Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

البروتينات التحليل المناعي من الداخلية والخارجية السنترومير-الحيز الحركي

Published: March 3, 2016 doi: 10.3791/53732

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

وحددت "القسيم" الكلاسيكي كما مناطق إعادة التركيب الانتصافي قمعت في مجال علم الوراثة واعترف فيما بعد انقباض الأساسي من الكروموسومات الإنقسامية، والتي تلعب دورا أساسيا في فصل كروموسوم دقيقة أثناء الانقسام. وصفت "Kinetochores" مثل الهياكل متعددة الطبقات التي ترتبط الأنابيب الدقيقة على سطح القسيم، كما يتضح من المجهر الإلكتروني. تم تعريف "kinetochores" فيما بعد باسم معقد جزيء أن يموضع في السنترومير من الكروموسومات الإنقسامية. وعلى الرغم من الاختلاف الكبير في تسلسل الحمض النووي القسيم المركزي بين الفقاريات، هيكل الحيز الحركي والتكوين يتم حفظها للغاية. مطلوب التفاعل الديناميكي بين ميكروتثبول المغزل والحيز الحركي للفصل المؤمنين من الصبغيات أثناء الانقسام، والعيوب في السنترومير-الحيز الحركي وظيفة يؤدي إلى عدم توازن الصبغيات وبالتالي السرطان.

السنترومير في معظم حقيقيات النوىلا يوجد لديه تسلسل الحمض النووي محددة، ولكن يتكون من صفائف كبيرة (0،3-5 ميجا بايت) من الحمض النووي alphoid المتكررة التي تتكون من 171-BP الحمض النووي α قنوات فضائية. إلا في مهدها الخميرة، ويتحقق هوية السنترومير وليس عن طريق تسلسل الحمض النووي ولكن من خلال وجود جسيم نووي الخاصة التي تحتوي على هيستون H3 البديل CenH3 (السنترومير البروتين A [CENP-A] في البشر). 5 CENP-A جسيم نووي توطين ل لوحة الداخلية kinetochores الثدييات 7 و ربط على الحمض النووي α-الأقمار الصناعية 171-BP. تتطلب القسيم النشطة CENP المحتوية على وجسيم نووي لتوجيه توظيف شبكة التأسيسية المرتبطة السنترومير (CCAN) والبروتينات الحيز الحركي، التي تنظم معا المرفق من الكروموسومات إلى المغزل الإنقسامية وتقدم دورة لاحقة عبر حاجز المغزل.

في ضوء الأدلة أعلاه، فقد اقترح CENP-A ليكون علامة جينية من السنترومير ومع ذلك، فإن العملية التي يتم تضمينها CENP-A طn لالحمض النووي القسيم المركزي والعوامل المسؤولة عن هذا التأسيس حتى الآن لم يتم توصيفه جيدا. ونطاق استهداف السنترومير قصيرة (CATD) يقيم في هيستون أضعاف منطقة CENP-A، واستبدال المنطقة المقابلة من H3 مع CATD كافية لH3 المباشر إلى السنترومير، واقترحت 9 دراسات عدة أدوار وظيفية لمرحلة ما بعد متعدية تعديل (PTM) من CENP-A 12-16. ومع ذلك، لم يتم بعد إجمال الآليات الجزيئية لهذه PTMs من CENP-A في التوظيف لالقسيم. ذكرنا سابقا أن CUL4A-RBX1-COPS8 E3 النشاط يغاز مطلوب للCENP-A K124 ubiquitylation وتوطين CENP-A إلى القسيم 17

وقد أدى اكتشاف وتوصيف البروتينات الحيز الحركي إلى رؤية جديدة بشأن العزل الصبغي. وقد تم تحديد 18 أكثر من 100 من عناصر الحيز الحركي في خلايا الفقاريات التي كتبها نهج مختلف. 19،20 وكيلمكانة كيفية تجميع kinetochores وظيفة تأتي أيضا من توصيف الوظائف الخلوية من كل شبكة البروتينات الحيز الحركي-السنترومير والبروتين البروتين داخل الخلايا. 19 التصور المباشر والتصوير المتقدمة الأساليب في مضان المجهري توفر قرار ملحوظا من مكونات السنترومير الحيز الحركي وتسمح الملاحظة المباشرة من مكونات جزيئية معينة من القسيم وkinetochores. وبالإضافة إلى ذلك، أساليب مناعي غير مباشر (معهد التمويل الدولي) تلطيخ باستخدام أجسام مضادة محددة ذات أهمية حاسمة لهذه الملاحظات. ومع ذلك، على الرغم من العديد من التقارير حول بروتوكولات معهد التمويل الدولي، وعدد قليل مناقشتها في مشاكل التفاصيل بروتينات معينة، السنترومير الحيز الحركي 1-4 وهكذا، وتطوير وسائل معهد التمويل الدولي تلطيخ وفحص معهد التمويل الدولي الكمي التقارير إلى تحليل تحديدا كل من البروتين السنترومير الحيز الحركي أمر مهم للغاية. في معهد التمويل الدولي تلطيخ، ينبغي للمرء أن المضي قدما في بروتوكول تلطيخ لتجنب فقدان البروتين في المصالح أوبقية الخلية. ومع ذلك، تثبيت يدمر مواقع المستضدات في بعض الأحيان، ومختلف مجموعات الضد مستضد عمل سيئة مع تثبيتي واحد، ولكن بشكل جيد جدا مع آخر، 21 واختيار تثبيتي يعتمد إلى حد كبير على البروتين (ق) من الفائدة. لذلك، وأساليب مختلفة تثبيتي حاسمة في تلطيخ معهد التمويل الدولي من البروتينات السنترومير الحيز الحركي.

وقد تم تطوير أساليب هنا الأمثل للمناعي غير مباشر (معهد التمويل الدولي) تلطيخ ومقايسة لمعالجة توطين البروتينات السنترومير الحيز الحركي الذاتية، بما في ذلك CENP-A والعلم الموسومة الخارجية البروتينات CENP-A، والكميات من هذه البروتينات في الخلايا البشرية. ويمكن تطبيق هذه الأساليب لتحليل البروتينات السنترومير الحيز الحركي في الأنواع الأخرى.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. خلية الثقافة وترنسفكأيشن

  1. وضع غطاء زجاجي (22 ملم × 22 ملم) في لوحة البوليسترين 6 جيدا. معطف اختياريا غطاء زجاجي مع بولي-L-ليسين، 0.1٪ ث / ت، في الماء (انظر قائمة المواد / المعدات) للحفاظ على الخلايا الإنقسامية على الزجاج غطاء باتباع الخطوات التالية:
    ملاحظة: يجب تحديد الظروف المثلى لكل خط الخلية والتطبيق.
    1. جو معقم و مطهر سطح الثقافة معطف مع بولي-L-ليسين، 0.1٪ ث / ت، في الماء (0.4 مل / بئر لوحة 6 جيدا البوليسترين). صخرة بلطف لضمان حتى طلاء السطح الثقافة.
    2. بعد 5 دقائق، وإزالة حل بواسطة طموح ويشطف جيدا السطح مع الأنسجة المعقمة للمياه ثقافة الصف.
    3. الجافة على الأقل 2 ساعة قبل إدخال الخلايا والمتوسطة.
  2. البذور خلايا هيلا هيلا 17 أو تيت أوف خلايا 17،22 على غطاء زجاجي (22 ملم × 22 ملم) وضعها في لوحة البوليسترين 6 جيدا. تأكد من أن كثافة الخلية هي 5.4 × 10 5 لكل بئر. الخلايا ثقافةفي DMEM عالية الجلوكوز مع FBS 10٪ و 1٪ البنسلين ستربتومايسين.
    ملاحظة: للحصول على أفضل النتائج، وتحديد تجريبيا كثافة الخلايا لاستخدامها في البذر.
  3. احتضان الخلايا عند 37 درجة مئوية في جو من 5٪ CO 2 لمدة 18 ساعة.
    ملاحظة: في حالة من خلايا هيلا تيت أوف، نسخ من الجين خارجي نشطا في غياب محفز (أي، التتراسيكلين / الدوكسيسيكلين) لذا الخلايا ثقافة دون التتراسيكلين / الدوكسيسيكلين وtransfect عابر مع ناقلات overexpression pTRM4 (الجدول 2 )، الذي ينظمه المروج TRE النسخ (أنظر أدناه).
  4. ثمانية عشر ساعة بعد خلايا البذر، transfect على النحو التالي:
    1. جعل حل وعن طريق خلط 1.5 ميكرولتر سيرنا بنسبة ضئيلة (20 ميكرومتر الأسهم صلب، الجدول 1) و / أو 2.0 ميكروغرام البلازميد (الجدول 2) في 50 ميكرولتر خفض سيرم (انظر قائمة المواد / المعدات)، واحتضان في RT لمدة 5 دقائق .
      ملاحظة: في هذا التحليل،وكان شارك في transfected لاستخدامها في بروتوكولات 3 و 4 (انظر مناقشة)؛ CA-UTR الرناوات siRNAs (الجدول 1 خليط من 5 'و 3' UTR سيرنا).
    2. جعل حل B عن طريق خلط 0.75 ترنسفكأيشن كاشف ميكرولتر أنا (انظر قائمة المواد / المعدات) في 50 ميكرولتر انخفاض متوسط ​​مصل، واحتضانها في RT لمدة 5 دقائق.
      ملاحظة: خطوة اختيارية هي إضافة 1.0 ميكرولتر ترنسفكأيشن الكاشف الثاني (انظر قائمة المواد / المعدات).
    3. مزيج حلول A و B معا، واحتضانها في RT لمدة 15 دقيقة.
    4. غسل الخلايا المستزرعة مرة واحدة مع برنامج تلفزيوني، ثم إضافة 500 ميكرولتر خفض سيرم إلى كل بئر من لوحة البوليسترين 6 جيدا. يضاف خليط من الحلول A و B (أي RNA و / أو مجمع الحمض النووي الدهون) مباشرة إلى كل من الفرد أيضا.
      ملاحظة: التركيز النهائي هو 3.3 ميكروغرام / مل (البلازميد)؛ 50 نانومتر (سيرنا).
    5. احتضان الخلايا عند 37 درجة مئوية في جو من 5٪ CO 2 ل 4.5 ساعة. تغيير متوسطة إلى عالية الجلوكوز DMEM خفة دمح 10٪ FBS و 1٪ البنسلين ستربتومايسين.
    6. احتضان الخلايا عند 37 درجة مئوية في جو من 5٪ CO 2 ل48-72 ساعة بعد ترنسفكأيشن.
      ملاحظة: للحصول على أفضل النتائج، وفترة حضانة لنمو الخلايا قبل التثبيت يجب أن يتحدد تجريبيا، واستنزاف البروتين و / أو يجب تأكيد التعبير عن طريق تحليل لطخة غربية (انظر بروتوكول 6).
    7. إذا تحليل الخلية الإنقسامية هو من الفائدة، إضافة باكليتاكسيل (10 نانومتر) إلى الخلايا المستزرعة 24 ساعة قبل التثبيت، أو إضافة TN16 (0.5 ميكرومتر) إلى الخلايا المستزرعة 2.5 ساعة قبل التثبيت.

2. خلية التثبيت ومناعي تلطيخ لكشف البروتينات الذاتية السنترومير-الحيز الحركي (امتصاص العرق التثبيت)

  1. إعداد تثبيتي، ومخازن، والكواشف.
    1. حديثا تجهيز 50 مل من محلول بارافورمالدهيد 4٪ في برنامج تلفزيوني، ودرجة الحموضة 7.4.
      1. إضافة 40 مل من 1 × PBS إلى دورق زجاجي على طبق من ضجة في غطاء التهوية. الحرارة في حين stirrinز إلى ما يقرب من 60 درجة مئوية. إضافة 2 غرام من مسحوق امتصاص العرق إلى برنامج تلفزيوني ساخنة.
      2. رفع ببطء درجة الحموضة بإضافة 1 مل من 1 N هيدروكسيد الصوديوم في المجموع، لأن مسحوق لم تنحل فورا.
        ملاحظة: الحل يزيل بعد إضافة هيدروكسيد الصوديوم.
      3. مرة واحدة قد حلت امتصاص العرق، بارد وتصفية الحل.
      4. ضبط درجة الحموضة مع 1 N حمض الهيدروكلوريك إلى 7.4 درجة الحموضة وحجم حل مع 1 × PBS إلى 50 مل.
        ملاحظة: أجزاء مأخوذة من الحل يمكن تجميد أو تخزينها في 2-8 درجة مئوية لمدة طالما 1 أسبوع. وينبغي أن يكون الحل من الجليد البارد أو تخزينها في 4 درجة مئوية حتى يصبح لاستخدامها.
    2. تجهيز 50 مل من KB1 العازلة، والذي يتألف من 10 ملي تريس، حمض الهيدروكلوريك، ودرجة الحموضة 7.5. 150 ملي مول كلوريد الصوديوم. 0.5٪ BSA. و 0.5٪ تريتون X-100.
      ملاحظة: BSA ينبغي أن تضاف حديثا.
      ملاحظة: المخزن المؤقت KB سلسلة تستند KB عازلة وصفها في التقارير السابقة 1،2،4.
    3. تجهيز 50 مل من KB2 العازلة، والذي يتألف من 10 ملي تريس، حمض الهيدروكلوريك،7.5 درجة الحموضة. 150 ملي مول كلوريد الصوديوم. و 0.5٪ BSA.
      ملاحظة: BSA ينبغي أن تضاف حديثا.
    4. إعداد 1 مل من KB3 العازلة التي تحتوي على دابي (50 نانوغرام / مل).
    5. إعداد 100 مل من تصاعد المتوسط، والذي يتكون من 1 ملغ / مل ف phenylenediamine. 10٪ في برنامج تلفزيوني، و 90٪ الجلسرين.
      1. ضبط درجة الحموضة من 1 × برنامج تلفزيوني إلى 9.8 مع 1 N هيدروكسيد الصوديوم، حل ف phenylenediamine في الحل، ثم قم بإضافة الجلسرين.
      2. مخزن 1 مل aliquots في -80 درجة مئوية. يحفظ بعيدا عن الضوء.
  2. إزالة مستنبت بواسطة الطموح في 48-72 ساعة بعد ترنسفكأيشن (انظر البروتوكول 1) لتثبيت الخلية. خلايا شطف مرة واحدة مع برنامج تلفزيوني. تطبيق برنامج تلفزيوني إلى جانب الآبار ثقافة لتجنب إزعاج سطح الخلايا.
    ملاحظة: يجب تحديد نقطة زمنية المثلى لتثبيت الخلية تجريبيا.
  3. إصلاح الخلايا في بارافورمالدهيد 4٪ في برنامج تلفزيوني لمدة 30 دقيقة على 4 درجات مئوية. شطف الخلايا مرتين مع KB2 عازلة لإزالة بما فيه الكفاية المتبقية 4٪ لامتصاص العرق.
  4. Permeabiليز العينات في KB1 عازلة لمدة 30 دقيقة في RT. شطف خلايا مرة واحدة مع KB2 العازلة، وإضافة KB2 عازلة لمدة 5 دقائق على RT لمواقع كتلة إضافية من ملزمة انوعي.
    ملاحظة: المخزن المؤقت KB1 أيضا يساهم بشكل كبير في عرقلة.
  5. إزالة الغطاء الزجاجي (22 ملم × 22 ملم) من لوحة البوليسترين 6-جيدا باستخدام ملقط. بمانع القلم مسعور (انظر قائمة المواد / المعدات)، رسم مربع أخضر شاحب أو دائرة لتشكيل حاجز مسعور حول كل عينة غطاء زجاجي. لا تلمس أو الاقتراب جدا من الخلايا التي تحتوي على قلم حاجز مسعور. وضع غطاء زجاجي في 6 جيدا جديدة لوحة البوليسترين.
  6. تمييع الأجسام المضادة الأولية لالسنترومير أو البروتين الحيز الحركي (نسبة التخفيف من 1: 100 إلى 1: 200؛ وانظر أيضا قائمة من المواد / المعدات) وإما الأجسام المضادة لمكافحة CENP-B (نسبة التخفيف من 1: 400) أو المضادة السنترومير الأجسام المضادة (ACA) (نسبة التخفيف من 1: 2000) كعلامة السنترومير موقع في KB2 العازلة.
    ملاحظة: للحصول على أفضل النتائج، وconcentra النهائييجب تحديد نشوئها من الأجسام المضادة الأولية في هذا الحل تجريبيا.
  7. تطبيق كمية كافية (حوالي 30 ميكرولتر) من الأجسام المضادة الأولية المخفف لتزج عينة الخلية. احتضان عينة الخلايا لمدة 1 ساعة عند 37 درجة مئوية. شطف الخلايا 3 مرات مع KB2 العازلة.
  8. باستخدام KB2 عازلة، تمييع الضد الثانوي fluorophore مترافق (نسبة التخفيف من 1: 100-1: 200) موجهة ضد كل الأجسام المضادة الأولية.
    ملاحظة: للحصول على أفضل النتائج، لا بد من تحديد تركيز النهائي من الأجسام المضادة الثانوية في هذا الحل تجريبيا.
  9. تطبيق حجم كاف (قطرة من كاليفورنيا 30 ميكرولتر على غطاء زجاجي) من الأجسام المضادة الثانوية المخفف لتزج عينة الخلية. احتضان عينة الخلايا لمدة 1 ساعة عند 37 درجة مئوية. شطف الخلايا 5 مرات مع KB2 العازلة خلال فترة 30 دقيقة (خمسة 6 يغسل دقيقة).
    ملاحظة: للحصول على أفضل النتائج (أي لفقدان الحد الأدنى من الخلايا)، وحالة غسل الأمثل يجب أن يتحدد empiricaLLY.
  10. تطبيق حجم كاف من KB3 العازلة التي تحتوي على دابي (50 نانوغرام / مل) أن تزج عينة الخلية. احتضان عينة خلية لمدة 5 دقائق على RT. شطف خلايا 1-2 مرات مع KB2 العازلة.
  11. تركيب الغطاء الزجاجي الذي يحتوي على عينة الخلايا على الشريحة الصغيرة.
    1. ضع قطرة من تصاعد المتوسطة في وسط الشريحة الصغيرة.
    2. إزالة السائل من عينة الخلية، وباستخدام اليدين أو ملقط، ضع العينة في وسط الشريحة الصغيرة. تجنب فقاعات الهواء.
    3. إزالة المتوسطة المتزايدة الزائدة مع منشفة ورقية.

3. خلية التثبيت ومناعي تلون C-محطة الموسومة العلم CENP-A البروتينات (الأسيتون التثبيت)

  1. تجهيز
    1. إعداد المثلج 75٪ الأسيتون.
    2. حديثا تجهيز 50 مل من برنامج تلفزيوني (الرقم الهيدروجيني 7.4) التي تحتوي على الحليب الخالي من الدسم 0.5٪ و 0.5٪ BSA.
    3. حديثا تجهيز 50 مل من برنامج تلفزيوني (الرقم الهيدروجيني 7.4) التي تحتوي على الحليب الخالي من الدسم 0.1٪ و 0.1٪ BSA.
    4. إعداد 1 مل من برنامج تلفزيوني (ودرجة الحموضة 7.4) التي تحتوي على دابي (50-100 نانوغرام / مل).
    5. إعداد 100 مل من تصاعد المتوسط ​​كما هو موضح في 2.1.5.
  2. إزالة مستنبت بواسطة الطموح في 48-72 ساعة بعد ترنسفكأيشن (انظر البروتوكول 1) لتثبيت الخلية. خلايا شطف مرة واحدة مع برنامج تلفزيوني. تطبيق برنامج تلفزيوني إلى جانب البئر ثقافة لتجنب إزعاج سطح الخلايا.
    ملاحظة: يجب تحديد نقطة زمنية المثلى لتثبيت الخلية تجريبيا.
  3. إصلاح الخلايا في الجليد الباردة 75٪ الأسيتون، واحتضان الخلايا لمدة 10 دقيقة في درجة حرارة -20 درجة مئوية. الخلايا الجافة على الغطاء الزجاجي في غطاء الدخان لمدة 30-60 دقيقة في RT.
    ملاحظة: للحصول على أفضل النتائج، لا بد من تحديد المدة الزمنية اللازمة لتثبيت وخلية تجفيف تجريبيا.
  4. باستخدام حاجز القلم مسعور (انظر قائمة المواد / المعدات)، رسم مربع أخضر شاحب أو دائرة لتشكيل حاجز مسعور حول كل عينة غطاء زجاجي. لا تلمس أو الاقتراب جدا من الخلايا التي تحتوي على قلم حاجز مسعور.
  5. كتلة nonspecIFIC مواقع على الخلايا ملزمة بإضافة برنامج تلفزيوني يحتوي الحليب الخالي من الدسم 0.5٪ و 0.5٪ BSA لمدة 5 دقائق على RT.
  6. باستخدام برنامج تلفزيوني يحتوي الحليب الخالي من الدسم 0.1٪ و 0.1٪ BSA، وتمييع الأجسام المضادة ضد العلم (1: 1000 نسبة التخفيف) وإما الأجسام المضادة لمكافحة CENP-B (نسبة التخفيف من 1: 200) أو هيئة مكافحة الفساد (نسبة 1: 2000 تخفيف ) كعلامة السنترومير الموقع.
    ملاحظة: للحصول على أفضل النتائج، لا بد من تحديد تركيز النهائي من الأجسام المضادة الأولية في هذا الحل تجريبيا.
  7. تطبيق كمية كافية (حوالي 30 ميكرولتر) من الأجسام المضادة الأولية المخفف لتزج عينة الخلية. احتضان عينة الخلايا لمدة 1 ساعة عند 37 درجة مئوية. شطف الخلايا 5 مرات مع عازلة تمنع خلال فترة 30 دقيقة.
    ملاحظة: يمكن أن تشطف الخلايا مع برنامج تلفزيوني. لأفضل النتائج (أي، لتجنب فقدان الخلايا)، يجب أن تحدد الشروط غسل الأمثل تجريبيا.
  8. تمييع الضد الثانوي fluorophore مترافق (نسبة التخفيف من 1: 100-1: 200) موجهة ضدعلى كل الأجسام المضادة الأولية في برنامج تلفزيوني يحتوي الحليب الخالي من الدسم 0.1٪ و 0.1٪ BSA.
    ملاحظة: للحصول على أفضل النتائج، لا بد من تحديد تركيز النهائي من الأجسام المضادة الثانوية في هذا الحل تجريبيا.
  9. تطبيق كمية كافية (حوالي 30 ميكرولتر) من الأجسام المضادة الثانوية المخفف لتزج عينة الخلية. احتضان عينة الخلايا لمدة 1 ساعة عند 37 درجة مئوية. شطف الخلايا 2 مرات مع برنامج تلفزيوني يحتوي الحليب الخالي من الدسم 0.1٪ و 0.1٪ BSA.
    ملاحظة: برنامج تلفزيوني وحدها يمكن أن تستخدم أيضا لغسل الخلايا.
  10. تطبيق حجم كاف من برنامج تلفزيوني تحتوي على دابي (50-100 نانوغرام / مل) أن تزج عينة الخلية. احتضان عينة خلية لمدة 5 دقائق على RT. شطف خلايا 1-2 مرات مع برنامج تلفزيوني.
  11. تركيب الغطاء الزجاجي الذي يحتوي على عينة الخلايا على الشريحة الصغيرة كما هو موضح في 2.11.

4. خلية التثبيت ومناعي تلطيخ من N-محطة الموسومة العلم CENP-A البروتينات (الميثانول التثبيت)

  1. تجهيز
    1. تحضير الميثانول الجليد الباردة.
    2. إعداد TBS (الرقم الهيدروجيني 7.4) التي تحتوي على 4٪ مصل الماعز.
    3. إعداد 1 مل من TBS (الرقم الهيدروجيني 7.4) التي تحتوي على دابي (50-100 نانوغرام / مل).
    4. إعداد 100 مل من تصاعد المتوسط ​​كما هو موضح في 2.1.5.
  2. إزالة مستنبت بواسطة الطموح في 48-72 ساعة بعد ترنسفكأيشن (انظر البروتوكول 1) لتثبيت الخلية. خلايا شطف مرة واحدة مع TBS. تطبيق TBS إلى جانب الآبار ثقافة لتجنب إزعاج سطح الخلايا.
    ملاحظة: يجب تحديد نقطة زمنية المثلى لتثبيت الخلية تجريبيا.
  3. إصلاح الخلايا في الميثانول الجليد الباردة، واحتضان الخلايا لمدة 6 دقائق عند درجة حرارة -20 درجة مئوية. شطف الخلايا مرتين مع TBS لإزالة بما فيه الكفاية الميثانول المتبقية.
  4. بمانع القلم مسعور (انظر قائمة المواد / المعدات)، رسم مربع أخضر شاحب أو دائرة لخلق حاجز مسعور حول كل عينة غطاء زجاجي. لا تلمس أو الاقتراب جدا من الخلايا التي تحتوي على قلم حاجز مسعور.
  5. حجب المواقع ملزمة غير محددة على سلليرة سورية وذلك بإضافة TBS تحتوي على 4٪ مصل الماعز. احتضان لمدة 10 دقيقة في RT.
  6. تمييع الأجسام المضادة ضد العلم (1: 1000 تمييع) وإما الأجسام المضادة لمكافحة CENP-B (نسبة التخفيف من 1: 200) أو هيئة مكافحة الفساد (1: 2000 نسبة تمييع) باعتباره السنترومير موقع علامة في TBS تحتوي على 4٪ مصل الماعز .
    ملاحظة: للحصول على أفضل النتائج، لا بد من تحديد تركيز النهائي من الأجسام المضادة الأولية في هذا الحل تجريبيا.
  7. تطبيق كمية كافية (حوالي 30 ميكرولتر) من الأجسام المضادة الأولية المخفف لتزج عينة الخلية. احتضان عينة الخلايا لمدة 1 ساعة عند 37 درجة مئوية. شطف الخلايا 5 مرات مع عازلة تمنع خلال فترة 30 دقيقة. لأفضل النتائج (أي فقدان الحد الأدنى من الخلايا)، لا بد من تحديد حالة غسل الأمثل تجريبيا.
  8. تمييع الضد الثانوي fluorophore مترافق (نسبة التخفيف من 1: 100-1: 200) موجهة ضد كل الأجسام المضادة الأولية في TBS تحتوي على 4٪ مصل الماعز.
    ملاحظة: للحصول على أفضل النتائج، والاتحاد الدولي للسباحةيجب تحديد تركيز لتر من الأجسام المضادة الثانوية في هذا الحل تجريبيا.
  9. تطبيق كمية كافية (حوالي 30 ميكرولتر) من الأجسام المضادة الثانوية المخفف لتزج عينة الخلية. احتضان عينة الخلايا لمدة 1 ساعة عند 37 درجة مئوية. شطف الخلايا 3 مرات مع العازلة الحجب.
  10. تطبيق حجم كاف من TBS تحتوي على دابي (50-100 نانوغرام / مل) أن تزج عينة الخلية. احتضان عينة خلية لمدة 5 دقائق على RT. شطف خلايا 1-2 مرات مع TBS.
  11. تركيب الغطاء الزجاجي الذي يحتوي على عينة الخلايا على الشريحة الصغيرة كما هو موضح في 2.11.

5. المناعي صورة للمراقبة، شراء، الكميات، وتحليل

  1. مراقبة عينة الخلية من خلال المجهر مضان الآلية مجهزة عدسة 63X 100X والغمر النفط، مصدر خارجي ضوء المدمجة، وكاميرا CCD الرقمية.
  2. أداء الحصول على الصور ومعالجتها، بما في ذلك deconvolution، باستخدام البرمجياتA، أو برامج B1 و B2 (انظر قائمة المواد / المعدات). يرجى الاطلاع التكميلي Files الرمز (5.2.1) لجميع الأوامر المستخدمة في البرامج A. لجميع الأوامر المستخدمة في برامج B1 و B2، يرجى الاطلاع على (5.2.2) في ملفات التعليمات البرمجية التكميلي.
  3. استخدام الأسلوب هو موضح سابقا 23-25 ​​لتحديد إشارات من البروتينات السنترومير الحيز الحركي (على سبيل المثال، وتبقى إشارات CENP-A في السنترومير) مع تعديلات طفيفة التالية:
    1. حدد منطقة البروتينات السنترومير الحيز الحركي والخلفية على النحو التالي:
      1. الخلية الإنقسامية: (منطقة السنترومير الحيز الحركي) حدد منطقة متداخلة مع الكروموسومات ملطخة دابي. (المنطقة الخلفية) ومنطقة خارج الكروموسومات ولكن داخل خلية واحدة متطابقة (المنطقة أي عصاري خلوي).
      2. الخلية الطور البيني: (منطقة السنترومير الحيز الحركي) حدد منطقة متداخلة مع لونين ملطخة دابي. (المنطقة الخلفية) ومنطقة خارج لونين ولكن داخل خلية واحدة مماثلة (<م> أي منطقة عصاري خلوي).
        ملاحظة: انظر القانون أيضا التكميلي الملفات (5.2.1.4.3) أو (5.2.2.6.4) لاختيار المنطقة مع البرامج أو البرامج B2، على التوالي.
    2. تحديد النسبة المئوية للإشارات المتبقية في القسيم باستخدام البرامج أو B. لهذه المهمة، استخدم الصيغة التالية:
      تبقى إشارات من البروتين السنترومير-الحيز الحركي في السنترومير-الحيز الحركي
      Equation1
      حيث الصورة هو سطوع إشارة من المنطقة المحددة، وهو ما يؤكده ACA أو CENP-B تلطيخ، ب هي سطوع إشارة الخلفية؛ عينة ص هي ACA إشارة أو CENP-B إشارات لسيرنا (ق) الخلايا المعالجة بالإثير. وص السيطرة هو ACA إشارة أو إشارات CENP-B للخلايا transfected سيرنا لوك.
      ملاحظة: في هذا التحليل، تم استخدام إشارات CENP-B كإشارات مرجعية لCUL4A وRBX1 كما هو موضح في التقارير السابقة.
    3. استخدام ملف Excel لهذا الحساب بعد نسخ ولصق البيانات الخام من البرنامج إشارة الكميات المذكورة أعلاه. انظر أيضا ملفات التعليمات البرمجية الإضافية: (5.2.1.4) و (5.2.2.6) لمزيد من التفاصيل. ويظهر أحد الأمثلة على حساب في الجدول 3.
  4. تحليل لا يقل عن 20 خلايا للقضاء على التفاوت في تلطيخ والحصول على الصور لكل مستوى القياس. اختياريا استخدام "قيمة المتوسط" ما تبقى من إشارات السنترومير الحيز الحركي لكل تحليل الخلية لمقارنة هذه القيم بين البروتينات السنترومير الحيز الحركي المختلفة.

6. الغربية تحليل وصمة عار من البروتين الكلي

  1. resuspend الخلايا في تغيير طبيعة العازلة ألف (20 ملي تريس، حمض الهيدروكلوريك، ودرجة الحموضة 7.4 و 50 ملي كلوريد الصوديوم، 0.5٪ Nonidet P-40؛ 0.5٪ deoxycholate؛ 0.5٪ SDS، 1 ملم EDTA، والكامل خالية من EDTA مثبط البروتياز كوكتيل)، 26 موضوع التعليق لصوتنة وتجميد عملية ذوبان الجليد، وقياستركيزات البروتين على النحو التالي:
    1. وفيما يتعلق بعملية صوتنة، إضافة 50 ميكرولتر من العازلة ألف من الخلايا التي تم جمعها من بئرين لوحة البوليسترين 6 جيدا في 48-72 ساعة بعد ترنسفكأيشن (انظر البروتوكول 1). تشغيل sonicator مجهزة القرن اختلال وmicrotip (انظر قائمة المواد / المعدات) لمجموع 15 ثانية مدة متقطعة النبض (دورة عمل 50٪) في عينة واحدة.
    2. لتجميد عملية ذوبان الجليد، وتجميد الخلايا مع النيتروجين السائل وذوبان الجليد الخلايا في RT.
    3. قياس تركيز البروتين باستخدام التجارية البروتين الفحص الكاشف الأول أو الثاني (انظر قائمة المواد / المعدات).
      والمخفف لست] مع نسبة 01:10 في قياس تركيزات البروتين مع أي كاشف الأول أو الثاني: مذكرة. وفي هذا التخفيف والحاضر SDS في المخزن ويظهر التدخل ضئيلة أو معدومة في هذا القياس.
  2. خلط المحللة التي تحتوي على 20-30 ميكروغرام من البروتين الكلي مع العازلة تحميل 2 × أو 4 × SDS-PAGE 27 تغلي العينات ل5 دقائق ثم تحميلها على 12.0٪ -15.0٪ تغيير طبيعة هلام SDS-بولي أكريلاميد لالكهربائي.
  3. نقل البروتينات مفصولة SDS-PAGE على غشاء PVDF باستخدام طريقة النشاف الغربية التي سبق وصفها. 17،24،27-31
    1. منع مواقع الربط غير محددة على الغشاء مع 5٪ الحليب الخالي من الدسم في 1 × PBS، ثم احتضان الغشاء مع حلول الأجسام المضادة الأولية مخففة لمدة 1 ساعة على RT. انظر قائمة المواد / المعدات للحصول على معلومات مفصلة (على سبيل المثال، نسبة التخفيف) من كل الأجسام المضادة الأولية.
    2. بعد غسل مرات غشاء 3-4 (كل حضانة 3- إلى 5 دقيقة مع اهتزاز) مع برنامج تلفزيوني-T عازلة (1 × برنامج تلفزيوني و 0.1٪ توين-20)، احتضان الغشاء في خليط من الأشعة تحت الحمراء القريبة (الأشعة تحت الحمراء) الأجسام المضادة الثانوية صبغ مترافق فلوري (نسبة التخفيف من 1: 20،000)، والأجسام المضادة الثانوية DyLight مترافق (نسبة التخفيف من 1: 20،000)، و / أو الفجل البيروكسيديز (HRP) -conjugated الأجسام المضادة الثانوية (المخفف في برنامج تلفزيوني-T، dilutiعلى نسبة 1: 10،000) لمدة 1 ساعة على RT. انظر قائمة المواد / المعدات للحصول على معلومات مفصلة (على سبيل المثال، نسبة التخفيف) من كل الأجسام المضادة الثانوية.
  4. غسل غشاء 3 مرات، ثم مسح غشاء لتحليل البروتينات مع نظام التصوير بالأشعة تحت الحمراء و / أو تصوير التوهج للكشف عن طخة مناعية (انظر قائمة المواد / المعدات).
    1. لاستخدام نظام التصوير بالأشعة تحت الحمراء، انظر (6.4.1) في ملفات التعليمات البرمجية التكميلي.
    2. لاستخدام تصوير التوهج، انظر (6.4.2) في ملفات التعليمات البرمجية التكميلي. استخدام فائقة الحساسية تعزيز chemiluminescent (ECL) الركيزة (انظر قائمة المواد / المعدات) لهذا النظام.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

التحليل المناعي من الذاتية CENP-A تدعم الفرضية القائلة بأن هناك حاجة CUL4A-E3 يغاز لتوطين CENP-A إلى القسيم
وأظهرت لنا الدراسات الحديثة أن CUL4A-RBX1-COPS8 E3 النشاط يغاز مطلوب للubiquitylation من ليسين 124 (K124) على CENP-A وتوطين CENP-A إلى القسيم. 17 في البداية، تم عزل مجمع البيني-السنترومير (ICEN) من خلال مكافحة CENP-A: أصلي لونين مناعي، 32-34، وقد افترض أن بعض البروتينات ICEN قد تلعب دورا في توطين CENP-A إلى القسيم. لذلك، أجريت سيرنا التجارب ضربة قاضية للكشف عن البروتينات التي يسببها عدم تمركز CENP-A في القسيم 17 غياب التعبير (لا تظهر البيانات): و transfected خلايا هيلا المتزايد بشكل غير متزامن مع Cullin 4A (CUL4A) سيرنا أو سيرنا RBX1 للمرة اللازمة لاستنزاف البروتين الأمثل (48 ساعة ص لCUL4A و 72 ساعة لRBX1). أظهرت خلايا transfected مع CUL4A سيرنا على عدم تمركز كبير من CENP-A في القسيم (الشكل 1A-C). كما رأينا في الشكل 2G، كانت مستويات البروتين من CENP-A في إجمالي لست] خلية من خلايا transfected سيرنا CUL4A مماثلة لمستويات CENP-A في لست] من وسيفيراز (لوك) خلايا transfected سيرنا في ظل الظروف الثقافة نفسها. تم استبعاد إمكانية الآثار بعيدا عن الهدف من CUL4A سيرنا، لأن التعبير خارج الرحم من CUL4A-العلم انقاذ الحد من CENP-A في القسيم عندما استهدفت CUL4A سيرنا على 'UTR 3 (الشكل 2A-C). وأكد مستويات البروتين من CENP-A في إجمالي لست] الخلية لتكون مماثلة لمستويات CENP-A في لست] من خلايا transfected سيرنا لوك في ظل الظروف الثقافة نفسها بغض النظر عن (1B الأرقام، 2G) مرحلة دورة الخلية. وبالتالي، فإن احتمال أن CUL4A نضوب تسبب-A CENP تم القضاء على تدهور البروتين.

FO: المحافظة على together.within الصفحات = "1"> Cullin-RING-E3 ligases اليوبيكويتين (كرلس) هي الطبقة الأكثر بروزا من اليوبيكويتين ligases 35 وتحتوي على 3 عناصر رئيسية هي: سقالة cullin، وهو بروتين البنصر (RBX1 أو RBX2)، وE2 انزيم المشحونة اليوبيكويتين أن يتم تجنيده من قبل RBX1 أو RBX2، 36 حلقة البروتين إصبع المجندين أيضا محول الركيزة التي تضع ركائز في القرب من انزيم E2 لتسهيل نقل اليوبيكويتين. يسببها 36 الرناوات siRNAs RBX1 انخفاض كبير في CENP-A في القسيم (1D الشكل-F) في ظل الظروف التي كانت مستويات البروتين من CENP-A في إجمالي لست] خلية من RBX1 الخلايا transfected سيرنا مماثلة لمستويات CENP-A في لست] من خلايا transfected سيرنا لوك (الشكل 2G). لم يكن لوحظ تدهور CENP-A البروتين إما عن طريق استنزاف RBX1 أو عن طريق الجمع بين CUL4A واستنزاف RBX1 في ظل الظروف الثقافة نفسها (الشكل 2G). إمكانية تأثير بعيدا عن الهدفتم استبعاد الصورة من RBX1 سيرنا، لأن التعبير خارج الرحم من العلم-RBX1 انقاذ الحد من CENP-A في القسيم عندما استهدفت RBX1 سيرنا على 'UTR 3 (الشكل 2D-F). وتشير هذه النتائج إلى أن CUL4A-RBX1-E3 يغاز مطلوب على وجه التحديد لتوطين CENP-A إلى القسيم.

التحليل المناعي للدخيلة CENP-A - البروتينات العلم إلى أن CENP-A K124 ubiquitylation أمر ضروري لتوطين CENP-A إلى القسيم
في السابق، وأظهر تحليلنا الطيف مناعي الشامل التي ليسين 124 (K124) من CENP-A-العلم وubiquitylated في خلايا هيلا 17 في التركيب البلوري للCENP-A جسيم نووي، K124 يقيم في الحلزون α3، على الرغم من أن الموقع هو لا داخل المنطقة CATD. 17 وبالإضافة إلى ذلك، يتم حفظها K124 بين الثدييات والطيور والزواحف والنباتات ومجموعة من الفطريات (على سبيل المثال، برعمدينغ الخميرة). 17 CENP-A المسوخ يسين (الشكل 3A) تم بناء واختبار قدرتها على توطين لالسنترومير. وقد لوحظ إلغاء كبيرا من توطين القسيم المركزي للدخيلة CENP-A متحولة K124R مع إشارات منتشر في كل الإنقسامية والبيني خلايا هيلا (الشكل 3B، C). كان السنترومير التعريب لم تتأثر بشكل كبير لا من الطفرات K9A (K9 يتوافق مع هيستون H3 مثيلة K9) ولا الطفرات K77R (K77 هو موقع يسين فريدة من نوعها في CATD) (الشكل 3B، C).

وبناء على هذه النتائج، يقترح اثنين من الفرضيات بشأن وظيفة في الجسم الحي من CENP-A ubiquitylation في K124. أولا، دور K124 ubiquitylation هو التحلل البروتيني بوساطة اليوبيكويتين للقضاء على overexpressed و / أو mislocalized CENP-A إلى كروماتين حقيقي. ثانيا، دور CENP-A ubiquitylation على K124 هو لتحميل CENP-A على القسيم. لاختبار وإمكانية أوال، وقد تناولت بثبات من نوع CENP-A-العلم البرية ومتحولة K124R فضلا الذاتية CENP-A بعد سيكلوهيكسيميد (فروج) علاج CUL4A- أو الخلايا المنضب RBX1. وتشير هذه البيانات إلى أن ubiquitylation من K124 ربما لا تشارك في التحلل البروتيني بوساطة اليوبيكويتين للقضاء على overexpressed و / أو mislocalized CENP-A (لا تظهر البيانات). 17. وعلاوة على ذلك، تم التأكيد على أن الطفرة K124R تلغي المفترضة monoubiquitylation وdiubiquitylation العصابات، سواء في المجراة في المقايسات ubiquitylation المختبر (لا تظهر البيانات). 17 بشكل جماعي، وتشير هذه البيانات إلى أن مجمع CUL4A-RBX1 يساهم في "إشارات" ubiquitylation، وهو مطلوب لCENP-A التعريب في القسيم.

التحليل المناعي من العلم خارجي - البروتينات CENP-A يشير إلى أن monoubiquitin الانصهار كافية لتحميلCENP-A K124R في القسيم
واستنادا إلى النتائج أعلاه، كان الافتراض بأن monoubiquitin مرتبطة تساهميا بمثابة إشارة لCENP-A تحميلها على القسيم. لاختبار هذه الفرضية، وهو N-محطة الموسومة العلم وC-محطة-تنصهر اليوبيكويتين من النوع البري CENP-A ومتحولة K124R شيد CENP-A (الشكل 4A). تم استخدام متحولة monoubiquitin UB (K48R)، التي تفتقر إلى الموقع الرئيسي لpolyubiquitylation 37-39 أيضا لمنع تنصهر اليوبيكويتين CENP-A البروتين من polyubiquitylation المحتملة. من خلال التقاط إشارات مناعي ضد العلم، تم اختبار توطين القسيم المركزي من البروتينات المشفرة بواسطة هذه التركيبات. في حين أن العلم-CENP-A (K124) ألغى بشكل كبير توطين السنترومير من CENP-A (الشكل 4B و 4C، العمود [6])، وكلاهما العلم-CENP-A (WT) والعلم-CENP-A (WT) -Ub ( WT) الحفاظ على توطين السنترومير بها (الشكل 4B و 4C، والأعمدة [1] و [2]). الالعلم CENP-A (K124R) -Ub (K48R) بروتين يفترض تحاكي monoubiquitylated CENP-A، حيث أن هذا البروتين استعادة كبير توطين لالقسيم (الشكل 4C، مقارنة الأعمدة [5] و [6]) بشكل أكثر كفاءة مما كان CENP-A (K124R) -Ub (WT) (الشكل 4C، مقارنة الأعمدة [4] - [6]). أظهرت هذه البيانات أن monoubiquitylation ما يكفي لتوظيف CENP-A إلى القسيم.

الشكل 1
الشكل 1. تحليل المناعي من الذاتية CENP-A تدعم الفرضية القائلة بأن هناك حاجة CUL4A-E3 يغاز لتوطين CENP-A إلى القسيم (تم تكييف أرقام من Niikura وآخرون. 17). (A) CUL4A سيرنا عدم التمركز الناجم من CENP-A في القسيم. و transfected خلايا هيلا مع CUL4A أو وسيفيراز (لوك) سيرنا والمحتضنة لمدة 48 ساعة (الجدول 1). يمثل مقياس شريط 10 ميكرون. (ب) تحليل لطخة غربية من هيلا لست] خلية كاملة باستخدام نفس حالة الثقافة كما في (A). وخلايا تم حصادها 48 ساعة بعد ترنسفكأيشن مع CUL4A سيرنا أو لوك سيرنا (الجدول 1). خدم GAPDH كعنصر تحكم التحميل. (C) كمية لالذاتية CENP-A إشارات في القسيم هو مبين في الفقرة (أ). تم إجراء تطبيع الإشارات باستخدام خلايا transfected سيرنا لوك، ويتم عرض متوسط ​​النسب المئوية (± SD). **** P <0.0001 مقابل خلايا transfected سيرنا لوك (الطالب اختبار t). (D) RBX1 سيرنا عدم التمركز الناجم من CENP-A من القسيم. و transfected خلايا هيلا مع RBX1 أو لوك سيرنا (ق) والمحتضنة لمدة 72 ساعة (الجدول 1). يمثل مقياس شريط 10 ميكرون. (E) تحليل لطخة غربية من هيلا لست] خلية كاملة باستخدام نفس حالة الثقافة كما في (D). تم حصاد الخلايا بعد 72 ساعة ترنسفكأيشن مع RBX1 سص لوك سيرنا (ق) (الجدول 1). خدم GAPDH كعنصر تحكم التحميل. (F) كميا إشارات الذاتية CENP-A في القسيم هو مبين في (D). تم إجراء تطبيع الإشارات باستخدام خلايا transfected سيرنا لوك، ويتم عرض متوسط ​​النسب المئوية (± SD). **** P <0.0001 مقابل خلايا transfected سيرنا لوك (الطالب اختبار t). الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الشكل 2
الشكل 2. خلفية تتعلق الشكل 1 القسيم (تم تكييف أرقام من Niikura وآخرون 17). (A) من مصادر خارجية CUL4A-العلم إنقاذ تمركز CENP-A عندما استهدفت CUL4A سيرنا على 'UTR 3. هيلا تيت أوف سلكانت ثابتة ليرة سورية في 48 ساعة بعد cotransfection مع سيرنا (CUL4A # 2: 3 "الهدف UTR أو لوك، الجدول 1)، بالإضافة إلى بناء البلازميد (pTRM4-CUL4A-العلم أو النواقل؛ الجدول 2). المناعية 4-اللون: تلطيخ للدابي (الأزرق)؛ العلم؛ الذاتية CENP-B (أحمر)؛ والذاتية CENP-A (الأخضر)، تم تنفيذ وتم فرز الخلايا العلم إيجابية، ولكن يتم حذف الصور العلم البساطة. ملاحظة: CUL4A رقم 2 هو الهدف متطابقة كما هو موضح في الشكل 1A-C. يمثل مقياس شريط 10 ميكرون. (ب) تحليل لطخة غربية من هيلا تيت أوف لست] خلية كاملة وفقا لنفس حالة الثقافة كما هو مبين في الفقرة (أ). خدم GAPDH كعنصر تحكم التحميل. وتم قياس كمية (C) CENP-A إشارات في القسيم هو مبين في الفقرة (أ) من خلال المجهر بعد فرز الخلايا لعزل تلك ملزمة من قبل الأجسام المضادة لمكافحة العلم. تم إجراء تطبيع إشارات مع خلايا transfected مع لوك سيرنا بالإضافة إلى ناقل، وتظهر النسب المئوية متوسط ​​(± SD).**** P <0.0001 مقابل خلايا transfected مع لوك سيرنا بالإضافة إلى ناقلات (يسار العمود، الطالب اختبار t). (د) من مصادر خارجية العلم-RBX1 انقاذ تمركز CENP-A في السنترومير عندما استهدفت RBX1 سيرنا على 'UTR 3 . تم إصلاح خلايا هيلا في 72 ساعة بعد cotransfection مع سيرنا (RBX1 # 2: 3 "الهدف UTR أو لوك، الجدول 1)، بالإضافة إلى بناء البلازميد (pcDNA3-علم-RBX1 أو النواقل؛ الجدول 2). المناعية 4-اللون: تلطيخ للدابي (الأزرق)؛ العلم؛ الذاتية CENP-B (أحمر)؛ والذاتية CENP-A (الأخضر)، تم تنفيذ وتم فرز الخلايا العلم إيجابية، ولكن يتم حذف الصور العلم البساطة. يمثل مقياس شريط 10 ميكرون. (E) تحليل لطخة غربية من هيلا لست] خلية كاملة وفقا لنفس حالة الثقافة كما في (D). خدم GAPDH كعنصر تحكم التحميل. (F) وتم قياس كمية CENP-A إشارات في القسيم هو مبين في (D) بواسطة المجهر بعد فرز الخلايا لعزل تلك ملزمة ل ن مكافحة العلم الأجسام المضادة. تم إجراء تطبيع إشارات مع خلايا transfected مع لوك سيرنا بالإضافة إلى ناقل، وتظهر النسب المئوية متوسط ​​(± SD). **** P <0.0001 مقابل خلايا transfected مع لوك سيرنا بالإضافة إلى ناقلات (يسار العمود، الطالب اختبار t). (G) استنفاد CUL4A وRBX1 لم يؤثر على مستويات الذاتية CENP-A البروتين. تم قياس مستويات الذاتية CENP-A البروتين في هيلا لست] خلية كاملة تحصد 72 ساعة بعد ترنسفكأيشن مع CUL4A، RBX1، CUL4A بالإضافة إلى RBX1، أو لوك سيرنا. بعد ثمانية وأربعين ساعة ترنسفكأيشن، كانت خلايا إما غير المعالجة (Asyn) أو تعامل مع باكليتاكسيل (+ الضريبة) للحث على اعتقال في الانقسام، وكانوا مثقف لمدة 24 ساعة. خدم GAPDH كعنصر تحكم التحميل. يرجى النقر هنا لمشاهدة نسخة أكبر من هذا الرقم.

32 / 53732fig3highres.jpg "العرض =" 700 "/>
وأشار شخصية تحليل 3. المناعي للبروتينات CENP-A-العلم الخارجية التي CENP-A K124 ubiquitylation مطلوب للCENP-A التعريب في القسيم (تم تكييف أرقام من Niikura وآخرون 17). (A) overexpression من CENP-A- وأكد ثوابت العلم (WT وKR المسوخ) من خلال تحليل لطخة غربية من هيلا تيت أوف لست] خلية كاملة. وخلايا تم حصادها 48 ساعة بعد ترنسفكأيشن مع pTRM4-CENP-A-العلم WT، المسوخ KR، أو ناقلات pTRM4 (الجدول 2). تم الكشف عن overexpression من CENP-A-العلم من قبل الأجسام المضادة لمكافحة العلم. خدم GAPDH كعنصر تحكم التحميل. وترد المفترضة CENP-A-العلم ديمر (##) وCENP-A-العلم مونومر (#). ملاحظة: تم الإبلاغ عن المقاومة للSDS dimers CENP-A سابقا 40،41 (ب) أظهر CENP-A متحولة K124R عدم التمركز تنتشر من القسيم. إشارات من دابي (الأزرق)، العلم (الجشعوترد تحكم موقع السنترومير)؛ n)، والذاتية CENP-B (أحمر. ملاحظة: على عكس الذاتية CENP-A في الخلايا transfected مع CUL4A أو سيرنا RBX1، إلى أن تستهدف القسيم، ربما لأن مستوى التعبير عنها ما يقرب من 10 ظهرت إشارات منتشرة في الخلايا التي overexpressed خارجي CENP-A K124R-العلم باعتباره النمط الظاهري للعجز - إلى 25 أضعاف أعلى من الذاتية CENP-A (لا تظهر البيانات) يمثل 17 مقياس شريط 10 ميكرون (C) المدرج الإحصائي من أنماط توطين هو مبين في (ب).. تم إحصاء أكثر من 50 الموالية / طليعة الطور والطورية الخلايا وأكثر من 200 خلية البيني في التجربة ≥ 3 تجارب). ويبين متوسط ​​النسب المئوية (± SD). "أخرى (غير السنترومير)" يشير الخلايا التالفة في الغالب، الخلايا الميتة، أو الخلايا مع التعريب نويي (فقط في الطور البيني)، ربما لأن ترنسفكأيشن أو غيرها من العلاجات. *** P <0.001 مقابل CENP-A WT-العلم (الطالب اختبار t).

الشكل (4)
وأشار شخصية تحليل 4. المناعي للبروتينات خارجية العلم-CENP-A التي CENP-A monoubiquitin الانصهار انقاذ تمركز في CENP-A متحولة K124R من القسيم (تم تكييف أرقام من Niikura وآخرون. 17). (أ) الرسوم تخطيطي من كل بناء المستخدمة في هذه الدراسة (انظر أيضا الجدول 2). ويبين الموقع طفرة K124R على CENP-A (الحمراء)، وموقع طفرة K48R على monoubiquitin (الأزرق). (1) WT: العلم-CENP-A WT، (2) WT-UB (WT): العلم-CENP-A WT-UB (WT)، (3) WT-UB (K48R): العلم-CENP-A WT -Ub (K48R)، (4) K124R-UB (WT): العلم-CENP-A K124R-UB (WT)، (5) K124R-UB (K48R): العلم-CENP-A K124R-UB (K48R)، (6) K124R: العلم-CENP-A K124R (ب) من مصادر خارجية CENP-A monoubiquitin الانصهار انقاذ تمركز في CENP-A متحولة K124R من القسيم. وترد، دابي (الأزرق)، العلم (الأخضر)، والذاتية CENP-B (عنصر تحكم موقع السنترومير الأحمر). يمثل مقياس شريط 10 ميكرون (C) المدرج الإحصائي من أنماط توطين هو مبين في (C). تم إحصاء أكثر من 50 الموالية / طليعة الطور والطورية الخلايا وأكثر من 200 خلية البيني في التجربة ≥ 3 تجارب). ويبين متوسط ​​النسب المئوية (± SD). **** P <0.0001 و*** P <0.001 مقابل غير تنصهر العلم-CENP-A K124R (العمود [6]) (الطالب اختبار t). الرجاء النقر هنا لمشاهدة نسخة أكبر من هذا الرقم.

الهدف سيرنا إشارة في الدراسة نوع الهدف عدد قواعد البيانات سيرنا تسلسل إلى الأمام (ق) المصدر / المرجع
وسيفيراز (GL3) - 1 الهدف RKK9 CUUACGCUGAGUACUUCGAdTdT البشير وآخرون، (2001)
CENP-A CA-UTR تجمع سيرنا (2 أهداف خليط) RKK375 / 5 "T1 UTR CGAGCGGCGCGGACUUCUGCCdTdT Niikura وآخرون، (2015)
RKK383 / 3 'T1 UTR UCCUGCACCCAGUGUUUCUGUdGdT Niikura وآخرون، (2015)
CUL4A # 1 1 الهدف CRKK178 / RKK309 / T1 AGCGAUCGUAAUCAAUCCUGA Niikura وآخرون، (2015)
# 2 (3'UTR) 1 الهدف CRKK181 / RKK331 / T4 AUGCGGGUUUGAAAUAUGACA Niikura وآخرون، (2015)
RBX1 / ROC1 # 1 تجمع سيرنا (4 أهداف خليط) CRKK198 / RKK411 / T1 GAAGCGCUUUGAAGUGAAA Niikura وآخرون، (2015)
CRKK198 / RKK413 / T2 GCAUAGAAUGUCAAGCUAA Niikura وآخرون، (2015)
CRKK198 / RKK415 / T3 GCAAGAAGCGCUUUGAAGU Niikura وآخرون، (2015)
CRKK198 / RKK417 / T4 CAACAGAGAGUGGGAAUUC Niikura وآخرون، (2015)
# 2 (3 'UTR) 1 الهدف CRKK206 / RKK425 / T8 UUCCCUGCUGUUACCUAAUUA Niikura وآخرون، (2015)

الجدول 1. تسلسل سيرنا المستخدمة في هذه الدراسة.

عدد B سمة ذات الصلة (ق) المصدر / المرجع
B288 pTRM4 Niikura وآخرون، (2006)
B2067 pTRM4 البشرية CENP-A-العلم Niikura وآخرون، (2015)
B2281 pTRM4 البشرية CENP-A-K9A العلم Niikura وآخرون، (2015)
B2387 pTRM4 البشرية CENP-A-K77R العلم Niikura وآخرون، (2015)
B2388 pTRM4-هومان CENP-A-K124R العلم Niikura وآخرون، (2015)
B2512 pTRM4-العلم البشرية CENP-A Niikura وآخرون، (2015)
B2579 CENP-A-pTRM4 العلم البشرية K124R Niikura وآخرون، (2015)
B2513 pTRM4-العلم البشرية CENP-A-UB (WT) Niikura وآخرون، (2015)
B2559 pTRM4-العلم البشرية CENP-A K124R-UB (WT) Niikura وآخرون، (2015)
B2515 pTRM4-العلم إنسان CENP-A-UB (K48R) Niikura وآخرون، (2015)
B2560 pTRM4-العلم إنسان CENP-A K124R-UB (K48R) Niikura وآخرون، (2015)
B2759 pTRM4 البشرية CUL4A-العلم Niikura وآخرون، (2015)
B2624 RBX1 pcDNA3-العلم إنسان Niikuraوآخرون، (2015)
B1491 pcDNA3-العلم Niikura وآخرون، (2015)

الجدول 2. ناقلات البلازميد المستخدمة في هذه الدراسة.

R (مكافحة CENP-B) عينة ب (مكافحة CENP-B) R العينة (طرح) نسبة (S عينة: R العينة) نسبة تصحيح (S عينة: R العينة)
520 514 6 -4.167 0.000
535 445 90 -1.033 0.000
515 431 84 0.274 0.274
562 483 79 0،506 0،506
902 562 340 0،509 0،509
1203 703 500 -0.560 0.000
1014 589 425 -0.819 0.000
768 510 258 -1.345 0.000
555 458 97 -1.845 0.000
781 576 205 -1.146 0.000
556 436 120 0،758 0،758
534 493 41 -1.634 0.000
702 543 159 0.667 0.667
482 429 53 -1.000 0.000 654 531 123 0.740 0.740
1190 607 583 0.384 0.384
552 454 98 0.969 0.969
489 413 76 0،539 0،539
511 452 59 -3.186 0.000
485 475 10 -2.700 0.000
481 441 40 -1.475 0.000
مجموع 5،347
متوسط 0.255
R (مكافحة CENP-B) السيطرة ب (مكافحة CENP-B) نسبة (S السيطرة: R السيطرة) نسبة تصحيح (S السيطرة: R السيطرة)
543 483 60 3،017 3،017
526 466 60 2.667 2.667
532 460 72 1.792 1.792
507 457 50 3.520 3.520
491 458 33 4.273 4.273
545 464 81 2.160 2.160
518 484 34 3،559 3،559
461 404 57 2،404 2،404
487 447 40 3.550 3.550
534 477 57 3،965 3،965
528 456 72 3،097 3،097
707 601 106 1.868 1.868
615 528 87 2،828 2،828
660 481 179 1.620 1.620
565 476 89 1،607 1،607
527 455 72 3،583 3،583
560 474 86 2.930 2.930
510 451 59 4،017 4،017
729 586 143 2،678 2،678
634 576 58 3،655 3،655
507 476 31 3،935 3،935
مجموع 62،725
متوسط 2.987
تبقى إشارات CENP-A في السنترومير (٪) 8.5

الجدول 3. مثال واحد على حساب إشارات المتبقية CENP-A في السنترومير (٪) يظهر مثال برو / طليعة الطور التالي في الشكل 2F: العينة RBX1 # 2 (3'UTR) + مركزنا (مركز العمود في الشكل 2F ) والسيطرة هو لوك + المزيد (العمود الأيسر في الشكل 2F). ونتيجة لذلك، تبقى إشارات CENP-A فيالسنترومير (٪) = (0.255 / 2.987) × يتم الحصول على 100 ​​= 8.5٪ (أو [5.347 / 62.725] × 100 = 8.5٪ مع نفس مجموع عدد الخلايا [أي 21 خلايا] حلل بين عينتين). لاحظ أنه إذا كانت القيمة ب هي أكثر من قيمة S (أي، إذا كانت القيمة طرح هو سلبي)، يتم تعيين قيمة نسبة تصحيح إلى 0.00.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

في السنوات الأخيرة قد وضعت العديد من الدراسات المختلفة المقايسات المجهر الكمي للخلايا ثابتة. 42 التقدم في علم الأحياء السنترومير-الحيز الحركي وغالبا ما يتطلب فهم وظيفة السنترومير محددة أو الحيز الحركي محددة من البروتينات التي التحت خلوية تنظيم المكانية والزمانية ويعكس الوظائف المتغيرة لل هذه البروتينات خلال دورة الخلية. لذلك، هنا وضعنا طرق معهد التمويل الدولي تلطيخ وفحص معهد التمويل الدولي الكمي لتحليل تحديدا المستويات النسبية للالداخلية والخارجية البروتينات CENP-A، والتي يمكن أن تكون قابلة للتطبيق في عينات معاملة مختلفة. حققنا حاليا ناجحة تلطيخ معهد التمويل الدولي من الذاتية CENP-I، CENP-H، KNL1، Hec1، وSka1 باستخدام بروتوكول 2 في هذه الدراسة (انظر Niikura وآخرون 24 ولا تظهر البيانات؛ قائمة المواد / المعدات للحصول على معلومات من الأجسام المضادة) . في المستقبل، يمكن للمرء أن تطبيق نفس الأسلوب لتحديد مستوى البروتينات السنترومير الحيز الحركي المختلفة (endogenous والبروتينات الخارجية العلم الموسومة) اختيار أجسام مضادة محددة، إلا أن وسائل معهد التمويل الدولي لدينا لا تشمل الكشف عن هذه البروتينات في الخلايا الحية أو في خلية واحدة محددة خلال دورة الخلية بأكملها. لأن هذه الإجراءات تتطلب الخلايا لتكون ثابتة ومعالجتها coverslips على منفصلة، ​​قدمنا ​​إشارات مرجعية (على سبيل المثال، هيئة مكافحة الفساد أو CENP-B) لغرض التطبيع من أجل مقارنة إلى حد ما إشارات بين العينات المختلفة وزيادة دقة الفحص. لأن ACA إشراك أو إشارات الذاتية و / الخارجية CENP-A، CENP-B كما أن إشارة مرجعية لغرض التطبيع تكون أكثر ملاءمة للمقارنة من شأنه أن هيئة مكافحة الفساد من حيث دقة الفحص الكمي للإشارات CENP-A. بربط منطقة الأمينية من محطة CENP-B لعزر 17-BP تسلسل مربع CENP-B في الحمض النووي alphoid، ومنطقة كربوكسي محطة من CENP-B تشكل homodimers. 43،44 CENP-B لا colocalize تماما مع CENP ألف و / أو غيرها من الطرد المركزيالبروتينات omere-الحيز الحركي، ومع ذلك، ويرتبط بشكل وثيق معهم. 45 وبينما المناعي مع أجسام مضادة للCENP-C عادة يعطي مركزين منفصلة، ​​تلطيخ مع مكافحة CENP-B غالبا ما يظهر على شكل شريط مشرق واحد يربط كلا القسيم الشقيقة. 46 ولكن ، لدينا في الملاحظة المجهرية الحجم الكلي بعض الإشارات CENP-B على ما يبدو تتداخل مع إشارات CENP-A، وخصوصا في المراحل الإنقسامية السابقة (الطور-طليعة الطور التالي من أواخر الطورية)، وأيضا في جزء اعتمادا على زاوية الرصد ونوع من تثبيتي المستخدمة (لا تظهر البيانات). في المقابل، في فحص معهد التمويل الدولي الكمي للإشارات CENP-A، البروتين توطين الإشارات المرجعية يجب أن لا تتأثر استنزاف و / أو خلل في CENP-A لتحليل عادلة، على الرغم من توطين معظم البروتينات السنترومير الحيز الحركي يعتمد على تم تأسيس CENP-A التعريب في القسيم. التجميع الحيز الحركي 47،48 CENP-A-مستقل عن طريق استبدال المناطق الحمض النووي ملزم من CENP-C وCENP-T مع المجالات التي تستهدف كروموسوم البديلة التي تجند هذه البروتينات إلى مواضع خارج الرحم. 49،50 وبالإضافة إلى ذلك، أشارت الأبحاث الحديثة أن مكونات الحيز الحركي الداخلية CENP-C وCENP-T عمل بالتوازي لتجنيد شبكة KMN ل kinetochores. 51-54 وعلاوة على ذلك، نيشينو وآخرون. واقترح أن أشكال CENP-TWSX معقدة تشبه هيكل جسيم نووي فريدة من نوعها لتوليد الاتصالات مع الحمض النووي، وتوسيع نطاق "كود هيستون" ما وراء البروتينات جسيم نووي الكنسي. 55 لأن توطين السنترومير من CENP- C تعتمد على توطين السنترومير من CENP-A، 47،48 CENP-TWSX أو خاصة CENP-T يمكن أن يكون المرشح بروتين آخر (الصورة) لتوفير الإشارات المرجعية في فحص معهد التمويل الدولي الكمي للCENP-A. ومع ذلك، ينبغي اختبار المرشح لالإشارات المرجعية بعناية قبل الاختبار لتحديد ما إذا كان التعريب في القسيم يتأثر نضوب و / أو خلل في CENP-A. نظر مماثلةينبغي أن تؤخذ لفحوصات معهد التمويل الدولي كمية من البروتينات الأخرى السنترومير الحيز الحركي: توطين البروتين الإشارات المرجعية لا ينبغي أن تتأثر استنزاف و / أو خلل في البروتين المستهدف لتحليل عادلة. في دراسة سابقة، كنا ACA كإشارة مرجعية لفحص معهد التمويل الدولي الكمي من البروتينات الحيز الحركي المركزية التي الخارجي الأخرى. 24 ACA يمكن أن يكون خيارا أكثر ملاءمة من واحد CENP-B بمثابة سيطرة على الموقف، فضلا عن إشارة مرجعية، إذا ACA لا تتأثر الإشارات التي كتبها استنزاف و / أو خلل في بروتين الهدف ولكن colocalization من البروتين الهدف مع CENP-B فقير كما هو مذكور أعلاه.

بودور وآخرون. وذكرت أن مستويات القسيم المركزي CENP-A تنظمها العمل الجماهيري، أي كمية من القسيم المركزي CENP-A يختلف في نسبة مباشرة إلى المحتوى الخلوي. 56 كما اظهرت أن تحريض عابرة من CENP-A التعبير يؤدي إلى زيادة سريعة في القسيم المركزي CENP-A مستوى. على العكس من ذلك، لاحظنا السكان الخلية كبير مع مترجمة السنترومير، العلم الموسومة-CENP-A WT بعد cotransfection من ناقلات التعبير pTRM4 مع CA-UTR الرناوات siRNAs (خليط من 5 'و 3' UTR سيرنا، الجدول 1) (البيانات لا معروضة). وهذه الفئة من السكان أكبر مما كان عليه بعد ترنسفكأيشن فقط مع ناقلات التعبير pTRM4. وكان مستوى خارجي الموسومة العلم CENP-A البروتين التي كان يقودها pTRM4 التعبير، حوالي 1،0-1،4 أوامر من حجم (10- إلى 25 أضعاف) أعلى من الذاتية CENP-A (لا تظهر البيانات). وتكهن بأن تعبير خارجي CENP-A WT فوق عتبة معينة يمكن أن يؤثر سلبا على توطين القسيم المركزي الذي تستحقه.

في البروتوكولات الحالية، التثبيت هو خطوة حاسمة للحفاظ على البنية الخلوية والبيئة والوضع الداني وقت ممكن إلى الدولة الأم. مرة واحدة يتم إصلاحها الخلايا، ينبغي للمرء أن المضي قدما في بروتوكول تلطيخ لتجنب فقدان البروتين من الأسواق العالمية ضغطهاراحة أو بقية الخلية. ومع ذلك، تثبيت يدمر مواقع المستضدات في بعض الأحيان، ومختلف مجموعات الضد مستضد عمل سيئة مع تثبيتي واحد، ولكن بشكل جيد جدا مع آخر. 21 وبسبب هذا الاختلاف، واختيار من تثبيتي يعتمد إلى حد كبير على البروتين (ق) من الفائدة. طول الوقت من تثبيت يمكن أن تؤثر تأثيرا كبيرا على الكشف عن بروتين (ق) من المناعية، وأقصر تثبيت أفضل عموما للاحتفاظ استضداد. 57 لذلك، عند تحديد الإجراءات تلطيخ لهدف جديد من البروتينات الأخرى السنترومير الحيز الحركي، وخاصة من غير مؤكد التوطين، أو عند العمل مع الأجسام المضادة الجديدة، ينبغي للمرء أن يختبر عدة طرق لتثبيت ومخازن لإيجاد الظروف المثلى. في البروتوكولات الحالية، وقد تم اختيار فئتين من مثبتات الشعبية: مثبتات ألدهيد (بروتوكول 2) والمذيبات العضوية (بروتوكولات 3 و 4). نقاء مثبتات هو أيضا في غاية الأهمية. في بروتوكول 4، يتم استخدام 4٪ مصل الماعز especiaLLY لمنع مستقبلات مفتش على سطح الخلية للحد من خلفية غير محددة. 57 عموما، ومصل لمنع المستقبلات مفتش يجب أن تكون من الأنواع لا علاقة لها الأجسام المضادة الأولية ويفضل أن يكون من نفس النوع كما الأجسام المضادة الثانوية (57).

في كل من البروتوكولات الحالية، واختيار من الأجسام المضادة الأولية هو الخطوة الأكثر أهمية في تحقيق المناعية ناجحة. المطلوب هو الجسم المضاد مع أكبر قدر من الدقة والنقاء، تقارب، والطمع. وهناك تركيز انطلاق جيدة لالأجسام المضادة وحيدة النسيلة هو عادة 1-5 ميكروغرام / مل. التخفيفات نموذجية من إعداد الأوراق المالية الأجسام المضادة تتراوح من 1:20 إلى 1: 500 57 يحتاج المرء لتحديد تجريبيا التركيز المناسب من الأجسام المضادة الأولية ومخفف لكل عينة. العينات يجب أن هز بلطف ولكن لم يجف خلال الحضانة لتلطيخ متجانس. غسل واسعة بين حضانة الأجسام المضادة الأولية والثانويةقد تكون هناك حاجة ntibody لتجنب الاختلاطات مع المناعية من الأنواع الأخرى. ومع ذلك، لا بد من تحديد حالة غسل الأمثل تجريبيا لتجنب فقدان الخلايا، وخاصة الخلايا الإنقسامية، التي تختم وفصل عندما اهتزت (أي الإنقسامية هزة إيقاف). 58 ونظرا للنجاح، يجب اختيار الأجسام المضادة الثانوية لربط الأجسام المضادة الأولية مع قابلية عالية. على سبيل المثال، لتجنب ملزمة انوعي الجزء التيسير من الأجسام المضادة الثانوية لمستقبلات مفتش التيسير، أف ب (أ ب ') 2 شظايا يمكن أن تستخدم بدلا من الأجسام المضادة كله. 57 بالنسبة للعديد من الأجسام المضادة الثانوية، فترة حضانة يمكن التقليل إلى 30 دقيقة في RT للحد من خلفية غير محددة.

بالإضافة إلى بروتوكول 5، ويمكن ليزر المسح المجهري متحد البؤر يكون من المفيد في كشف وتحليل توطين وظيفة من البروتينات السنترومير الحيز الحركي مع خصائص الفلورسنت. كما هو مبين في قائمة المواد / اجهزة لازيوتالإقليم الشمالي، اليكسا فلور 488 واليكسا فلور 594 هي على الأرجح الأصباغ الفلورية الأكثر استخداما في البروتوكولات الحالية. للكشف عن اثنين و / أو البروتينات السنترومير الحيز الحركي مختلفة متعددة في العينة، لا بد من التأكد من أن الأجسام المضادة المستخدمة للكشف عن البروتين واحد لا تمنع من الكشف عن البروتين الثاني 57 في البروتوكولات الحالية.، وهما الأجسام المضادة الأولية مختلطة وتطبيقها في نفس الوقت. ومع ذلك، ينبغي للمرء أن تحسين الظروف المناعية لكل البروتين على حدة قبل تطبيق الأجسام المضادة الأولية أو الثانوية معا: إذا البروتينات هما على مقربة كما هو الحال بالنسبة للمكونين السنترومير-الحيز الحركي، الأجسام المضادة الأولية يجوز لأحد أن يمنع هيكليا الربط من الأجسام المضادة الأولية الثانية. قلق آخر للكشف عن إشارة متعددة هي مشكلة التداخل الطيفي: صعوبة في منع إشارة من صبغة واحدة "تسريب" في قناة الطيفية للآخر. تصبح هذه المشكلة أكثر صعوبة بالنسبة للاتفاقيةآل مرشح تدخل مجموعات لحل كما يزيد عدد الأصباغ أو إذا كانت العينة تحتوي على إشارات overenhanced (على سبيل المثال، هيئة مكافحة الفساد أو مكافحة علم الإشارات في هذه الدراسة)، بما في ذلك التدخل من تألق ذاتي. وقد أجريت استكشاف الأخطاء وإصلاحها من تألق ذاتي في دراسات أخرى. 57،59،60 وفي الدراسة الحالية، وتحسين مجموعات مرشح الفلورسنت مع الضوابط تسمية واحدة في كل قناة يكفي في معظم الحالات لتجنب هذه المشاكل (أنظر أدناه).

في كل من البروتوكولات الحالية، والضوابط المناسبة ضرورية. يجب أن تتسم كل الأجسام المضادة الأولية جديد قبل أن يبدأ المناعية. وينبغي تأكيد خصوصية الأجسام المضادة عن طريق تحليل لطخة غربية، إن وجدت. وبالإضافة إلى ذلك، وتأكيد أن تلطيخ لا ينتج عن انوعي ملزم لسطح الخلية ينبغي الحصول، وينبغي تحديد تركيز العمل الأمثل من الأجسام المضادة الأولية معين من خلال استخدام التخفيفات المسلسل(أي، ينبغي وضع منحنى ملزم). وسيطرة سلبية (أي عدم وجود الأجسام المضادة الأولية من عملية تلطيخ) ينبغي أن تدرج. وثمة خيار آخر للسيطرة سلبية هو استبدال مفتش العادي من نفس النوع لالأجسام المضادة الأولية. للكشف عن علامات متعددة، لا بد من إعداد الضوابط دون الأجسام المضادة الثانوية (سيطرة الخلفية) وكذلك الضوابط تسمية واحدة لتجنب القطع الأثرية تداخل الطيفية (أي تنزف من خلال، كروس، الحديث المتبادل، أو صبغ "تسريب"، كما هو موضح أعلاه ). يمكن للمرء أن تحديد جزء من "تسرب" من خلال مقارنة إشارات من خلال مرشحات "خاطئة" مع الإشارة الصحيحة، وذلك باستخدام هذه النسب لإزالة حسابيا عن "تسريب" وحساب التوزيع الحقيقي و / أو المشاركة في توطين التسمية الفلورسنت 60 ينبغي النظر سيطرة الخلفية بشكل مستقل مع كل قناة لتعيين حدود كسب إشارة وتعويض لتكون آداpted للتصوير النهائي. جميع القنوات التي سيتم استخدامها للحصول على صورة عينة متعددة التسمية يجب أن تخضع للتصويب خلفية مستقل، لأن مستوى تألق ذاتي في كل قناة يختلف إلى حد كبير. في "تسريب" الضوابط على النحو المبين أعلاه اللازمة لتحديد مقدار الربح إشارة ممكنة في كل قناة من دون الكشف عن "تسريب" في القنوات المجاورة. 60

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

الكتاب تعلن أنه ليس لديهم مصالح مالية المتنافسة.

Acknowledgments

وأيد هذا العمل من قبل المعاهد الوطنية للصحة منح GM68418.

Materials

Name Company Catalog Number Comments
Lipofectamin 2000 Life Technologies/Invitrogen 11668 transfection reagent I
Lipofectamin RNAiMAX Life Technologies/Invitrogen 13778 transfection reagent II
Opti-MEM I Life Technologies/Invitrogen 31985 Reduced serum media, warm in 37 °C water bath before use
High-glucose DMEM (Dulbecco’s modified Eagle’s medium) Life Technologies/BioWhittaker 12-604 high-glucose DMEM, warm in 37 °C water bath before use
Fetal Bovine Serum, certified, heat inactivated, US origin Life Technologies/Gibco 10082 FBS (fetal bovine serum)
Poly-L-Lysine SOLUTION SIGMA-SLDRICH P 8920 Poly-L-Lysine, 0.1% w/v, in water
UltraPure Distilled Water Life Technologies/Invitrogen/Gibco 10977 Sterile tissue culture grade water 
Micro Cover glass (22 mm x 22 mm)  Surgipath 105 Cover glass (22 mm x 22 mm) 
6 Well Cell Culture Cluster Fisher/Corning Incorporated 07-200-83 6-well polystyrene plate 
Penicillin, Streptomycin; Liquid Fisher/Gibco 15-140 Penicillin-streptomycin
PAP PEN  Binding Site AD100.1 Hydrophobic barrier pen (for a water repellant barrier in immunofluorescent staining)
Paclitaxel (Taxol) SIGMA-SLDRICH T7402 Taxol for mitotic cell analysis
TN-16, microtubule inhibitor (TN16) Enzo Life Sciences BML-T120 TN16 for mitotic cell analysis
BSA (bovine serum albumin) SIGMA-SLDRICH A7906 Blocking reagent
Triton X-100 SIGMA-SLDRICH T8787 Detergent for permeabilization
Paraformaldehyde SIGMA-SLDRICH P6148 Fixation reagant
DAPI SIGMA-SLDRICH D9542 For nuclear staining
p-phenylenediamine SIGMA-SLDRICH P6001 For mounting medium
VWR Micro Slides, Frosted VWR International 48312-013 Micro slides 
Anti-CENP-A antibody Stressgen/Enzo Life Sciences KAM-CC006 Mouse monoclonal antibody; dilution ratio of 1:100 (IIF), 1:5000 (WB)
Anti-CENP-B antibody Novus Biologicals H00001059-B01P Mouse monoclonal antibody; dilution ratio of 1:200 (IIF, methanol/acetone fixation)-1:400 (IIF, paraformaldehyde fixation)
Anti-CENP-B antibody  abcam ab25734 Rabbit polyclonal antibody; dilution ratio of 1:200 (IIF, methanol/acetone fixation)-1:400 (IIF, paraformaldehyde fixation)
Anti-centromere antibody (ACA) Fitzgerald Industries International, Inc. 90C-CS1058 Human centromere antiserum; dilution ratio of 1:2000 (IIF)
Anti-CENP-H antibody Bethyl Laboratories BL1112 (A400-007A) Rabbit polyclonal antibody; dilution ratio of 1:200 (IIF)
Anti-CENP-H antibody BD 612142 Mouse monoclonal antibody; dilution ratio of 1:200 (IIF)
Anti-CENP-I antibody N/A, Dr. Katusmi Kitagawa N/A, Dr. Katusmi Kitagawa Rabbit polyclonal antibody; dilution ratio of 1:1000 (IIF); Niikura et al., Oncogene, 4133-4146 (2006)
Anti-KNL1 antibody Novus Biologicals NBP1-89223 Rabbit polyclonal antibody; dilution ratio of 1:100 (IIF)
Anti-Hec1 antibody Novus Biologicals / GeneTex NB 100-338 / GTX70268 Mouse monoclonal antibody; dilution ratio of 1:100 (IIF)
Anti-Hec1 antibody GeneTex GTX110735 Rabbit polyclonal antibody; dilution ratio of 1:100 (IIF)
Anti-Ska1 antibody abcam ab46826 Rabbit polyclonal antibody; dilution ratio of 1:100 (IIF)
Anti-Flag antibody SIGMA-ALDRICH F3165 Mouse monoclonal antibody; dilution ratio of 1:1000 (IIF), 1:5000 (WB)
Anti-Flag antibody SIGMA-ALDRICH F7425 Rabbit polyclonal antibody; dilution ratio of 1:1000 (IIF), 1:5000 (WB)
Anti-CUL4A antibody N/A, Dr. Pradip Raychaudhuri N/A, Dr. Pradip Raychaudhuri Rabbit polyclonal antibody; dilution ratio of 1:3000 (WB); Shiyanov et al., The Journal of biological chemistry, 35309-35312 (1999)
Anti-RBX1 antibody Cell Signaling 4397 Rabbit polyclonal antibody; dilution ratio of 1:2000 (WB)
Anti-GAPDH antibody Chemicon MAB374 Mouse monoclonal antibody; dilution ratio of 1:5000 (WB)
Alexa Fluor 488 Goat Anti-Mouse IgG Life Technologies/Invitrogen A11001 fluorophore-conjugated secondary antibody (Affinity-purified secondary antibody)
Alexa Fluor 594 Goat Anti-Mouse IgG Life Technologies/Invitrogen A11005 fluorophore-conjugated secondary antibody (Affinity-purified secondary antibody)
Alexa Fluor 488 Goat Anti-Rabbit IgG Life Technologies/Invitrogen A11008 fluorophore-conjugated secondary antibody (Affinity-purified secondary antibody)
Alexa Fluor 594 Goat Anti-Rabbit IgG Life Technologies/Invitrogen A11012 fluorophore-conjugated secondary antibody (Affinity-purified secondary antibody)
Non fat powdered milk (approved substitution for carnation powdered milk) Fisher Scientific NC9255871 (Reorder No. 190915; Lot# 90629) Skim milk
Leica DM IRE2 motorized fluorescence microscope  Leica motorized fluorescence microscope 
HCX PL APO 63x oil immersion lens Leica LEICA HCX PL APO NA 1.40 OIL PH 3 CS 63X oil immersion lens
HCX PL APO 100x oil immersion lens Leica LEICA HCX PL APO NA 1.40 OIL PHE 100X oil immersion lens
Leica EL6000 compact light source Leica External compact light source for fluorescent excitation
ORCA-R2 Digital CCD camera  Hamamatsu C10600-10B digital CCD camera 
Openlab version 5.5.2 Scientific Imaging Software  Perkin Elmer/Improvision For image observation, acquisition, quantification, and analysis
Velocity version 6.1.1 3D Image Analysis Software  Perkin Elmer/Improvision For image observation, acquisition, quantification, and analysis
Complete EDTA-free protease inhibitor cocktail Roche 11873580001/11836170001 Protease inhibitor cocktail tablets
PlusOne 2-D Quant Kit Amersham Biosciences 80-6483-56 Commercial protein assay reagent I for measurement of protein concentration (compatible with 2% SDS)
Bio-Rad Protein Assay Bio-Rad 500-0006 Commercial protein assay reagent II for measurement of protein concentration (compatible with 0.1% SDS)
Immobilon-FL EMD Millipore IPFL00010 PVDF membrane for transferring
IRDye 800CW Goat Anti-Mouse IgG LI-COR Biosciences 926-32210 IR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:20000 (IIF)
IRDye 680 Goat Anti-Rabbit IgG LI-COR Biosciences 926-32221 IR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:20000 (IIF)
Goat anti-Mouse IgG DyLight 549 Fisher Scientific PI35507 DyLight-conjugated secondary antibodyIR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:20000 (IIF)
Goat anti-Rabbit DyLight 649 Fisher Scientific PI35565 DyLight-conjugated secondary antibodyIR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:20000 (IIF)
Goat anti-mouse IgG-HRP Santa Cruz SC-2005 HRP-conjugated secondary antibodyDyLight-conjugated secondary antibodyIR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:10000 (IIF)
Goat anti-rabbit IgG-HRP Santa Cruz SC-2004 HRP-conjugated secondary antibodyDyLight-conjugated secondary antibodyIR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:10000 (IIF)
Openlab version 5.5.2. Scientific Imaging Software  Improvision/PerkinElmer Software A
Volocity version 6.3 3D Image Analysis Software (Volocity Acquisition) PerkinElmer Software B1
Volocity version 6.3 3D Image Analysis Software (Volocity Quantification) PerkinElmer Software B2
Branson SONIFIER 450 Sonicator
Branson Ultrasonics sonicator Microtip Step, Solid, Threaded 9.5 mm VWR Scientific Products Inc.  33995-325 Disruptor horn for sonication
Branson Ultrasonics sonicator Microtip Tapered 6.5 mm VWR Scientific Products Inc.  33996-185 Microtip for sonication
Odyssey CLx Infrared imaging System  LI-COR Biosciences Infrared imaging system for immunoblot detection
Image Studio Analysis Software Ver 4.0  LI-COR Biosciences Software C
Molecular Imager Versadoc MP4000 System  Bio-Rad Chemiluminescence imager for immunoblot detection
Quantity One 1-D analysis software  Bio-Rad Software D
SuperSignal West Femto Maximum Sensitivity Substrate Thermo 34095 Ultra-sensitive enhanced chemiluminescent (ECL) substrate

DOWNLOAD MATERIALS LIST

References

  1. DeLuca, J. G., et al. Hec1 and nuf2 are core components of the kinetochore outer plate essential for organizing microtubule attachment sites. Molecular biology of the cell. 16, 519-531 (2005).
  2. Earnshaw, W. C., Halligan, N., Cooke, C., Rothfield, N. The kinetochore is part of the metaphase chromosome scaffold. J Cell Biol. 98, 352-357 (1984).
  3. Hoffman, D. B., Pearson, C. G., Yen, T. J., Howell, B. J., Salmon, E. D. Microtubule-dependent changes in assembly of microtubule motor proteins and mitotic spindle checkpoint proteins at PtK1 kinetochores. Molecular biology of the cell. 12, 1995-2009 (2001).
  4. Regnier, V., et al. CENP-A is required for accurate chromosome segregation and sustained kinetochore association of BubR1. Mol Cell Biol. 25, 3967-3981 (2005).
  5. Bernad, R., Sanchez, P., Losada, A. Epigenetic specification of centromeres by CENP-A. Exp Cell Res. 315, 3233-3241 (2009).
  6. Black, B. E., Cleveland, D. W. Epigenetic centromere propagation and the nature of CENP-a nucleosomes. Cell. 144, 471-479 (2011).
  7. Warburton, P. E., et al. Immunolocalization of CENP-A suggests a distinct nucleosome structure at the inner kinetochore plate of active centromeres. Curr Biol. 7, 901-904 (1997).
  8. Karpen, G. H., Allshire, R. C. The case for epigenetic effects on centromere identity and function. Trends Genet. 13, 489-496 (1997).
  9. Black, B. E., et al. Structural determinants for generating centromeric chromatin. Nature. 430, 578-582 (2004).
  10. Black, B. E., et al. Centromere identity maintained by nucleosomes assembled with histone H3 containing the CENP-A targeting domain. Mol Cell. 25, 309-322 (2007).
  11. Fachinetti, D., et al. A two-step mechanism for epigenetic specification of centromere identity and function. Nat Cell Biol. 15, 1056-1066 (2013).
  12. Zeitlin, S. G., Shelby, R. D., Sullivan, K. F. CENP-A is phosphorylated by Aurora B kinase and plays an unexpected role in completion of cytokinesis. The Journal of cell biology. 155, 1147-1157 (2001).
  13. Zhang, X., Li, X., Marshall, J. B., Zhong, C. X., Dawe, R. K. Phosphoserines on maize CENTROMERIC HISTONE H3 and histone H3 demarcate the centromere and pericentromere during chromosome segregation. The Plant cell. 17, 572-583 (2005).
  14. Goutte-Gattat, D., et al. Phosphorylation of the CENP-A amino-terminus in mitotic centromeric chromatin is required for kinetochore function. Proc Natl Acad Sci U S A. 110, 8579-8584 (2013).
  15. Bailey, A. O., et al. Posttranslational modification of CENP-A influences the conformation of centromeric chromatin. Proc Natl Acad Sci U S A. 110, 11827-11832 (2013).
  16. Samel, A., Cuomo, A., Bonaldi, T., Ehrenhofer-Murray, A. E. Methylation of CenH3 arginine 37 regulates kinetochore integrity and chromosome segregation. Proc Natl Acad Sci U S A. 109, 9029-9034 (2012).
  17. Niikura, Y., et al. CENP-A K124 Ubiquitylation Is Required for CENP-A Deposition at the Centromere. Dev Cell. (2015).
  18. Chan, G. K., Liu, S. T., Yen, T. J. Kinetochore structure and function. Trends in cell biology. 15, 589-598 (2005).
  19. Hori, T., Okada, M., Maenaka, K., Fukagawa, T. CENP-O class proteins form a stable complex and are required for proper kinetochore function. Molecular biology of the cell. 19, 843-854 (2008).
  20. Fukagawa, T., Earnshaw, W. C. The centromere: chromatin foundation for the kinetochore machinery. Developmental cell. 30, 496-508 (2014).
  21. Kedersha, N. The Proteintech Blog.Proteintech. Grainger, D. Proteintech Group. (2012).
  22. Clontech Laboratories, Inc. HeLa Tet-Off Advanced Cell Line. Available from: http://www.clontech.com/CR/Products/Inducible_Systems/Tetracycline-Inducible_Expression/ibcGetAttachment.jsp?cItemId=26908&fileId=6712191&sitex=10020:22372:US (2012).
  23. Meraldi, P., Sorger, P. K. A dual role for Bub1 in the spindle checkpoint and chromosome congression. EMBO J. 24, 1621-1633 (2005).
  24. Niikura, Y., et al. 17-AAG, an Hsp90 inhibitor, causes kinetochore defects: a novel mechanism by which 17-AAG inhibits cell proliferation. Oncogene. 25, 4133-4146 (2006).
  25. Yang, Z., et al. Silencing mitosin induces misaligned chromosomes, premature chromosome decondensation before anaphase onset, and mitotic cell death. Mol Cell Biol. 25, 4062-4074 (2005).
  26. Wang, H., et al. Histone H3 and H4 ubiquitylation by the CUL4-DDB-ROC1 ubiquitin ligase facilitates cellular response to DNA damage. Mol Cell. 22, 383-394 (2006).
  27. Lamb, J. R., Tugendreich, S., Hieter, P. Tetratrico peptide repeat interactions: to TPR or not to TPR? Trends Biochem Sci. 20, 257-259 (1995).
  28. Kitagawa, K., Skowyra, D., Elledge, S. J., Harper, J. W., Hieter, P. SGT1 encodes an essential component of the yeast kinetochore assembly pathway and a novel subunit of the SCF ubiquitin ligase complex. Mol Cell. 4, 21-33 (1999).
  29. Niikura, Y., Dixit, A., Scott, R., Perkins, G., Kitagawa, K. BUB1 mediation of caspase-independent mitotic death determines cell fate. J Cell Biol. 178, 283-296 (2007).
  30. Niikura, Y., Kitagawa, K. Identification of a novel splice variant: human SGT1B (SUGT1B). DNA Seq. 14, 436-441 (2003).
  31. Niikura, Y., Ogi, H., Kikuchi, K., Kitagawa, K. BUB3 that dissociates from BUB1 activates caspase-independent mitotic death (CIMD). Cell Death Differ. 17, 1011-1024 (2010).
  32. Ando, S., Yang, H., Nozaki, N., Okazaki, T., Yoda, K. CENP-A, -B, and -C chromatin complex that contains the I-type alpha-satellite array constitutes the prekinetochore in HeLa cells. Mol Cell Biol. 22, 2229-2241 (2002).
  33. Izuta, H., et al. Comprehensive analysis of the ICEN (Interphase Centromere Complex) components enriched in the CENP-A chromatin of human cells. Genes to cells : devoted to molecular & cellular mechanisms. 11, 673-684 (2006).
  34. Obuse, C., et al. Proteomics analysis of the centromere complex from HeLa interphase cells: UV-damaged DNA binding protein 1 (DDB-1) is a component of the CEN-complex, while BMI-1 is transiently co-localized with the centromeric region in interphase. Genes Cells. 9, 105-120 (2004).
  35. Merlet, J., Burger, J., Gomes, J. E., Pintard, L. Regulation of cullin-RING E3 ubiquitin-ligases by neddylation and dimerization. Cell Mol Life Sci. 66, 1924-1938 (2009).
  36. Bennett, E. J., Rush, J., Gygi, S. P., Harper, J. W. Dynamics of cullin-RING ubiquitin ligase network revealed by systematic quantitative proteomics. Cell. 143, 951-965 (2010).
  37. Antonelli, A., et al. Efficient inhibition of macrophage TNF-alpha production upon targeted delivery of K48R ubiquitin. Br J Haematol. 104, 475-481 (1999).
  38. Codomo, C. A., Furuyama, T., Henikoff, S. CENP-A octamers do not confer a reduction in nucleosome height by AFM. Nat Struct Mol Biol. 21, 4-5 (2014).
  39. Thrower, J. S., Hoffman, L., Rechsteiner, M., Pickart, C. M. Recognition of the polyubiquitin proteolytic signal. The EMBO journal. 19, 94-102 (2000).
  40. Yoda, K., et al. Human centromere protein A (CENP-A) can replace histone H3 in nucleosome reconstitution in vitro. Proc Natl Acad Sci U S A. 97, 7266-7271 (2000).
  41. Shelby, R. D., Vafa, O., Sullivan, K. F. Assembly of CENP-A into centromeric chromatin requires a cooperative array of nucleosomal DNA contact sites. J Cell Biol. 136, 501-513 (1997).
  42. Majumder, S., Fisk, H. A. Quantitative immunofluorescence assay to measure the variation in protein levels at centrosomes. J Vis Exp. (2014).
  43. Masumoto, H., Masukata, H., Muro, Y., Nozaki, N., Okazaki, T. A human centromere antigen (CENP-B) interacts with a short specific sequence in alphoid DNA, a human centromeric satellite. J Cell Biol. 109, 1963-1973 (1989).
  44. Yoda, K., Kitagawa, K., Masumoto, H., Muro, Y., Okazaki, T. A human centromere protein, CENP-B, has a DNA binding domain containing four potential alpha helices at the NH2 terminus, which is separable from dimerizing activity. J Cell Biol. 119, 1413-1427 (1992).
  45. Sugata, N., et al. Human CENP-H multimers colocalize with CENP-A and CENP-C at active centromere--kinetochore complexes. Hum Mol Genet. 9, 2919-2926 (2000).
  46. Earnshaw, W. C., Ratrie, H. 3rd, Stetten, G. Visualization of centromere proteins CENP-B and CENP-C on a stable dicentric chromosome in cytological spreads. Chromosoma. 98, 1-12 (1989).
  47. Goshima, G., Kiyomitsu, T., Yoda, K., Yanagida, M. Human centromere chromatin protein hMis12, essential for equal segregation, is independent of CENP-A loading pathway. J Cell Biol. 160, 25-39 (2003).
  48. Liu, S. T., Rattner, J. B., Jablonski, S. A., Yen, T. J. Mapping the assembly pathways that specify formation of the trilaminar kinetochore plates in human cells. J Cell Biol. 175, 41-53 (2006).
  49. Gascoigne, K. E., Cheeseman, I. M. T time for point centromeres. Nat Cell Biol. 14, 559-561 (2012).
  50. Gascoigne, K. E., et al. Induced ectopic kinetochore assembly bypasses the requirement for CENP-A nucleosomes. Cell. 145, 410-422 (2011).
  51. Nishino, T., et al. CENP-T provides a structural platform for outer kinetochore assembly. EMBO J. 32, 424-436 (2013).
  52. Malvezzi, F., et al. A structural basis for kinetochore recruitment of the Ndc80 complex via two distinct centromere receptors. EMBO J. 32, 409-423 (2013).
  53. Schleiffer, A., et al. CENP-T proteins are conserved centromere receptors of the Ndc80 complex. Nat Cell Biol. 14, 604-613 (2012).
  54. Rago, F., Gascoigne, K. E., Cheeseman, I. M. Distinct organization and regulation of the outer kinetochore KMN network downstream of CENP-C and CENP-T. Curr Biol. 25, 671-677 (2015).
  55. Nishino, T., et al. CENP-T-W-S-X forms a unique centromeric chromatin structure with a histone-like fold. Cell. 148, 487-501 (2012).
  56. Bodor, D. L., et al. The quantitative architecture of centromeric chromatin. Elife. 3, e02137 (2014).
  57. Oliver, C. Ch 58. Molecular Biomethods Handbook. Rapely, R., Walker, J. M. Humana Press. 1063-1079 (2008).
  58. Terasima, T., Tolmach, L. J. Changes in x-ray sensitivity of HeLa cells during the division cycle. Nature. 190, 1210-1211 (1961).
  59. Levenson, G. B. R. Ch 8. Biomedical Photonics Handbook. Vo-Dinh, T. uan CRC Press LLC. 8-19 (2003).
  60. Sanderson, J. Fluorescence bleed-though. Available from: http://www.gum2012.fionastoreydesign.co.uk/Downloads/Bleed through text.pdf (2011).
البروتينات التحليل المناعي من الداخلية والخارجية السنترومير-الحيز الحركي
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Niikura, Y., Kitagawa, K. Immunofluorescence Analysis of Endogenous and Exogenous Centromere-kinetochore Proteins. J. Vis. Exp. (109), e53732, doi:10.3791/53732 (2016).More

Niikura, Y., Kitagawa, K. Immunofluorescence Analysis of Endogenous and Exogenous Centromere-kinetochore Proteins. J. Vis. Exp. (109), e53732, doi:10.3791/53732 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter