A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

Aip1p Dynamics Are Altered by the R256H Mutation in Actin

8K views

⸱

DOI:

10.3791/51551

⸱

July 30th, 2014

In This Article

Summary

Disease-causing mutations in actin can alter cytoskeletal function. Cytoskeletal dynamics are quantified through imaging of fluorescently tagged proteins using total internal fluorescence microscopy. As an example, the cytoskeletal protein, Aip1p, has altered localization and movement in cells expressing the mutant actin isoform, R256H.

Abstract

Mutations in actin cause a range of human diseases due to specific molecular changes that often alter cytoskeletal function. In this study, imaging of fluorescently tagged proteins using total internal fluorescence (TIRF) microscopy is used to visualize and quantify changes in cytoskeletal dynamics. TIRF microscopy and the use of fluorescent tags also allows for quantification of the changes in cytoskeletal dynamics caused by mutations in actin. Using this technique, quantification of cytoskeletal function in live cells valuably complements in vitro studies of protein function. As an example, missense mutations affecting the actin residue R256 have been identified in three human actin isoforms suggesting this amino acid plays an important role in regulatory interactions. The effects of the actin mutation R256H on cytoskeletal movements were studied using the yeast model. The protein, Aip1, which is known to assist cofilin in actin depolymerization, was tagged with green fluorescent protein (GFP) at the N-terminus and tracked in vivo using TIRF microscopy. The rate of Aip1p movement in both wild type and mutant strains was quantified. In cells expressing R256H mutant actin, Aip1p motion is restricted and the rate of movement is nearly half the speed measured in wild type cells (0.88 ± 0.30 μm/sec in R256H cells compared to 1.60 ± 0.42 μm/sec in wild type cells, p < 0.005).

Introduction

Actin is the dominant protein comprising the cytoskeleton and participates in critical cellular processes including cell division, organelle movement, cell motility, contraction, and signaling. Over the past decade, disease-causing mutations in actin have been discovered in each of the six human actin isoforms leading to a range of disorders, from myopathies to coronary artery disease1-7. The processes by which actin mutations lead to disease continue to be elucidated. The yeast model remains the gold standard to study the biochemical effects of mutations on actin function owing to the advantages of the single essential actin isoform, genetic tractability and high conservation of actin sequence and function. Studies show that individual actin mutations lead to molecular specific dysfunctions with dominant negative effects8. For example, deafness-causing mutations in γ-non-muscle actin that affect the Lys-118 residue alter regulation by the actin binding protein Arp2/39. Studies frequently employ in vitro analyses of protein: protein interactions. Investigations into the effect of actin mutations on cell biology and, in particular, actin binding protein localization in the cell are limited.

Studies of the yeast cytoskeleton in vivo conventionally rely on images of fixed cells from an inverted fluorescence microscope10. These experiments supplied foundational data about the morphology of the actin cytoskeleton. Investigations have since incorporated three dimensional confocal imaging to visualize the complex cytoskeletal network11,12. This imaging permits quantification of the abundance and relative location of actin patches and filaments. Thin section electron tomography has been used to image the morphology of the dense filamentous networks relative to preserved subcellular structures13. Crowded cellular spaces with a small cross section can be examined in fine detail with this technique. Imaging studies have been extended to living cells using time lapse fluorescent microscopy. When photo bleaching and background fluorescence can be moderated, time lapse imaging allows investigations as to the dynamics of cytoskeletal proteins and the response to environmental conditions11,14. Separately, visualization of the dynamics of actin filaments in vitro was advanced by the introduction of total internal reflection fluorescence (TIRF) microscopy. Compared to wide field microscopy, TIRF has the advantage of decreased background fluorescence and enhanced contrast to monitor individual filaments15,16. With these qualities, TIRF microscopy has been adapted by cell biologists to monitor cellular structures at the plasma membrane17,18. Cellular events, including changes in the cytoskeleton, can be visualized real time with low phototoxicity, maximal contrast, and minimal background florescence19.

To better understand the effect of actin mutations on the movement, localization, and turnover of cytoskeletal proteins in the cell, TIRF microscopy and protein tagging were used. Herein, methods to study the effects of a clinically relevant mutation in actin on cytoskeletal dynamics in Saccharomyces cerevisiae are described. Specifically, the localization and movement of the actin binding protein, Aip1p, was visualized and quantified in cells expressing the R256H mutation in actin. These techniques complement in vitro biochemical studies and allow for a greater understanding of protein interactions and functions.

Access restricted. Please log in or start a trial to view this content.

Protocol

1. Cloning into the PB1996 Plasmid

  1. Design and order DNA primers from an oligonucleotide manufacturing company that flank the target sequence and contain unique restriction sites in the selected parent plasmid. NOTE: In this case, primers were designed to amplify the 400 base pairs at the 5’ end of the Aip1 sequence. The XhoI restriction site was incorporated into the primer about 20 bp before the Aip1 sequence, and XmaI was included about 20 bp after the target Aip1 sequence. The plasmid used for cloning was PB1996, which contains a 3XGFP tag for fluorescence, a URA gene for yeast strain selection, and an ampicillin resistance gene for bacterial selection.
  2. Purify the genomic DNA from a Ura- yeast haploid strain. Note: Refer to Figure 1 for a diagram of cloning process.
  3. Run a standard PCR reaction using the two primers and the yeast genomic DNA to amplify the Aip1p gene with the restriction sites on either end. Digest the PCR product and the PB1996 plasmid with the restriction enzymes in separate reactions per manufacturer recommended protocols. In this case XmaI and XhoI were used with the accompanying buffer at 37 °C for 1 hr.
  4. Run a 0.8% agarose electrophoresis gel to separate the digested DNA fragments. In one well, load a low DNA mass ladder and, in separate wells, load the whole reaction from each digestion. Run the gel at 100 volts for about 1 hr, until the dye front is near the end of the gel. Visualize the gel under a UV light and purify out the segment that corresponds to the protein segment and the cut plasmid.
  5. Ligate the digested Aip1 segment and PB1996 plasmid. Transform the product into DH5α cells using manufacturer protocols (10 μl DNA with 100 μl cells for 30 min on ice, heat shock at 42 °C for 2 min, grow in SOC media for 2 hr at 37 °C) and plate onto culture plates that include the antibiotic for selection, in this case LB+Amp plates. Select and grow one colony in liquid culture. Purify the newly designed plasmid.

2. Mutant Yeast Strain Generation

  1. Use a haploid yeast strain in which the actin allele has been deleted to build a mutant yeast strain. Note: In this case, the parent strain was a generous gift from Dr. Peter Rubenstein (University of Iowa) and the construction was described by Cook et al.20 This strain lacks the chromosomal actin gene and contains a plasmid that encodes wild type yeast actin and uracil.
  2. Use the pRS plasmid encoding wild type yeast actin with a Trp+ selection as the base plasmid for mutagenesis21.
  3. Perform site-directed mutagenesis on the pRS plasmid to engineer the missense mutation into actin.
    1. For the R256H mutation in actin, make the primer 5’ ggtaacgaaagattccatgccccagaagc 3’ to change the Arg256 to His256. Run a standard mutagenesis PCR reaction with the plasmid from step 2.2.
    2. Transform the mutant actin plasmid from the PCR into DH5α cells. Isolate the plasmid DNA and sequence the actin gene to verify the mutation.
  4. Transform the plasmid encoding mutant yeast actin into the haploid yeast strain from step 2.1.
  5. Culture the transformed cells on Trp- plates to select for yeast containing the Trp+ containing mutant yeast actin plasmid.
  6. Select for cells lacking the original plasmid that encodes wild type actin and uracil (described in 2.1) by sub-culturing cells from the Trp- plates on plates that contain 5-Fluoroorotic Acid (5-FOA). 5-FOA is converted to the toxic form, 5-flurouracil, in yeas strains expressing the functional URA3 gene. The cells that grow after the stepwise selection will contain only the mutant actin plasmid.
  7. Purify the plasmid DNA from the new yeast strain. Sequence the plasmid to ensure the mutant actin gene is present. Use this strain in further studies. This process is diagrammed in Figure 2.

3. Transforming the Plasmid into Yeast Cells

  1. Digest the Aip1p-GFP plasmid with a restriction enzyme to allow integration into the yeast chromosome. NOTE: The restriction site must be outside of the sequence block that contains the fluorescent tag, gene of interest, and selection marker. In this case, use 1 μl of HpaI restriction enzyme with 8 μl DNA and 1 μl of the accompanying 10x buffer for 1 hr at 37 °C.
  2. Culture S. cerevisiae cells (from step 2.5) that are unable to synthesize uracil (Ura- strain) overnight in 5 ml in YPD media (1% yeast extract, 2% peptone, and 2% dextrose) on a wheel at 30 °C. Spin down 1 ml of the cells for 5 min at 1,000 x g.
  3. Make PLATE mixture. Make 10XTE by adding 5 ml of 1 M Tris pH 7.5 and 2 ml of 250 mM ethylenediaminetetraacetic acid (EDTA) to 43 ml of ddH2O. Add 0.204 g of lithium acetate to 20 ml of 1XTE, then 8 g of polyethylene glycol (PEG) (MW ~3,300) and filter sterilize.
  4. Decant the supernatant from the cells spun down in step 3.2 and resuspend the cells in the remaining liquid. To the suspended cells, add 2 μl of 10 mg/ml salmon testes carrier DNA. Add 10 μl of the digested plasmid DNA from step 3.1 and vortex. Add 0.5 ml of PLATE and vortex. Add 20 μl of 1 M DTT and vortex.
  5. Incubate the mixture for 6-8 hr at 25 °C. Heat shock the cells in a water bath at 42 °C for 10 min. Plate 100 μl of cells from the bottom of the microcentrifuge tube where they have settled out onto a –Ura plate. Incubate at 30 °C for 2-3 days or until colonies form.
  6. Select individual colonies and streak out onto a –Ura plate. NOTE: These cells contain the plasmid with the Aip1-GFP and Ura gene integrated into the chromosome, allowing for growth. These cells will then be used in microscopy.

4. Visualizing the Aip1p Protein Movement Using Total Internal Reflection Fluorescence Microscopy

  1. Grow a culture of the yeast cells with the incorporated Aip1p-GFP in YPD overnight on a wheel at 30 °C. Subculture 1 ml of the overnight culture into 9 ml of –Ura media. Grow the cells for an additional 3-4 hr on a shaker at 30 °C to ensure that they are in log growth phase.
  2. Add 3 μl of cells to a glass microscope slide and add a coverslip. Allow the cells to settle on the slide for 5 min. Place the slide in the bracket of the stage plate.
  3. Observe the Aip1p-GFP protein with a total internal reflection fluorescence (TIRF) microscope (488 nm) using an oil immersion 100X TIRF objective and a digital CCD camera. Using SlideBook 5.0 software, obtain images for 20 sec at a rate of 5 frames/sec (Individual frames of acquired images are presented in Figure 2A).
    1. To focus on the cells, open SlideBook 5.0 software and click the Focus Window button in the toolbar to access the focus controls. Select the Scope tab and select the 100X-TIRF objective. Turn the lamp on and slide the lamp bar to 15%. Change the Bin setting to 2 x 2. Change filter to bright field.
    2. On the microscope, use the fine focus dial to bring the cells into focus as seen on the computer screen.
    3. Using the controls within the Focus Window, turn the lamp off, change the filter to Live, and click the TIRFM button.
    4. On the TIRFM illuminator attached to the right side port of the microscope, turn the laser emission to On.
    5. Select the Stream tab within the Focus Window, check the box next to Start Recording and then click bright field button.
    6. On the TIRFM illuminator, turn the micrometer to adjust the incident angle of the laser. This is used to optimize the fluorescence emission from the Aip1-GFP foci and minimize the background fluorescence from the cells and slide.
    7. When the desired image is displayed, press Start. After 20 sec, press Stop. Save the images. Under the File tab on the main menu bar, select Save Slide As and enter the file location and name.
  4. Use ImageJ software to analyze the images. Use the macro plugin “Manual Tracker” to track the movement and rate of the fluorescent Aip1p foci. Change the time interval parameter to 0.2 sec.
    1. Using the add track selection, select and track an individual fluorescent protein through four to eight connective frames. Use the end track command and the velocity of protein movement between each frame will display in a results window.
    2. Determine the mean rate between each frame using a Microsoft Excel spreadsheet. Use the values to compute the average velocity of Aip1p movement for each cell strain of interest. NOTE: A scatter plot of the rate of Aip1p movement and the average non-linear velocity is shown in Figure 2B.

Access restricted. Please log in or start a trial to view this content.

Results

A method to image the dynamics of cytoskeletal proteins in the cell is presented. The actin-binding protein, Aip1p, was tagged with GFP. The design for the plasmid encoding the tagged product is shown in Figure 1. The plasmid was then transformed into the yeast cells. Expression of the fluorescently tagged Aip1p allowed visualization of the protein behavior in the cell. Aip1p typically localizes to actin patches at sites of endocytosis22. To quantify Aip1p movement, more than 50 fluorescent Ai...

Access restricted. Please log in or start a trial to view this content.

Discussion

An effective strategy to visualize the dynamics of the cytoskeleton and the utility in investigations on pathogenic mutations has been described here. Advanced imaging modalities have created new opportunities to understand the intracellular movement of proteins near the cell membrane. Total internal reflection fluorescence microscopy (TIRF) is a sensitive technique for functional studies in living cells. TIRF uses an angled excitation laser that creates an evanescent field due to the difference in refractive indexes of ...

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors have nothing to disclose.

Acknowledgements

The authors thank Peter Rubenstein for useful discussion and technical advice and David Pellman for the original PB1996 clone. This work was supported by a grant from the March of Dimes and funding from the Ride for the Kids.

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
Agaroserpi9012-36-6
Bromophenol BlueAmresco115-39-9
BSANEBB9001S
Change-IT Multiple Mutation Site Directed Mutagenesis KitUSB Corporation4166059
CutSmart BufferNEBB7204S
DNA, single stranded from salmon testesSigma9007-49-2
EDTA pH 7.4Sigma93302
Ethidium bromideInvitrogen15585-011Warning! Harmful irritation
Fungal/Bacterial DNA KitSymo ResearchD6005
HpaINEBR0105S
Lithium acetateAlfaAesar6108-17-4
Low DNA Mass LadderInvitrogen10068-013
NE Buffer #4NEBB7004S
Platinum PCR SuperMix High FidelityInvitrogen12532-016
Miniprep KitQiagen27106Any kit will work
Quick Ligation KitNEBM2200S
Sodium azideSigma26628-22-8
PBSInvitrogen10010-023
PEGAmresco25322-68-3
Tris Base Ultrapurerpi77-86-1
Wizard SV Gel and PCR Clean-Up SystemPromega1/6/2015
XhoINEBR0146S
XmaINEBR0180S
YPD mediaLabExpress3011
-URA MediaLabExpress3010
PCR MachineInvitrogen4359659Any PCR machine will work
TIRF MicroscopeOlympus IX81
Hamamatsu ORCA-R cameraHamamatsu

References

  1. Lehtonen, H. J., et al. Segregation of a missense variant in enteric smooth muscle actin gamma-2 with autosomal dominant familial visceral myopathy. Gastroenterology. 143, e1483 1482-1491 (2012).
  2. Matsson, H., et al. Alpha-cardiac actin mutations produce atrial septal defects. Hum Mol Genet. 17, 256-265 (2008).
  3. Zhu, M., et al. Mutations in the gamma-actin gene (ACTG1) are associated with dominant progressive deafness (DFNA20/26). Am J Hum Genet. 73, 1082-1091 (2003).
  4. Nowak, K. J., et al. Mutations in the skeletal muscle alpha-actin gene in patients with actin myopathy and nemaline myopathy. Nat Genet. 23, 208-212 (1999).
  5. Olson, T. M., Michels, V. V., Thibodeau, S. N., Tai, Y. S., Keating, M. T. Actin mutations in dilated cardiomyopathy, a heritable form of heart failure. Science. 280, 750-752 (1998).
  6. Riviere, J. B., et al. De novo mutations in the actin genes ACTB and ACTG1 cause Baraitser-Winter syndrome. Nat Genet. 44, S441-442 440-444 (2012).
  7. Guo, D. C., et al. Mutations in smooth muscle alpha-actin (ACTA2) lead to thoracic aortic aneurysms and dissections. Nat Genet. 39, 1488-1493 (2007).
  8. Sparrow, J. C., et al. Muscle disease caused by mutations in the skeletal muscle alpha-actin gene (ACTA1). Neuromuscul Disord. 13, 519-531 (2003).
  9. Kruth, K. A., Rubenstein, P. A. Two deafness-causing (DFNA20/26) actin mutations affect Arp2/3-dependent actin regulation. J Biol Chem. 287, 27217-27226 (2012).
  10. Amberg, D. C. Three-dimensional imaging of the yeast actin cytoskeleton through the budding cell cycle. Mol Biol Cell. 9, 3259-3262 (1998).
  11. Pelham, R. J., Chang, F. Role of actin polymerization and actin cables in actin-patch movement in Schizosaccharomyces pombe. Nat Cell Biol. 3, 235-244 (2001).
  12. Vavylonis, D., Wu, J. Q., Hao, S., O'Shaughnessy, B., Pollard, T. D. Assembly mechanism of the contractile ring for cytokinesis by fission yeast. Science. 319, 97-100 (2008).
  13. Bertin, A., et al. Three-dimensional ultrastructure of the septin filament network in Saccharomyces cerevisiae. Mol Biol Cell. 23, 423-432 (2012).
  14. Senning, E. N., Marcus, A. H. Actin polymerization driven mitochondrial transport in mating S. cerevisiae. Proc Natl Acad Sci U.S.A. 107, 721-725 (2010).
  15. Breitsprecher, D., Kiesewetter, A. K., Linkner, J., Faix, J. Analysis of actin assembly by in vitro TIRF microscopy. Methods Mol Biol. 571, 401-415 (2009).
  16. Popp, D., Narita, A., Iwasa, M., Maeda, Y., Robinson, R. C. Molecular mechanism of bundle formation by the bacterial actin ParM. Biochem Biophys Res Commun. 391, 1598-1603 (2010).
  17. Trache, A., Lim, S. M. Live cell response to mechanical stimulation studied by integrated optical and atomic force microscopy. J Vis Exp. (44), (2010).
  18. Spira, F., Dominguez-Escobar, J., Muller, N., Wedlich-Soldner, R. Visualization of cortex organization and dynamics in microorganisms, using total internal reflection fluorescence microscopy. J Vis Exp. (63), e3982(2012).
  19. Manneville, J. B. Use of TIRF microscopy to visualize actin and microtubules in migrating cells. Methods Enzymol. 406, 520-532 (2006).
  20. Cook, R. K., Sheff, D. R., Rubenstein, P. A. Unusual metabolism of the yeast actin amino terminus. J Biol Chem. 266, 16825-16833 (1991).
  21. Feng, L., et al. Fluorescence probing of yeast actin subdomain 3/4 hydrophobic loop 262-274. Actin-actin and actin-myosin interactions in actin filaments. J Biol Chem. 272, 16829-16837 (1997).
  22. Lin, M. C., Galletta, B. J., Sept, D., Cooper, J. A. Overlapping and distinct functions for cofilin, coronin and Aip1 in actin dynamics in vivo. J Cell Sci. 123, 1329-1342 (2010).
  23. Malloy, L. E., et al. Thoracic Aortic Aneurysm (TAAD)-causing Mutation in Actin Affects Formin Regulation of Polymerization. J Biol Chem. 287, 28398-28408 (2012).
  24. Smyth, J. W., Shaw, R. M. Visualizing ion channel dynamics at the plasma membrane. Heart Rhythm. 5, S7-S11 (2008).
  25. Bhattacharya, R., et al. Recruitment of vimentin to the cell surface by beta3 integrin and plectin mediates adhesion strength. J Cell Sci. 122, 1390-1400 (2009).
  26. Hetheridge, C., et al. The formin FMNL3 is a cytoskeletal regulator of angiogenesis. J Cell Sci. 125, 1420-1428 (2012).
  27. Bergeron, S. E., et al. Allele-specific effects of thoracic aortic aneurysm and dissection alpha-smooth muscle actin mutations on actin function. J Biol Chem. 286, 11356-11369 (2011).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

Actin Mutation R256HTIRF MicroscopyFluorescent Protein TaggingCytoskeletal DynamicsYeast Model SystemActin DepolymerizationProtein Movement QuantificationLive Cell ImagingGFP Tracking