल्ली को कि स्थानीय डोमेन युक्त प्रोटीन के साथ टैग कर रहे थे, जिसमें वर्णित किया गया हैफ्लोरोसेंट प्रोटीन और Gal4/UAS प्रणाली 10 के नियंत्रण में व्यक्त किया. नाभिक परमाणु लिफाफा की बाहरी झिल्ली को दूर करने के nonionic डिटर्जेंट की मौजूदगी में अलग, और विरोधी GFP एंटीबॉडी के लिए युग्मित चुंबकीय मोतियों का उपयोग आत्मीयता शुद्ध गया. यह दृष्टिकोण सफलतापूर्वक ड्रोसोफिला 10 के वयस्क मस्तिष्क के भीतर विशिष्ट neuronal उपप्रकार से लेबल नाभिक की छोटी आबादी को अलग करने के लिए इस्तेमाल किया गया था.

इधर, ड्रोसोफिला लार्वा ऊतकों से कोशिकाओं के एक मिश्रित आबादी से लेबल नाभिक के अलगाव के लिए एक प्रोटोकॉल में वर्णित है. इस विधि स्वतंत्र रूप से विकसित, लेकिन हेनरी एट अल. 10 पहले से वर्णित दृष्टिकोण के समान हो गया है, नाभिक मिश्रित आबादी से टैग किया नाभिक के बाद अलगाव की सुविधा के लिए ही ड्रोसोफिला मेलानोगास्टर में विशिष्ट प्रकार की कोशिकाओं में व्यक्त किया है कि एक फ्लोरोसेंट टैग के साथ लेबल रहे थे एक आकर्षण आधारित दृष्टिकोण का उपयोग कर. नाभिक लेबल करने के लिए,कश्मीरियों (कश्मीर larsicht / A नेकां -1 / एस yne घंटे omology) डोमेन का उपयोग किया गया था. कश्मीरियों डोमेन perinuclear अंतरिक्ष 11 भीतर धूप डोमेन युक्त प्रोटीन के साथ बातचीत के माध्यम से हिस्से में परमाणु लिफाफा की बाहरी झिल्ली, localizes कि एक transmembrane डोमेन है. उनके एन टर्मिनल डोमेन ऐसी कोशिका द्रव्य 12-14 में actin या सूक्ष्मनलिकाएं रूप cytoskeleton प्रोटीन के साथ बातचीत करते हुए इस तरह के ड्रोसोफिला एमएसपी 300 और Klarsicht के रूप में प्रोटीन की सी टर्मिनल कश्मीरियों डोमेन, बाहरी परमाणु झिल्ली को इन प्रोटीनों एंकर. निर्माणों जिसमें ड्रोसोफिला एमएसपी 300 के कश्मीरियों डोमेन pUAST-attB वेक्टर 15, 16 में Gal4 विनियामक अनुक्रम, यूएएस के नियंत्रण के तहत, EGFP के सी टर्मिनस से इनकार किया गया था उत्पन्न किया गया. PhiC31 साइट विशेष एकीकरण का उपयोग करना, ट्रांसजेनिक मक्खियों उत्पन्न थे यूएएस EGFP :: एमएसपी 300 कश्मीरियों transgene गुणसूत्र पर attP2 loci में डाला गया था जो में3L 17. यूएएस EGFP :: एमएसपी 300 कश्मीरियों मक्खियों ब्याज की कोशिका प्रकार में बाहरी परमाणु झिल्ली पर EGFP के लक्षित अभिव्यक्ति है, जिसके परिणामस्वरूप एक विशेष सेल प्रकार में Gal4 ड्राइवर व्यक्त कि मक्खियों के साथ पार किया जा सकता है. लेबल वाले नाभिक तो चुंबकीय मोतियों के लिए युग्मित GFP के खिलाफ एंटीबॉडी का उपयोग मिश्रित सेल आबादी से शुद्ध किया जा सकता है. इस दृष्टिकोण में, nonionic डिटर्जेंट के उपयोग EGFP टैग बाहरी परमाणु झिल्ली की cytoplasmic ओर करने के लिए स्थानीय है क्योंकि आवश्यक है, और इसलिए एंटीबॉडी के लिए सुलभ नहीं है.

नीचे वर्णित प्रोटोकॉल पवित्रता और अलग नाभिक की उपज यों, ड्रोसोफिला लार्वा ऊतकों में विशिष्ट प्रकार की कोशिकाओं से EGFP लेबल नाभिक को समृद्ध / अलग करने के लिए, और (मात्रात्मक रिवर्स प्रतिलेखन पोलीमरेज़ चेन रिएक्शन के लिए उपयुक्त परमाणु शाही सेना को निकालने के लिए इस्तेमाल किया जा सकता qRT पीसीआर) जीन अभिव्यक्ति विश्लेषण. नाभिक का अलगाव और आत्मीयता शुद्धि (Tissu छोड़करई विच्छेदन) कम से कम एक घंटे में किया जा सकता है. परिणाम glial नाभिक सफलतापूर्वक लार्वा ऑप्टिक पालि और आंख imaginal डिस्क से अलग, और बाद में जीन अभिव्यक्ति विश्लेषण के लिए इस्तेमाल किया जा सकता है दिखा रहा है कि प्रस्तुत कर रहे हैं. यह इस दृष्टिकोण लक्ष्य कोशिकाओं कुल आबादी का कम से कम 5% का गठन, जिसमें भ्रूण और लार्वा ऊतकों से लेबल नाभिक का अलगाव / संवर्धन के लिए उपयोगी हो जाएगा अनुमान है कि. इस अध्ययन में उत्पन्न सभी ड्रोसोफिला स्टॉक और plasmids अनुरोध पर लेखकों से उपलब्ध हैं.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. EGFP की पीढ़ी और विशेषता :: कश्मीरियों ड्रोसोफिला

  1. क्रॉस Gal4 चालक एमएसपी 300 कश्मीरियों मक्खियों यूएएस EGFP :: के लिए मक्खियों. वैकल्पिक रूप से, Gal4 ड्राइवर और यूएएस EGFP :: एमएसपी 300 कश्मीरियों transgene दोनों ले कि पुनः संयोजक मक्खियों मानक आनुवंशिक तकनीक का उपयोग कर उत्पन्न किया जा सकता है. संतान की बड़ी संख्या की आवश्यकता होती है, तो यह दूसरा दृष्टिकोण फायदेमंद है.
  2. मानक माइक्रोस्कोपी तकनीक का उपयोग EGFP :: कश्मीरियों मार्कर की अभिव्यक्ति की विशेषताएँ. नोट: EGFP अभिव्यक्ति या पूरे लार्वा में, विच्छेदित तय ड्रोसोफिला ऊतकों में मानक तकनीक माइक्रोस्कोपी द्वारा मनाया जा सकता है, और एक एंटीबॉडी के उपयोग की आवश्यकता नहीं है.
    1. EGFP की अभिव्यक्ति पैटर्न का निर्धारण करें :: एक प्रतिदीप्ति विदारक माइक्रोस्कोप के तहत पूरे जीव में कश्मीरियों मार्कर (माल पीडीएफ देखें). नोट: चित्रा 1 में दिखाया रेपो-GAL4 ड्राइवर, प्रदर्शनी एन सहित कई Gal4 ड्राइवरों,ऐसे लार ग्रंथि के रूप में अन्य लार्वा ऊतकों में अभिव्यक्ति की onspecific पैटर्न (परिणाम देखें).
    2. Confocal माइक्रोस्कोपी का उपयोग ब्याज की विच्छेदित ऊतक में EGFP :: कश्मीरियों अभिव्यक्ति पैटर्न का विश्लेषण करें.
      1. EGFP के स्थानीयकरण :: डीएनए के लिए कश्मीरियों टैग रिश्तेदार कल्पना करने के लिए 0.1 माइक्रोग्राम / एमएल के एक अंतिम एकाग्रता में DAPI का उपयोग कर एक अंतिम 4% की एकाग्रता, और दाग डीएनए में formaldehyde का उपयोग ब्याज के ऊतकों को ठीक करें.
      2. ब्याज की ऊतक के आकार के आधार पर एक 40X / 1.30 तेल विसर्जन उद्देश्य या एक 20X / 0.75 तेल विसर्जन उद्देश्य, या तो उपयोग कर छवियों का मोल. निम्नलिखित / उत्तेजना उत्सर्जन शर्तों छवि अधिग्रहण के लिए इस्तेमाल किया जा सकता है: 408 nm/425-475 एनएम (DAPI), 488 एनएम / 525-550 एनएम (GFP).

2. ड्रोसोफिला लार्वा ऊतकों से नाभिक को अलग

  1. लार्वा ऊतक विच्छेदन और बाद के नाभिक अलगाव के लिए उपकरण तैयार करते हैं. ध्यान दें किपूरे dechorionated भ्रूण भी अगर वांछित सामग्री शुरू करने के रूप में इस्तेमाल किया जा सकता है. यह ब्याज की कोशिका प्रकार ऐसे imaginal डिस्क के रूप में एक विशेष ऊतकों में मौजूद है बल्कि पूरे लार्वा से आंशिक रूप से विच्छेदित लार्वा ऊतकों का उपयोग करने के लिए सिफारिश की है. यह बाध्यकारी अविशिष्ट कम कर देता है, और भी nontarget कोशिकाओं में कुछ Gal4 चालकों की अभिव्यक्ति के कारण हो सकता है कि समस्याओं को समाप्त.
    1. (माल पीडीएफ देखें) तेज संदंश के दो जोड़े की तैयारी, एक siliconized 9-अच्छी तरह से गिलास प्लेट (माल पीडीएफ देखें), और पीबीटी (1x पीबीएस, पीएच 7.4, 0.1% बीच 20).
    2. चुंबकीय मोतियों को GFP एंटीबॉडी Prebind. यह कदम विच्छेदन की शुरुआत से पहले शुरू किया जाना चाहिए. धोने बफर के 400 μl के लिए (सामग्री पीडीएफ देखना, रॉश) चुंबकीय मोतियों की 10 μl (Invitrogen, माल पीडीएफ देखें) और GFP एंटीबॉडी की 2 ग्राम जोड़ें (1x पीबीएस, पीएच 7.4, 2.5 मिमी 2 MgCl) एक 1.5 मिलीलीटर ट्यूब में . यदि आवश्यक हो तो इस्तेमाल किया मोती और एंटीबॉडी की राशि सैम में लक्ष्य की राशि के आधार पर अनुकूलित किया जा सकता हैमिसाल और मोतियों के लिए एंटीबॉडी के बंधन आत्मीयता.
    3. कमरे के तापमान पर कम से कम 30 मिनट के लिए रोटेशन के साथ मोती और एंटीबॉडी सेते हैं.
    4. चुंबकीय रैक में मोतियों और एंटीबॉडी युक्त 1.5 मिलीलीटर ट्यूब (माल पीडीएफ देखें) प्लेस और मोती लगभग 1-2 मिनट के लिए चुंबकीय करने के लिए बाध्य करने के लिए अनुमति देते हैं. अनबाउंड एंटीबॉडी युक्त सतह पर तैरनेवाला निकालें और एक 1 एमएल पिपेट का उपयोग बफर धोने. मोती चुंबक से सटे पक्ष पर 1.5 मिलीलीटर ट्यूब की दीवार के लिए बाध्य रहेगा.
    5. खंड 2.1.4 में वर्णित के रूप में हर बार धोने बफर के 1 मिलीलीटर के साथ दो बार मोती कुल्ला. चुंबकीय रैक से 1.5 मिलीलीटर ट्यूब निकालें और मोती मिश्रण और प्रत्येक धोने के कदम के दौरान बफर धोने के लिए संक्षिप्त पलटना.
    6. कदम 2.7 के साथ जारी रखने के लिए तैयार है जब तक धोने बफर में एंटीबॉडी बाध्य मोती स्टोर. मोती प्रोटोकॉल के किसी भी चरण में बाहर सुखाने के लिए अनुमति नहीं दी जानी चाहिए.
  2. पीबीटी में लार्वा ऊतकों काटना और को विच्छेदित ऊतकों का स्थानांतरण9-अच्छी तरह से पकवान की एक अच्छी तरह से. आमतौर पर, 100 तृतीय instar लार्वा से ऑप्टिक पालि और आंख imaginal डिस्क के विच्छेदन नाभिक अलगाव निम्नलिखित बहाव के जीन अभिव्यक्ति विश्लेषण के लिए पर्याप्त सामग्री उपलब्ध कराता है.
  3. परमाणु निष्कर्षण बफर में अलग ऊतक कुल्ला (10 मिमी HEPES-KOH, पीएच 7.5, 2.5 मिमी 2 MgCl, 10 मिमी KCl) एक 1.5 मिलीलीटर ट्यूब में. ताजा परमाणु निष्कर्षण बफर के 1 मिलीलीटर होता है कि बर्फ पर (माल पीडीएफ देखें) 1 मिलीलीटर Dounce homogenizer को पृथक लार्वा ऊतकों स्थानांतरण. 5 मिनट के लिए बर्फ पर सेते हैं. यह आरएनए नाभिक अलगाव निम्नलिखित निकाला जा रहा है अगर protease inhibitors जोड़ने के लिए आवश्यक नहीं है.
  4. ढीला मूसल के साथ 20 स्ट्रोक से ऊतक को बाधित और फिर कोशिकाओं को प्रफुल्लित करने के लिए अनुमति देने के लिए 10 मिनट के लिए बर्फ पर नमूना सेते हैं. तंग मूसल से 15 स्ट्रोक का उपयोग कोशिकाओं से नाभिक निकालें. ढीला और तंग pestles साथ स्ट्रोक की संख्या विभिन्न ऊतकों और सेल प्रकार के लिए अनुकूलित किया जाना चाहिए, अतिरिक्त homogenization में परिणाम कर सकते हैंअपर्याप्त homogenization ऊतक से सभी नाभिक को अलग नहीं होगा, जबकि नाभिक sheared.
  5. परमाणु homogenization बफर के साथ prerinsed किया गया है कि एक 40 माइक्रोन ताकना आकार झरनी (माल पीडीएफ देखें) के माध्यम से, नाभिक और सेलुलर मलबे होता है जो homogenate, फ़िल्टर. एक ताजा ट्यूब में फ़िल्टर्ड homogenate लीजिए.
  6. नाभिक उपज, नाभिक अखंडता का निर्धारण करने के लिए, और अलगाव नाभिक के लिए पहले लक्ष्य जीन की प्रतिलिपि स्तर को निर्धारित करने के बाद के विश्लेषण के लिए पूर्व अलगाव के नमूने ले लीजिए.
    1. एक पिपेट का उपयोग कर एक ताजा 1.5 मिलीलीटर ट्यूब पर स्थानांतरण फ़िल्टर्ड homogenate के 50 μl. इस पूर्व अलगाव नमूना है. Trizol अभिकर्मक के 500 μl जोड़ें बाद शाही सेना अलगाव (3.1 कदम) के लिए -20 डिग्री सेल्सियस पर, मिश्रण को पलटना, और दुकान (माल पीडीएफ, सावधानी देखें).
    2. एक ताजा 1.5 मिलीलीटर ट्यूब पर स्थानांतरण फ़िल्टर्ड homogenate के 20 μl.
      1. 0.1 माइक्रोग्राम / एमएल के एक अंतिम एकाग्रता के लिए DAPI जोड़ें, और इंक10 मिनट के लिए बर्फ पर यूबेट नमूना.
      2. एक पाली lysine लेपित coverslip करने के लिए DAPI दाग नाभिक स्थानांतरण, और एक खुर्दबीन स्लाइड पर जगह है. स्पष्ट नेल पॉलिश का उपयोग coverslip सील.
      3. नाभिक अखंडता, और फ्लोरोसेंट माइक्रोस्कोप का उपयोग ब्याज की GFP टैग नाभिक की उपस्थिति की जांच करें. नोट: यह नाभिक को ठीक करने के लिए, या इन स्लाइड्स (24 घंटे के भीतर) तैयारी निम्नलिखित यथोचित जल्दी से विश्लेषण कर रहे हैं अगर GFP के लिए दाग के लिए आवश्यक नहीं है.
    3. एक ताजा 1.5 मिलीलीटर ट्यूब पर स्थानांतरण फ़िल्टर्ड homogenate के 10 μl और धोने बफर के 90 μl (1x पीबीएस, पीएच 7.4, 2.5 मिमी 2 MgCl) जोड़ें. 0.1 माइक्रोग्राम / एमएल के एक अंतिम एकाग्रता के लिए DAPI जोड़ें, और 10 मिनट के लिए बर्फ पर सेते हैं. एक 10X हवा उद्देश्य के तहत epifluorescence का उपयोग DAPI पॉजिटिव नाभिक गिनती करने के लिए एक hemocytometer का उपयोग पूर्व अलगाव नमूने में नाभिक उपज का निर्धारण करें.
  7. एक चुंबकीय रैक में (धारा 2.1.6 में तैयार) प्रतिरक्षी बाध्य मोती युक्त 1.5 मिलीलीटर ट्यूब प्लेस,और खंड 2.1.4 में वर्णित के रूप में चुंबकीय मोतियों कम से कम 2 मिनट के लिए चुंबक के लिए बाध्य करने के लिए अनुमति देते हैं. एक 1 एमएल पिपेट का उपयोग एंटीबॉडी बाध्य मोती से धोने बफर निकालें, और एक 1 एमएल पिपेट का उपयोग 1.5 मिलीलीटर ट्यूब को 2.5 कदम से फ़िल्टर homogenate जोड़ें.
  8. धीरे मिश्रण करने के लिए ट्यूब में कई बार पलटना, और अंत से अधिक अंत आंदोलन के साथ 30 मिनट के लिए 4 डिग्री सेल्सियस पर सेते हैं. यदि संभव हो तो इन नाभिक के clumping में परिणाम कर सकते हैं के बाद से ट्यूब में बुलबुले से बचें.
  9. एक चुंबकीय रैक में एंटीबॉडी बाध्य मोती और homogenate युक्त 1.5 मिलीलीटर ट्यूब, जगह और खंड 2.1.4 में वर्णित के रूप में चुंबकीय मोतियों कम से कम 2 मिनट के लिए चुंबक के लिए बाध्य करने के लिए अनुमति देते हैं. एक 1 एमएल पिपेट का उपयोग अनबाउंड नाभिक अंश युक्त homogenate निकालें.
  10. धोने के 3x के साथ 1 मिलीलीटर हर बार बफर नमूना धो लें. वर्णित के रूप में मोती, बाध्य नाभिक युक्त 1.5 मिलीलीटर ट्यूब निकालें और रैक से बफर धोने और कई बार मिश्रण को पलटना, तो चुंबकीय रैक में ट्यूब जगहकदम 2.9 में और एक 1 एमएल पिपेट का उपयोग सतह पर तैरनेवाला हटायें.
  11. लक्ष्य नाभिक के लिए बाध्य किया जाना चाहिए जो मोती, को धोने बफर के 150 μl जोड़ें. इस के बाद अलगाव नमूना है. माइक्रोस्कोपी विश्लेषण और बाद में शाही सेना निकासी के लिए नमूने तैयार.
    1. एक ताजा 1.5 मिलीलीटर ट्यूब और DAPI साथ दाग पर स्थानांतरण के बाद अलगाव नमूना के 20 μl और खंड 2.6.2 में वर्णित के रूप में विश्लेषण. GFP + / DAPI + और ​​GFP-/DAPI + के बाद अलगाव नमूने में समृद्ध GFP + नाभिक की शुद्धता निर्धारित करने के लिए चुंबकीय मोतियों से कब्जा कर लिया नाभिक गणना.
    2. , के बाद अलगाव नमूना के शेष के लिए Trizol अभिकर्मक के 1 मिलीलीटर जोड़ें मिश्रण को पलटना, और स्टोर बाद शाही सेना अलगाव (3.1 कदम) के लिए -20 डिग्री सेल्सियस पर. नोट: Trizol में नमूने यदि आवश्यक -20 डिग्री सेल्सियस पर कई हफ्तों के लिए भंडारित किया जा सकता है यह Trizol अभिकर्मक का उपयोग पूर्व शाही सेना निकासी के लिए चुंबकीय मोतियों से नाभिक elute करने के लिए आवश्यक नहीं है becausई मोती बाद शाही सेना अलगाव के साथ हस्तक्षेप नहीं करते.

3. लारवल ऊतकों से पृथक नाभिक में ट्रांसक्रिप्ट का स्तर निर्धारित

  1. निम्नलिखित संशोधनों के साथ (माल पीडीएफ देखें) Trizol आधारित शाही सेना निकासी के लिए वर्णित मानक प्रोटोकॉल का उपयोग कर वर्गों 2.6.1 और 2.11.2 में तैयार पूर्व अलगाव और बाद के अलगाव के नमूनों से शाही सेना को अलग:
    1. शाही सेना गोली की तेज़ी के बाद गोली को RNase मुफ्त पानी का 19.2 μl और RNASecure अभिकर्मक के 0.8 μl (माल पीडीएफ देखें) जोड़ने और RNases निष्क्रिय करने के लिए 20 मिनट के लिए 60 डिग्री सेल्सियस पर सेते हैं.
  2. निर्माता प्रोटोकॉल निम्नलिखित QubitR 2.0 fluorometer का उपयोग ऐसे Qubit आरएनए परख किट के रूप में एक फ्लोरोसेंट शाही सेना बाध्यकारी डाई (माल पीडीएफ देखें) के साथ शाही सेना एकाग्रता का निर्धारण.
  3. ऐसे EpiScr के रूप में एक amplifying रिवर्स ट्रांसक्रिपटेस का उपयोग सीडीएनए synthesizeIPT निर्माता के निर्देशों का पालन ट्रांसक्रिपटेस किट और oligodT प्राइमरों उल्टा. नोट: आमतौर पर, शाही सेना के 50 से 100 एनजी कई जीन अभिव्यक्ति विश्लेषण प्रदर्शन करने के लिए पर्याप्त सीडीएनए उत्पन्न करता है. पूर्व अलगाव और बाद अलगाव शाही सेना के बराबर मात्रा सीडीएनए उत्पन्न करने के लिए इस्तेमाल किया जाना चाहिए.
  4. इस 10 गुना से पहले वास्तविक समय मात्रात्मक पीसीआर (qPCR) विश्लेषण पतला करने के लिए 20 μl सीडीएनए नमूना करने nuclease मुक्त पानी के 180 μl जोड़ें. Undiluted सीडीएनए नमूने qPCR बाधित कर सकते हैं क्योंकि यह कमजोर पड़ने, एक महत्वपूर्ण कदम है.
  5. पोलीमर्स और dNTPs, 4 pmoles आगे से प्रत्येक के साथ एक qPCR मास्टर मिश्रण तैयार करें और प्राइमर रिवर्स, 20 μl के अंतिम प्रतिक्रिया मात्रा को बाँझ पानी के साथ बना हुआ है.
    1. ब्याज की कोशिका प्रकार में व्यक्त होने की उम्मीद कर रहे हैं कि जीन लक्ष्य, और ऊतक एकत्र किया जाता है, जिस पर विकास के चरण में करने के लिए qPCR प्राइमरों डिजाइन. एक intron अवधि के लिए डिजाइन प्राइमरों यदि संभव हो तो, इतना है कि जीनोमिक औरसीडीएनए पीसीआर उत्पादों प्रतिष्ठित किया जा सकता. नोट: लक्ष्य सेल प्रकार के जीन की अभिव्यक्ति प्रोफाइल ज्ञात नहीं है, में चिह्नित नाभिक आबादी में विशेष रूप से व्यक्त किया जाना चाहिए जो EGFP, के खिलाफ प्राइमरों, एक विशेष सेल प्रकार और ऊतक (तालिका 1) के लिए प्रोटोकॉल का अनुकूलन करने के लिए इस्तेमाल किया जा सकता है.
  6. पूरे ऊतक से तैयार सीडीएनए की एक कमजोर पड़ने श्रृंखला की तुलना द्वारा पूर्व अलगाव और बाद के अलगाव के नमूनों में ब्याज की प्रत्येक जीन के रिश्तेदार प्रतिलेख के स्तर निर्धारित करते हैं. लक्ष्य जीन की ट्रांसक्रिप्ट स्तरों ऐसे Rpl32 (या बेहतर कई संदर्भ जीन) के रूप में एक संदर्भ जीन के लिए सामान्यीकृत किया जाना चाहिए.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

रेपो-GAL4 ड्राइवर (ब्लूमिंगटन स्टॉक संख्या 7415) विशेष रूप से विकास 18 के कई चरणों में ड्रोसोफिला तंत्रिका तंत्र में glial कोशिकाओं में व्यक्त किया है. मक्खियों stably मानक आनुवंशिक तकनीक का उपयोग कर रेपो-GAL4 ड्राइवर के नियंत्रण में यूएएस EGFP :: एमएसपी 300 कश्मीरियों व्यक्त कि उत्पन्न किया गया. EGFP की अभिव्यक्ति पैटर्न :: कश्मीरियों transgene इन मक्खियों में चिह्नित करने के लिए, तीसरे instar लार्वा से विच्छेदित ऑप्टिक पालि और आंख imaginal डिस्क में GFP अभिव्यक्ति की तर्ज confocal माइक्रोस्कोपी का उपयोग कर जांच की गई थी. विच्छेदित ऊतकों, फोटोरिसेप्टर axons (mAb24B10 लेबल करने के लिए डीएनए और α-chaoptin 19 के साथ चिह्नित करने के लिए DAPI साथ counterstained गया ) माल पीडीएफ देखना. चित्रा 1 ए रेपो-GAL4 संचालित EGFP :: कश्मीरियों transgene उम्मीद अभिव्यक्ति पैटर्न में ऑप्टिक lobes और आंख imaginal डिस्क में glia में व्यक्त किया जाता है कि पता चलता है. उच्च वृद्धि के तहत,EGFP अभिव्यक्ति EGFP के परमाणु लिफाफा स्थानीयकरण के साथ संगत DAPI पॉजिटिव डीएनए, :: कश्मीरियों टैग (चित्रा 1 बी) के आसपास के एक परिपत्र पैटर्न में मनाया जाता है. EGFP अभिव्यक्ति GFP के खिलाफ एक एंटीबॉडी का उपयोग संकेत प्रवर्धन की आवश्यकता के बिना तय करने में और unfixed ऊतकों में दोनों का पता लगाया जा सकता है, GFP के खिलाफ एंटीबॉडी आंकड़े 1 और 2 में दिखाया छवियों में EGFP :: कश्मीरियों अभिव्यक्ति कल्पना करने के लिए इस्तेमाल नहीं किया गया. EGFP :: कश्मीरियों transgene ड्रोसोफिला लार्वा में किसी भी अन्य ऊतकों में nonspecifically व्यक्त किया है, तो यह निर्धारित करने के लिए, GFP अभिव्यक्ति खुर्दबीन विदारक एक प्रतिदीप्ति का उपयोग पूरे तीसरे instar लार्वा में जांच की गई थी. विशेष रूप से, EGFP के अविशिष्ट अभिव्यक्ति :: कश्मीरियों transgene तीसरे instar लार्वा की लार ग्रंथियों में उच्च स्तर पर मनाया गया. इस रेपो-GAL4 ड्राइवर विकास के लार्वा चरण में glia के अलावा अन्य कुछ प्रकार की कोशिकाओं में गतिविधि है कि इंगित करता है. इस प्रकार, विशेष रूप से ग्ली अलग करने के लिएअल नाभिक, तीसरे instar लार्वा से ऑप्टिक पालि और आंख imaginal डिस्क पूर्व homogenization और आत्मीयता अलगाव को विच्छेदन का उपयोग कर अलग किया गया.

इस प्रोटोकॉल ड्रोसोफिला ऊतकों से नाभिक की निकासी के लिए उपयुक्त है कि इस बात की पुष्टि करने के लिए, और ऑप्टिक पालि और आंख से प्राप्त homogenates से एक दिया ऊतक, पूर्व अलगाव नमूना (धारा 2.6.2) में वर्तमान में चिह्नित नाभिक के प्रतिशत का अनुमान रेपो-GAL4 की imaginal डिस्क, यूएएस EGFP :: एमएसपी 300 कश्मीरियों तीसरे instar लार्वा जांच की गई थी. 2A चित्रा confocal माइक्रोस्कोपी का उपयोग कर प्राप्त पूर्व अलगाव नमूना के एक प्रतिनिधि छवि दिखाता है. इस छवि में, नाभिक की उपस्थिति DAPI पॉजिटिव घटनाओं ने संकेत दिया है. कम बिखरे GFP पॉजिटिव, DAPI पॉजिटिव glial नाभिक की एक छोटी संख्या भी मनाया जाता है. हम GFP सकारात्मक नाभिक इस में कुल नाभिक आबादी का कम से कम 2% के लिए खाते का अनुमान है किनमूना (2A चित्रा). खंड 2.6.3 (तालिका 2) में वर्णित के रूप में ऑप्टिक पालि और 100 लार्वा से विच्छेदित कर रहे थे कि आंख imaginal डिस्क से कुल नाभिक उपज पूर्व अलगाव नमूना के लिए निर्धारित किया गया था. लगभग 2% GFP पॉजिटिव थे, जिनमें से 0.8 और 1.2 x 10 7 नाभिक के बीच निहित 100 विच्छेदित ऑप्टिक पालि और आंख imaginal डिस्क, से एक ठेठ पूर्व अलगाव नमूना. चित्रा 2B एक परिभाषित क्षेत्र में DAPI पॉजिटिव नाभिक का एक प्रतिनिधि छवि से पता चलता है hemocytometer की. नाभिक बरकरार है,, और (आंकड़े 2A और 2 बी) प्रोटोकॉल में प्रयोग किया जाता निकासी शर्तों के तहत एक लगातार गोल आकार को बनाए रखने.

इस प्रोटोकॉल अलग और / या अत्यधिक मिश्रित सेल आबादी होते हैं कि ऊतकों से लेबल नाभिक के विशिष्ट आबादी को समृद्ध करने के लिए इस्तेमाल किया जा सकता है, तो यह निर्धारित करने के लिए, α-GFP एंटीबॉडी लेपित चुंबकीय मोतियों उपयोग कर रहे थेऑप्टिक पालि और 100 रेपो-GAL4, यूएएस EGFP :: एमएसपी 300 कश्मीरियों तीसरे instar लार्वा की आंख imaginal डिस्क से प्राप्त homogenates से टैग नाभिक अलग करने के लिए डी. आंकड़े -2 सी और 2 डी में, यह EGFP :: कश्मीरियों α-GFP लेपित चुंबकीय मोतियों को glial नाभिक बाँध टैग और चुंबकीय जुदाई निम्नलिखित के बाद अलगाव नमूना (खंड 2.11.1) में मनाया जाता है कि देखा जा सकता है. चुंबकीय मोतियों GFP चैनल में कुछ autofluorescence प्रदर्शन हालांकि, ये आसानी से अपने छोटे आकार (नाभिक के लिए लगभग 5 माइक्रोन बनाम चुंबकीय मोतियों के लिए 2.8 माइक्रोन) और DAPI धुंधला की कमी से मनका बाध्य नाभिक से भेदभाव किया जा सकता है. GFP + / DAPI + नाभिक के बाद अलगाव नमूने में DAPI सकारात्मक घटनाओं की अधिक से अधिक 95% के लिए खाते. इस प्रकार, लक्ष्य नाभिक आबादी में चिह्नित अत्यधिक पूर्व अलगाव के बाद अलगाव नमूना सापेक्ष में समृद्ध कर रहे हैंनमूना. बाद अलगाव नमूना शो मजबूत परमाणु लिफाफा स्थानीयकृत GFP प्रतिदीप्ति, और नाभिक के बहुमत आमतौर पर मोतियों से घिरे हैं. हालांकि, यह untagged नाभिक की एक छोटी संख्या भी इस नमूने में मौजूद हो सकता है कि संभव है. इस प्रकार, चित्रा -2 में और चित्रा 3 में जीन अभिव्यक्ति विश्लेषण में परिणाम (नीचे देखें) लक्ष्य, glial नाभिक जनसंख्या अत्यधिक समृद्ध है में चिह्नित संकेत मिलता है कि हालांकि कुछ अन्य अविशिष्ट प्रकार की कोशिकाओं से कुछ नाभिक भी नमूने में मौजूद हैं कि संभावना अपवर्जित नहीं किया जा सकता. यह उपयोगकर्ताओं को अपने विशेष सेल प्रकार और ब्याज की ऊतक लक्ष्य नाभिक आबादी के संवर्धन को अधिकतम करने के लिए, और बाध्यकारी अविशिष्ट नाभिक को खत्म करने के लिए इस प्रोटोकॉल का अनुकूलन की सिफारिश की है. विशेष रूप से, एंटीबॉडी और मोतियों के लिए सामग्री सापेक्ष शुरू करने का अनुपात लक्ष्य नाभिक का इष्टतम संवर्धन के लिए महत्वपूर्ण होने की संभावना है. इस कारण से, कुल की सीमाओंहमारे ठेठ पूर्व अलगाव के नमूने में मौजूद नाभिक संख्या 2 तालिका में दिखाया गया. पूर्व अलगाव नमूने में मौजूद कुल नाभिक संख्या, और ऑप्टिक पालि और आंख imaginal डिस्क से मिश्रित आबादी में glial कोशिकाओं की अनुमानित अनुपात के आधार पर, बाद अलगाव नमूने में अधिकतम नाभिक उपज 1.6 के बीच होने की उम्मीद थी एक्स 10 5 और 2.4 x 10 5 नाभिक. हालांकि, कदम 2.6.3 में वर्णित के रूप में नाभिक उपज का निर्धारण करने के लिए hemocytometer का उपयोग, के बाद अलगाव नमूने में प्राप्त वास्तविक नाभिक उपज 4 10 x 4 10 x 1.3 के बीच और 2.7 नाभिक था. बाद अलगाव नमूने में मौजूद मोती hemocytometer की सटीक लदान प्रभावित प्रकट क्योंकि इन नाभिक पैदावार बहुत मोटे अनुमान का प्रतिनिधित्व करते हैं. कुछ GFP सकारात्मक नाभिक का संकेत है, अनबाउंड homogenate में मनाया जाता है कि एस में नहीं सभी GFP सकारात्मक नाभिककुशलता से इस प्रोटोकॉल में प्रयोग किया जाता परिस्थितियों में मोतियों के लिए पर्याप्त बाँध. अनुक्रमिक अलगाव कदम बंधन या प्रदर्शन का समय बढ़ाने से संभवतः इस उपज में वृद्धि कर सकता है, लेकिन यह पवित्रता और आरएनए अखंडता दोनों की कीमत पर आ सकता है. इस प्रोटोकॉल में वर्णित शर्तों का उपयोग, शाही सेना के लिए पर्याप्त मात्रा QRT-पीसीआर (तालिका 2) से नीचे की ओर जीन अभिव्यक्ति विश्लेषण के लिए बाद अलगाव नमूने में प्राप्त किया जा सकता है. इस प्रकार, इस प्रोटोकॉल तेजी से और इसरो कोशिकाओं की मिश्रित आबादी है कि रोकने के ऊतकों से लक्ष्य नाभिक को अलग करने में सक्षम है. इसके अलावा, यह विशेष रूप से एक दिया आबादी में केवल कोशिकाओं के एक छोटे से अनुपात, कम से कम 5%, कि गठन लक्ष्य नाभिक अलग करने में सक्षम है.

आगे के बाद अलगाव नमूना अत्यधिक हमारे लक्ष्य glial नाभिक आबादी के लिए समृद्ध किया गया था कि इस बात की पुष्टि करने के लिए, पूर्व अलगाव में 4 अलग जीनों के लिए टेप के स्तर बाद अलगाव नमूने RT-qPCR से तुलना की गई. ELAV, nrv2 और EGFP की प्रतिलिपि स्तरों दो नमूनों में निर्धारित किया है, और (चित्रा 3) glial कोशिकाओं में बराबर के स्तर पर और आसपास के केंद्रीय तंत्रिका तंत्र में व्यक्त किया जाता है, जो संदर्भ जीन, Rpl32, सामान्यीकृत थे. बाद अलगाव नमूने में गुना अंतर एक करने के लिए सेट किया गया है जो पूर्व अलगाव नमूना, के सापेक्ष दिखाया गया है. चित्रा 3 में, बाद अलगाव नमूना पूर्व अलगाव नमूना करने के लिए neuronal विशेष जीन ELAV रिश्तेदार की काफी कम प्रतिलेख के स्तर से पता चलता है. इस neuronal कोशिकाओं से नाभिक के तहत प्रतिनिधित्व बाद अलगाव नमूने में हैं कि इंगित करता है. इसके विपरीत, glial समृद्ध nrv2 जीन 10 और EGFP दोनों के उच्च प्रतिलेख के स्तर के बाद Isola में मौजूद हैंपूर्व अलगाव नमूना करने के लिए tion नमूना रिश्तेदार. इस परिणाम के बाद अलगाव नमूना अत्यधिक लक्ष्य glial नाभिक आबादी के लिए समृद्ध है कि इंगित करता है. यह इस प्रोटोकॉल में मापा प्रतिलेख के स्तर परमाणु टेप का प्रतिनिधित्व करते हैं कि नोट करना महत्वपूर्ण है, और इसलिए सक्रिय प्रतिलेखन के स्तर के बजाय स्थिर राज्य mRNA संकेत मिलता है की संभावना है. रेपो की प्रतिलिपि प्रस्तुत करने योग्य अभिव्यक्ति रेपो-GAL4 ड्राइवर द्वारा व्यक्त Gal4 प्रोटीन अंतर्जात रेपो जीन की सक्रिय प्रतिलेखन के बाद बना रह सकता नहीं रह गया है, सुझाव है कि हमारे पूर्व अलगाव या बाद अलगाव के नमूनों में या तो पता नहीं था. इस ट्वी प्रमोटर का उपयोग लेबल नाभिक शायद कारण प्रोटीन स्थिरता 8 बनाम प्रतिलेखन के विकास के समय में अंतर करने के लिए, ट्वी टेप की समृद्ध स्तर नहीं दिखा है, जिसमें अन्य अध्ययनों से परिणामों के साथ संगत है. Takएन एक साथ, इन परिणामों वर्णित प्रोटोकॉल सफलतापूर्वक अत्यधिक कोशिकाओं की मिश्रित आबादी है कि रोकने के ऊतकों से लक्ष्य नाभिक को समृद्ध, और अलग नाभिक जीन अभिव्यक्ति विश्लेषण के लिए उपयुक्त हैं कि करने के लिए इस्तेमाल किया जा सकता है कि प्रदर्शित करता है.

चित्रा 1
चित्रा 1. रेपो-GAL4 की अभिव्यक्ति पैटर्न, यूएएस EGFP :: एमएसपी 300 कश्मीरियों लाइन उड़. (ए) तीसरे instar लार्वा में, रेपो-GAL4 ऑप्टिक में glial कोशिकाओं में यूएएस EGFP :: एमएसपी 300 कश्मीरियों transgene की अभिव्यक्ति ड्राइव पालि, ऑप्टिक डंठल (ओएस) और आंख imaginal डिस्क (ईडी). glial कोशिकाओं में परमाणु लिफाफा EGFP :: कश्मीरियों (हरा) के साथ लेबल है. R1 - R8 फोटोरिसेप्टर सेल axons तुलना के लिए α-chaoptin (mAB24B10, लाल) के साथ लेबल, और डीएनए स्टेशन हैDAPI (बैंगनी) के साथ ined. GFP लेबल glial नाभिक (तीर से चिह्नित) ऑप्टिक पालि भीतर लामिना (ला) के साथ दिखाई दे रहे हैं. स्केल बार, 50 माइक्रोन. (बी) EGFP :: कश्मीरियों होता है कि ऑप्टिक पालि के पटल गैन्ग्लिया के उच्च बढ़ाई छवि glial सेल नाभिक लेबल. स्केल बार, 50 माइक्रोन. Confocal छवियों एक या तो उपयोग कर हासिल किया गया   40X / 1.30 तेल या एक   20X / 0.75 तेल विसर्जन उद्देश्य, और 408 nm/425-475 एनएम (DAPI) की उत्तेजना / उत्सर्जन तरंग दैर्ध्य का उपयोग करते हुए 488 nm/525-550 एनएम (GFP), 561 nm/595-620 एनएम (एलेक्सा 5,6,8 ). इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें.

चित्रा 2
चित्रा 2. नाभिक की विशेषता"पूर्व अलगाव" और "के बाद अलगाव" नमूने. (ए) प्रतिनिधि छवि में से एक रेपो-GAL4, यूएएस EGFP :: एमएसपी 300 कश्मीरियों पूर्व अलगाव नमूना 20 / 0.75 तेल विसर्जन उद्देश्य और मानक एक एक्स का उपयोग विश्लेषण confocal खुर्दबीन. डीएनए DAPI (नीला) के साथ दाग, और EGFP :: कश्मीरियों glial नाभिक (तीर से चिह्नित) हरे रंग में दिखाया गया हैं टैग है. स्केल बार, 50 माइक्रोन. (बी) एक एक्स 10 हवा उद्देश्य और मानक epifluorescence माइक्रोस्कोप का उपयोग कर एक hemocytometer पर एक पूर्व अलगाव नमूना से DAPI दाग नाभिक के प्रतिनिधि छवि. Hemocytometer ग्रिड हल्के भूरे रंग में दिखाया गया है. GFP प्रतिदीप्ति epifluorescence माइक्रोस्कोप पर इस उद्देश्य के तहत दिखाई नहीं था के रूप में केवल DAPI पॉजिटिव नाभिक, इस छवि में दिखाया गया. (सी) एक रेपो-GAL4, यूएएस EGFP :: एमएसपी 300 कश्मीरियों के बाद अलगाव नमूना से प्रतिनिधि छविपैनल के लिए वर्णित के रूप में विश्लेषण किया. पृथक EGFP :: कश्मीरियों DAPI के लिए सकारात्मक दाग (तीर से चिह्नित) glial नाभिक में चिह्नित है, और मोतियों से घिरे रहे हैं GFP चैनल में निम्न स्तर पर जो autofluoresce. स्केल बार, 50 माइक्रोन. एक ठेठ पृथक EGFP :: कश्मीरियों की (डी) उच्च बढ़ाई छवि मोतियों से घिरा (तीर से चिह्नित) glial नाभिक में चिह्नित. स्केल बार, 5 माइक्रोन. इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें.

चित्रा 3
चित्रा 3. "पूर्व अलगाव" और "के बाद अलगाव" नमूनों से प्रतिनिधि QRT-पीसीआर डेटा. लक्ष्य जीन की ट्रांसक्रिप्ट स्तरों पूर्व ISOL की QRT-पीसीआर द्वारा निर्धारित किया गया हैरेपो-GAL4, यूएएस EGFP :: एमएसपी 300 कश्मीरियों ऑप्टिक lobes और आंख imaginal डिस्क से प्राप्त समझना और बाद अलगाव नमूनों. सभी प्रतिलेख के स्तर Rpl32 प्रतिलेख के स्तर को सामान्यीकृत कर रहे हैं, और प्रत्येक जीन लक्ष्य के लिए पूर्व अलगाव नमूना एक सेट है. एक जैविक प्रयोग से प्रतिनिधि परिणामों के बाद जीन के लिए दिखाए जाते हैं: ELAV, nrv2 और EGFP.

जीन प्राइमर अनुक्रम (5 '-3') साइज पीसीआर उत्पाद (बीपी)
EGFP GAGGGATACGTGCAGGAGAG 102
GATCCTGTTGACGAGGGTGT
nrv2 GGCTGGTTGTAGTCGCAGTT 125
GGCACCCAACACGAGAACTA
ELAV GCACCATTCGGAGCAATAAT 153
TGTGCAGCTGGATGGTGTAG
Rpl32 GCTAAGCTGTCGCACAAATG 160
CGTTGTGCACCAGGAACTT

तालिका 1. QRT-पीसीआर विश्लेषण के लिए इस्तेमाल प्राइमर.

पूर्व अलगाव नमूने में नाभिक की कुल संख्या बाद अलगाव नमूने में नाभिक की अनुमानित कुल संख्या बाद अलगाव नमूना से शाही सेना उपज (एनजी)
0.8-1.2 10 x 7 1.3-2.7 10 x 4 160-220 एनजी

तालिका 2. प्राप्त प्रतिनिधि नाभिक और शाही सेना पैदावार.Glial कोशिकाओं के साथ चिह्नित कर रहे हैं जिसमें 100 विच्छेदित ऑप्टिक पालि और रेपो-GAL4, यूएएस EGFP :: एमएसपी 300 कश्मीरियों जीनोटाइप, से आंख imaginal डिस्क से पूर्व अलगाव और बाद के अलगाव के नमूनों से प्राप्त नाभिक और शाही सेना पैदावार की विशिष्ट श्रेणियों EGFP :: कश्मीरियों. 2.6.3 में वर्णित के रूप में नाभिक मात्रा निर्धारित किया गया और 3.1.2 में वर्णित के रूप में शाही सेना मात्रा निर्धारित किया गया था.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

इस प्रोटोकॉल ड्रोसोफिला भ्रूण या लार्वा ऊतकों में मिश्रित सेल आबादी से विशेष रूप में चिह्नित नाभिक अलग या अत्यधिक समृद्ध करने के लिए इस्तेमाल किया जा सकता है. इस प्रोटोकॉल का प्रयोग, नाभिक लगभग 1 घंटे में विच्छेदित ऊतकों से अलग किया जा सकता है. पृथक नाभिक की पवित्रता और उपज प्रयोगात्मक प्रत्येक कोशिका प्रकार के लिए निर्धारित किया जाना चाहिए. इसकी वजह यह नमूने में मौजूद मोतियों की एक hemocytometer का उपयोग प्रोटोकॉल के बाद अलगाव के स्तर पर मनका बाध्य नाभिक अंदाजा लगाना मुश्किल हो सकता है. नाभिक की सटीक संख्या एक बहाव के आवेदन के लिए आवश्यक हैं इस प्रकार, यदि यह इस तरह के डीएनए सामग्री के रूप में एक वैकल्पिक पद्धति के आधार पर नाभिक उपज का अनुमान लगाने के लिए आवश्यक हो जाएगा. शाही सेना को सफलतापूर्वक अलग किया और मात्रा निर्धारित किया जा सकता है अगर नाभिक उपज की सही गणना जीन अभिव्यक्ति विश्लेषण के लिए आवश्यक नहीं कर रहे हैं. हमने पाया है, क्योंकि यह शाही सेना उपज बढ़ाता के लिए एक प्रतिदीप्ति आधारित पद्धति का उपयोग करने के लिए सिफारिश की है कि शाही सेना एकाग्रता की spectrophotometric दृढ़ संकल्पइन कम एकाग्रता के नमूनों में अत्यधिक चर रहा है.

चुंबकीय मोतियों और एंटीबॉडी का चुनाव: अपनी सफलता को प्रभावित करती है कि प्रोटोकॉल के दो महत्वपूर्ण पहलू हैं. GFP या प्रोटीन जी के लिए मिलकर कर रहे हैं कि चुंबकीय मोती कई अलग अलग स्रोतों से व्यावसायिक रूप से उपलब्ध हैं. हालांकि, यह दृढ़ता से दो प्रमुख कारणों से इस प्रोटोकॉल में वर्णित प्रक्रिया के लिए Invitrogen से उपलब्ध प्रोटीन जी चुंबकीय मोतियों का उपयोग करने के लिए सिफारिश की है. सबसे पहले, 2.8 माइक्रोन पर Invitrogen मोतियों का आकार लगभग 5 माइक्रोन (चित्रा 2 डी) है, जो हम जांच की है प्रकार की कोशिकाओं में नाभिक का औसत आकार की तुलना में थोड़ा छोटा है. छोटे होते हैं कि चुंबकीय मोती (जैसे 50 एनएम, μMACS α GFP, Miltenyi बायोटेक) बैच धोने शैली मैग्नेट के लिए तेजी से बाध्य नहीं है, और इन मोतियों के लिए प्रदान की जाती कॉलम लार्वा ऊतकों निष्कर्षों के साथ रोकना कर सकते हैं. बड़ा चुंबकीय मोती (जैसे 10 माइक्रोन, PureProteome प्रोटीन जी चुंबकीय बीईएडीएस, Millipore) हमारी प्रारंभिक परीक्षणों में नाभिक को अच्छी तरह से बाध्य नहीं किया था, और ये भी कि यह मुश्किल मानक माइक्रोस्कोपी तकनीक से मनका बाध्य नमूने में नाभिक की पहचान करने के लिए कर रही है, DAPI और GFP दोनों के रूप में एक ही चैनल में मजबूत autofluorescence दिखा रहे हैं. चुंबकीय मोतियों की पसंद के अलावा, यह immunoprecipitation के लिए अच्छी तरह से काम करता है, लेकिन है कि उच्च अविशिष्ट पृष्ठभूमि नहीं है कि एक GFP एंटीबॉडी का उपयोग करने के लिए महत्वपूर्ण है. इस प्रोटोकॉल के reproducibility में सहायता करने के लिए, हम GFP के खिलाफ एक मोनोक्लोनल माउस एंटीबॉडी का इस्तेमाल किया है. GFP के खिलाफ पॉलीक्लोनल खरगोश एंटीबॉडी भी सफलतापूर्वक हमारे प्रारंभिक अध्ययन में trialed थे, लेकिन इन उच्च अविशिष्ट पृष्ठभूमि में हो जाती थी. अन्य मोनोक्लोनल एंटीबॉडी भी सफलता के स्तर पर अलग से, (जैसे विकासात्मक अध्ययन हाइब्रिडोमा बैंक) का परीक्षण किया गया. इस प्रकार, एंटीबॉडी चुनाव लेबल नाभिक के सफल अलगाव में एक महत्वपूर्ण कारक है.

इस प्रोटोकॉल में हम डेट करने के तरीकों का वर्णन यद्यपिपृथक नाभिक में एमिन जीन प्रतिलेख के स्तर, यह कदम 2.1-2.11 में वर्णित दृष्टिकोण भी बाद में chromatin immunoprecipitation विश्लेषण के लिए इस्तेमाल किया जा सकता है कि नाभिक अलग करने के लिए उपयुक्त हो जाएगा अनुमान है कि. ऊतक पूर्व homogenization (2.3 कदम) को 1% formaldehyde में तय हो गई है, तो विच्छेदित ऊतकों कई दिनों और chromatin immunoprecipitation विश्लेषण प्रदर्शन करने के लिए अलग पर्याप्त सामग्री पर एकत्र किया जा सकता है. ऊपर चर्चा के रूप में केवल मोटे अनुमान प्रदान जो hemocytometer का उपयोग प्राप्त मायने रखता है, के आधार पर, हम आम तौर पर 10 x 4 1.3 प्राप्त किया है और आंख imaginal डिस्क और 100 लार्वा (तालिका 2) का ऑप्टिक पालि से 2.7 x 10 4 glial नाभिक. इस प्रकार, हमारे दृष्टिकोण का उपयोग कर, यह लक्षित सेल प्रकार की बहुतायत पर निर्भर करता है, chromatin immunoprecipitation विश्लेषण करने के लिए पर्याप्त सामग्री प्राप्त करने के लिए संभव हो सकता है, और ब्याज के मिलान करना चाहिए.

इस तकनीक का एक उपयोगी आनुवंशिक आवेदनकुए यह सकारात्मक एक पीछे हटने का घातक उत्परिवर्ती एलील के लिए homozygous हैं कि भ्रूण या लार्वा में विशिष्ट प्रकार की कोशिकाओं में नाभिक लेबल करने के लिए इस्तेमाल किया जा सकता है. इसे पूरा करने के दो अलग मक्खी शेयरों हित के उत्परिवर्ती एलील एक विशिष्ट Gal4 ड्राइवर के साथ recombined है जिसमें, या तीसरे गुणसूत्र पर यूएएस EGFP :: एमएसपी 300 कश्मीरियों transgene के साथ उत्पन्न किया जाना चाहिए. उत्परिवर्ती एलील और Gal4 ड्राइवर ले जाने मक्खियों उत्परिवर्ती एलील की दोनों प्रतियां है कि उत्परिवर्ती alleles और यूएएस EGFP :: एमएसपी 300 कश्मीरियों transgene, केवल संतान को ले जाने मक्खियों को पार कर रहे हैं ऊतक में GFP के साथ लेबल किया जाएगा जिसमें Gal4 ड्राइवर व्यक्त किया है. इस प्रकार, पीछे हटने का घातक alleles की सेल विशिष्ट प्रभाव पूर्व मारक चरण के लिए, भ्रूण या लार्वा चरणों में जांच की जा सकती. यह आनुवंशिक तकनीक पहले से सकारात्मक, सागा सबयूनिट में sgf11 1 म्यूटेशन के लिए homozygous थे कि भ्रूण की मांसपेशी में कोशिकाओं लेबल इस्तेमाल किया गया है </ Sup>.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखकों का खुलासा करने के लिए कुछ भी नहीं है.

Acknowledgments

हम यूएएस EGFP :: एमएसपी 300 कश्मीरियों प्लाज्मिड प्रदान करने के लिए जेनिस फिशर धन्यवाद. mAB24B10 एंटीबॉडी NICHD के तत्वावधान में विकसित विकासात्मक अध्ययन हाइब्रिडोमा बैंक से प्राप्त की और आयोवा विश्वविद्यालय, जीवविज्ञान विभाग द्वारा बनाए रखा गया था. रेपो-GAL4 शेयर (BL7415) इंडियाना विश्वविद्यालय में ब्लूमिंगटन स्टॉक केंद्र से प्राप्त हुई थी. कैंसर अनुसंधान के लिए पर्ड्यू विश्वविद्यालय केंद्र के लिए अमेरिकन कैंसर सोसायटी संस्थागत अनुसंधान अनुदान (IRG # 58-006-53) से समर्थन कृतज्ञता से स्वीकार किया है. Jingqun मा पर्ड्यू विश्वविद्यालय से खाद्य और कृषि में पर्ड्यू Assistantship में एक कृषि अनुसंधान द्वारा समर्थित है.

Materials

Name Company Catalog Number Comments
Anti-chaoptin antibody (mouse, monoclonal) Developmental Studies Hybridoma Bank mAB24B10
Anti-GFP antibody (mouse, monoclonal) Roche 11814460001 This specific antibody is recommended for this protocol. However, alternative antibodies could also be used.
2x Bullseye EvaGreen qPCR Mastermix with ROX MidSci BEQPCR-R
DAPI (4',6-diamidino-2-phenylindole, dihydrochloride salt) Biotium 40011
Dounce Homogenizer (1 ml) VWR 62400-595
Dumont #5 Tweezers, 11 cm World Precision Instruments 14095
Dynabeads Protein G for Immunoprecipitation Invitrogen 10003D This specific brand of magnetic beads is recommended for this protocol.
EpiScript Reverse Transcriptase Epicentre ERT12910K http://www.epibio.com/docs/default-source/protocols/episcript-reverse-transcriptase.pdf
Falcon cell strainers, 40 μm pore size VWR 21008-949 Alternative pore sizes could be used, depending on the size of the target cell nuclei.
Magnetic stand (8 x 1.5 ml tubes) Millipore LSKMAGS08 
Mini tube rotator Genemate H-6700
Qubit starter kit Life Technologies Q32871 Similar fluorescence-based methods for quantifying RNA yield could be used. http://tools.invitrogen.com/content/sfs/manuals/mp32852.pdfZ
RNAsecure (Ambion) Life Technologies AM7010 The use of this reagent to inactivate RNAses is optional.
RT-PCR machine Thermal Cycler BioRad CFX Connect Thermal Cycler
Siliconized 9-well glass plate Hampton Research HR3-134
Stereomicroscope Fluorescence Adapter (Royal Blue (440-460 nm) excitation + yellow barrier Nightsea This adaptor enables GFP fluorescence to be examined using a typical dissecting microscope (eg Nikon)
StereoZoom Microscope 83604 Set with 10X Wide Field Eyepieces and Universal Boom Stand Nikon SMZ 745
Thermal Cycler BioRad T100
Trizol reagent Life Technologies 15596018 CAUTION; Alternative RNA extraction methods can be used. http://tools.invitrogen.com/content/sfs/manuals/trizol_reagent.pdf
Tween 20 Amresco 0777-1L

DOWNLOAD MATERIALS LIST

References

  1. Weake, V. M., et al. Post-transcription initiation function of the ubiquitous SAGA complex in tissue-specific gene activation. Genes Dev. 25, 1499-1509 (2011).
  2. Bonn, S., et al. Cell type-specific chromatin immunoprecipitation from multicellular complex samples using BiTS-ChIP. Nat. Protoc. 7, 978-994 (2012).
  3. Haenni, S., et al. Analysis of C. elegans intestinal gene expression and polyadenylation by fluorescence-activated nuclei sorting and 3'-end-seq. Nucleic Acids Res. 40, 6304-6318 (2012).
  4. Barthelson, R. A., Lambert, G. M., Vanier, C., Lynch, R. M., Galbraith, D. W. Comparison of the contributions of the nuclear and cytoplasmic compartments to global gene expression in human cells. BMC Genom. 8, 340 (2007).
  5. Zhang, C., Barthelson, R. A., Lambert, G. M., Galbraith, D. W. Global characterization of cell-specific gene expression through fluorescence-activated sorting of nuclei. Plant Physiol. 147, 30-40 (2008).
  6. Deal, R. B., Henikoff, S. The INTACT method for cell type-specific gene expression and chromatin profiling in Arabidopsis thaliana. Nat. Protoc. 6, 56-68 (2011).
  7. Deal, R. B., Henikoff, S. A simple method for gene expression and chromatin profiling of individual cell types within a tissue. Dev Cell. 18, 1030-1040 (2010).
  8. Steiner, F. A., Talbert, P. B., Kasinathan, S., Deal, R. B., Henikoff, S. Cell-type-specific nuclei purification from whole animals for genome-wide expression and chromatin profiling. Genom. Res. 22, 766-777 (2012).
  9. Brand, A. H., Perrimon, N. Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development. 118, 401-415 (1993).
  10. Henry, G. L., Davis, F. P., Picard, S., Eddy, S. R. Cell type-specific genomics of Drosophila neurons. Nucleic Acids res. 40, 9691-9704 (2012).
  11. Starr, D. A. KASH and SUN proteins. Curr Biol. 21, 414-415 (2011).
  12. Fischer, J. A., et al. Drosophila klarsicht has distinct subcellular localization domains for nuclear envelope and microtubule localization in the eye. Genetics. 168, 1385-1393 (2004).
  13. Patterson, K., et al. The functions of Klarsicht and nuclear lamin in developmentally regulated nuclear migrations of photoreceptor cells in the Drosophila eye. Mol. Biol. Cell. 15, 600-610 (2004).
  14. Yu, J., et al. The KASH domain protein MSP-300 plays an essential role in nuclear anchoring during Drosophila oogenesis. Dev. Biol. 289, 336-345 (2006).
  15. Bischof, J., Maeda, R. K., Hediger, M., Karch, F., Basler, K. An optimized transgenesis system for Drosophila using germ-line-specific phiC31 integrases. Proc. Natl. Acad. Sci. U.S.A. 104, 3312-3317 (2007).
  16. Kracklauer, M. P., Banks, S. M., Xie, X., Wu, Y., Fischer, J. A. Drosophila klaroid encodes a SUN domain protein required for Klarsicht localization to the nuclear envelope and nuclear migration in the eye. Fly. 1, 75-85 (2007).
  17. Markstein, M., Pitsouli, C., Villalta, C., Celniker, S. E., Perrimon, N. Exploiting position effects and the gypsy retrovirus insulator to engineer precisely expressed transgenes. Nat. Genet. 40, 476-483 (2008).
  18. Sepp, K. J., Schulte, J., Auld, V. J. Peripheral glia direct axon guidance across the CNS/PNS transition zone. Dev. Biol. 238, 47-63 (2001).
  19. Fujita, S. C., Zipursky, S. L., Benzer, S., Ferrus, A., Shotwell, S. L. Monoclonal antibodies against the Drosophila nervous system. Proc. Natl. Acad. Sci. U.S.A. 79, 7929-7933 (1982).
से टैग्ड नाभिक की आत्मीयता के आधार पर अलगाव<em&gt; ड्रोसोफिला</emजीन एक्सप्रेशन विश्लेषण के लिए&gt; टिश्यूज
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Ma, J., Weake, V. M. Affinity-based Isolation of Tagged Nuclei from Drosophila Tissues for Gene Expression Analysis. J. Vis. Exp. (85), e51418, doi:10.3791/51418 (2014).More

Ma, J., Weake, V. M. Affinity-based Isolation of Tagged Nuclei from Drosophila Tissues for Gene Expression Analysis. J. Vis. Exp. (85), e51418, doi:10.3791/51418 (2014).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter