Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Immunofluorescens Analyse af endogene og eksogene Centromer-kinetochore Proteiner

Published: March 3, 2016 doi: 10.3791/53732

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

"centromerer" blev klassisk defineret som regioner af undertrykt meiotisk rekombination i genetik og senere anerkendt som den primære konstriktion af mitotiske kromosomer, som spiller en væsentlig rolle i nøjagtig kromosom segregering under mitose. "Kinetochores" blev beskrevet som de flerlagsstrukturer, som binder til mikrotubuli ved overfladen centromerer, som afsløret ved elektronmikroskopi; "kinetochores" blev senere defineret som det makromolekylære kompleks, der lokaliseres på centromeren af ​​mitotiske kromosomer. Trods en dramatisk divergens af centromere DNA-sekvenser blandt hvirveldyr, kinetochore struktur og sammensætning er stærkt konserverede. En dynamisk samspil mellem spindel mikrotubuli og kinetochore er nødvendig for trofaste segregering af kromosomer under mitose, og defekter i centromer-kinetochore funktion fører til aneuploidi og dermed kræft.

Centromeren i de fleste eukaryoterhar ingen definerede DNA-sekvens, men er sammensat af store arrays (0,3-5 MB) repetitiv alphoid DNA bestående af 171-bp α-satellit-DNA. Undtagen i knopskydende gær, er centromer identitet opnås ikke af DNA-sekvensen, men ved tilstedeværelsen af et særligt nukleosom der indeholder histon H3-variant CenH3 (centromerfusion Protein A [CENP-A] i mennesker). 5 CENP-A nukleosomer lokalisere til den indre plade af mammale kinetochores 7 og binder til de 171 bp α-satellit-DNA. Aktive centromerer kræver CENP-A-holdige nukleosomer at dirigere rekrutteringen af ​​en konstitutiv centromer-associeret netværk (CCAN) og kinetochore proteiner som tilsammen regulerer fastgørelse af kromosomer til mitosespindelen og efterfølgende cyklus progression gennem spindel checkpoint.

I lyset af ovenstående momenter har CENP-A blevet foreslået at være den epigenetiske mærke centromeren 8; imidlertid den proces, hvorved CENP-A er inkorporeret into centromerregionen DNA og de faktorer, der er ansvarlige for denne integration er endnu ikke blevet godt karakteriseret. En kort centromerfusion-targeting domæne (CATD) bor i histon fold regionen CENP-A, og erstatning af det tilsvarende område af H3 med CATD er tilstrækkelig til direkte H3 til centromeren. 9 Adskillige undersøgelser antydet funktionelle roller for posttranslationel modifikation (PTM) af CENP-A 12-16; imidlertid de molekylære mekanismer i disse PTMS af CENP-A i rekrutteringen til centromerer endnu ikke blevet belyst. Vi har tidligere rapporteret, at CUL4A-RBX1-COPS8 E3-ligaseaktivitet er påkrævet for CENP-A K124 ubiquitylering og lokalisering af CENP-A til centromerer. 17

Opdagelsen og karakterisering af kinetochore proteiner har ført til ny indsigt om kromosom adskillelse. 18. Mere end 100 kinetochore komponenter er blevet identificeret i hvirveldyr celler ved forskellige tilgange. 19,20 En understående af hvordan kinetochores samle og funktion kommer også fra karakteriseringen af de cellulære funktioner af hver centromer-kinetochore proteiner og protein-protein-netværk i cellerne. 19 Direkte visualisering og avancerede billeddiagnostiske metoder i fluorescens mikroskopi giver bemærkelsesværdig opløsning på centromerfusioner-kinetochore komponenter og tillade direkte observation af specifikke molekylære komponenter i centromerer og kinetochores. Desuden metoder til indirekte immunfluorescerende (IIF) farvning hjælp specifikke antistoffer er afgørende for disse observationer. Men trods talrige rapporter om IIF-protokoller, få drøftet i detaljer problemer med specifikke centromerfusioner-kinetochore proteiner. 1-4 således udvikle og rapportering metoder IIF farvning og en kvantitativ IIF assay til specifikt at analysere hver centromer-kinetochore protein er ekstremt vigtigt. I IIF-farvning, skal man fortsætte med farvningsprotokollen at undgå tab af proteinet af interesse ellerresten af ​​cellen. Men fiksering ødelægger antigene steder lejlighedsvis, og forskellige antistof-antigen kombinationer fungerer dårligt med et fiksativ, men meget godt med en anden, 21 og valg af fiksativ høj grad afhænger af protein (er) af interesse. Derfor forskellige fastgørelse metoder er afgørende IIF-farvning af centromerfusioner-kinetochore proteiner.

Der er udviklet her optimerede fremgangsmåder til indirekte immunfluorescerende (IIF) farvning og et assay til at løse lokalisering af endogene centromerfusioner-kinetochore proteiner, herunder CENP-A og FLAG-mærket exogene CENP-A-proteiner, og kvantificering af disse proteiner i humane celler. Disse metoder kan anvendes til analyse af centromerfusioner-kinetochore proteiner i andre arter.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Cell Culture og transfektion

  1. Sætte et dækglas (22 mm x 22 mm) i en 6-brønds polystyrenplade. Valgfrit pels et dækglas med Poly-L-lysin, 0,1% w / v, i vand (se liste over materialer / udstyr) til at holde mitotiske celler på dækglasset at følge nedenstående trin:
    Bemærk: skal bestemmes Optimale betingelser for hver cellelinie og anvendelse.
    1. Aseptisk coat kultur overflade med Poly-L-Lysin, 0,1% vægt / volumen, i vand (0,4 ml / brønd af en 6-brønds polystyrenplade). Rock forsigtigt for at sikre jævn belægning af kulturen overflade.
    2. Efter 5 minutter fjernes opløsning ved aspiration, og skyl overfladen med steril vævskultur kvalitetsvand.
    3. Tør mindst 2 timer, før der indføres celler og medium.
  2. Seed HeLa-celler 17 eller HeLa Tet-Off celler 17,22 på et dækglas (22 mm x 22 mm) løber i en 6-brønds polystyrenplade. Kontroller at celle massefylde er 5,4 x 10 5 per brønd. kulturcelleri høj-glucose DMEM med 10% FBS og 1% penicillin-streptomycin.
    Bemærk: For at opnå optimale resultater, empirisk bestemme celletætheden at bruge i såning.
  3. Inkuber cellerne ved 37 ° C i en atmosfære af 5% CO2 i 18 timer.
    Bemærk: I tilfælde af HeLa Tet-Off-celler, transskription af det exogene gen er aktiv i fravær af inducer (dvs. tetracyclin / doxycyclin) derfor kultur celler uden tetracyklin / doxycyclin og transficere transient med pTRM4 overekspression vektor (tabel 2 ), hvis transkription reguleres af TRE-promotoren (se nedenfor).
  4. Atten timer efter podning, transficere celler som følger:
    1. Lav løsning A ved at blande 1,5 pi siRNA oligo (20 uM udglødet lager, Tabel 1) og / eller 2,0 pg plasmid (tabel 2) i 50 pi reduceret serum medium (se liste over materialer / udstyr), og inkuberes ved stuetemperatur i 5 min .
      Bemærk: I denne analyse,CA-UTR siRNA'er (en blanding af 5 'og 3' UTR siRNA, tabel 1) blev co-transficeret til anvendelse i protokol 3 og 4 (se diskussionen).
    2. Lav opløsning B ved at blande 0,75 pi transfektionsreagens I (se liste over materialer / udstyr) i 50 pi reduceret serum medium og inkuberes ved stuetemperatur i 5 min.
      Bemærk: En valgfri trin er tilsætning af 1,0 pi transfektionsreagens II (se liste over materialer / udstyr).
    3. Bland løsninger A og B sammen, og inkuberes ved stuetemperatur i 15 minutter.
    4. Vask de dyrkede celler én gang med PBS, og derefter tilsættes 500 pi nedsatte serum-medium til hver brønd i 6-brønds polystyrenplade. Tilsæt blanding af A og B (dvs. RNA og / eller DNA-lipid-kompleks) direkte til hver af de individuelle godt.
      Bemærk: Endelig koncentration er 3,3 ug / ml (plasmid); 50 nM (siRNA).
    5. Inkuber cellerne ved 37 ° C i en atmosfære af 5% CO2 i 4,5 timer. Skift medium til høj-glucose DMEM with 10% FBS og 1% penicillin-streptomycin.
    6. Inkuber cellerne ved 37 ° C i en atmosfære af 5% CO2 i 48-72 timer efter transfektion.
      Bemærk: For at opnå optimale resultater skal inkubationstiden for cellevækst før fiksering bestemmes empirisk, og protein udtømning og / eller udtryk skal bekræftes af Western blot analyse (se protokol 6).
    7. Hvis mitotisk celleanalyse er af interesse, tilsættes paclitaxel (10 nM) til dyrkede celler 24 timer før fiksering, eller tilføje TN16 (0,5 uM) til dyrkede celler 2,5 timer før fiksering.

2. Cell Fiksering og immunfluorescensfarvning at Detect Endogen Centromer-kinetochore Proteiner (paraformaldehydfiksering)

  1. Fremstilling af fiksativ, puffere og reagenser.
    1. Forberede frisk 50 ml 4% paraformaldehyd i PBS, pH 7,4.
      1. Tilsæt 40 ​​ml 1 x PBS til et bægerglas på en omrøringsplade i et ventileret stinkskab. Heat mens stirring til ca. 60 ° C. Tilsættes 2 g paraformaldehyd pulver til den opvarmede PBS.
      2. Hæv langsomt pH ved tilsætning af 1 ml 1 N NaOH i alt, fordi pulveret ikke umiddelbart vil opløses.
        Bemærk: Opløsningen sender efter tilsætning af NaOH.
      3. Når paraformaldehyd er opløst, køligt og filtreres.
      4. Justere pH med 1 N HCI til pH 7,4, og volumenet af opløsningen med 1 × PBS til 50 ml.
        Bemærk: Portioner af opløsningen kan fryses eller opbevares ved 2-8 ° C, så længe som 1 uge. Opløsningen skal være iskold eller opbevaret ved 4 ° C, indtil det skal bruges.
    2. Forbered 50 ml buffer KB1, som består af 10 mM Tris-HCI, pH 7,5; 150 mM NaCl; 0,5% BSA; og 0,5% Triton X-100.
      Bemærk: BSA skal være frisk tilsat.
      Bemærk: Bufferen KB-serien er baseret på buffer KB beskrevet i tidligere rapporter 1,2,4.
    3. Forbered 50 ml buffer KB2, som består af 10 mM Tris-HCI,pH 7,5; 150 mM NaCl; og 0,5% BSA.
      Bemærk: BSA skal være frisk tilsat.
    4. Forbered 1 ml puffer KB3 indeholdende DAPI (50 ng / ml).
    5. Fremstilling af 100 ml monteringsmedium, som består af 1 mg / ml p-phenylendiamin; 10% PBS, og 90% glycerol.
      1. Justere pH 1 × PBS til 9,8 med 1 N NaOH, opløse p-phenylendiamin i opløsningen, og derefter tilføje glycerol.
      2. Store 1 ml alikvoter ved -80 ° C. Beskyttes mod lys.
  2. Fjern dyrkningsmediet ved aspiration ved 48-72 timer efter transfektion (se protokol 1) for celle fiksering. Skyl celler gang med PBS. Påfør PBS til siden af ​​kulturbrøndene at undgå at forstyrre overfladen af ​​cellerne.
    Bemærk: Den optimale tidspunkt for celle fiksering skal bestemmes empirisk.
  3. Fikseres cellerne i 4% paraformaldehyd i PBS i 30 minutter ved 4 ° C. Kuvetterne skylles to gange med puffer KB2 til tilstrækkeligt fjerne resterende 4% paraformaldehyd.
  4. PermeabiLize prøverne i buffer KB1 i 30 minutter ved stuetemperatur. Skyl cellerne en gang med buffer KB2, og tilføj buffer KB2 i 5 minutter ved stuetemperatur til yderligere blokere steder af ikke-specifik binding.
    Bemærk: Buffer KB1 bidrager også betydeligt til blokering.
  5. Fjern et dækglas (22 mm x 22 mm) fra en 6-brønds polystyrenplade med en pincet. Ved hjælp af en hydrofob barriere pen (se liste over materialer / udstyr), tegne en bleg grøn firkant eller cirkel for at danne en hydrofob barriere omkring hver dækglas prøve. Rør ikke ved, eller komme for tæt på cellerne med den hydrofobe barriere pen. Sæt dækglasset i nye 6-brønds polystyrenplade.
  6. Fortynd et primært antistof til CENTROMER eller kinetochore protein (fortyndingsforhold på 1: 100 til 1: 200; se også liste over materialer / udstyr) og enten et anti-CENP-B-antistof (fortynding på 1: 400) eller et anti- centromerfusion antistof (ACA) (fortynding på 1: 2.000) som en centromer placering markør i buffer KB2.
    Bemærk: For at opnå optimale resultater, den endelige koncentraning af det primære antistof i denne opløsning skal bestemmes empirisk.
  7. Påfør et tilstrækkeligt volumen (ca. 30 ul) af den fortyndede primære antistof til at fordybe celleprøven. Inkubér celleprøven i 1 time ved 37 ° C. Skyl cellerne 3 gange med buffer KB2.
  8. Anvendelse af buffer KB2, fortyndes en fluorofor-konjugeret sekundært antistof (fortynding på 1: 100 til 1: 200) rettet mod hver primære antistof.
    Bemærk: For at opnå optimale resultater skal den endelige koncentration af det sekundære antistof i denne opløsning bestemmes empirisk.
  9. Påfør et tilstrækkeligt volumen (et fald på ca. 30 pi på dækglasset) af den fortyndede sekundære antistof for at fordybe celleprøven. Inkubér celleprøven i 1 time ved 37 ° C. Skyl cellerne 5 gange med buffer KB2 i en periode på 30 minutter (fem seks minutters vaske).
    Bemærk: For at opnå optimale resultater (dvs., for minimalt tab af celler), skal den optimale vask tilstand bestemmes empirically.
  10. Påfør en tilstrækkelig mængde buffer KB3 indeholdende DAPI (50 ng / ml) for at fordybe celleprøven. Inkubér celleprøven i 5 minutter ved stuetemperatur. Skyl cellerne 1-2 gange med buffer KB2.
  11. Monter dækglas, der indeholder celleprøven på mikro slide.
    1. Placer en dråbe monteringsmedium i centrum af mikro slide.
    2. Fjerne væske fra celleprøven og, ved hjælp af hænder eller pincet, placere prøven i centrum af mikro slide. Undgå luftbobler.
    3. Fjern overskydende montering medium med en køkkenrulle.

3. Cell Fiksering og immunfluorescensfarvning af C-terminale Flag-tagget CENP-A-proteiner (Acetone Fiksering)

  1. Forberedelse
    1. Forbered iskold 75% acetone.
    2. Forberede frisk 50 ml PBS (pH 7,4) indeholdende 0,5% skummetmælk og 0,5% BSA.
    3. Forberede frisk 50 ml PBS (pH 7,4) indeholdende 0,1% skummetmælk og 0,1% BSA.
    4. Forbered 1 ml PBS (pH 7,4) indeholdende DAPI (50-100 ng / ml).
    5. Forbered 100 ml montering medium som beskrevet i 2.1.5.
  2. Fjern dyrkningsmediet ved aspiration ved 48-72 timer efter transfektion (se protokol 1) for celle fiksering. Skyl celler gang med PBS. Påfør PBS til siden af ​​kulturen godt for at undgå at forstyrre overfladen af ​​cellerne.
    Bemærk: Den optimale tidspunkt for celle fiksering skal bestemmes empirisk.
  3. Fikseres cellerne i iskold 75% acetone, og inkuber cellerne i 10 minutter ved -20 ° C. Tørre celler på dækglasset i et stinkskab i 30-60 minutter ved stuetemperatur.
    Bemærk: For at opnå optimale resultater skal den tid er nødvendig for fiksering og celle tørring bestemmes empirisk.
  4. Brug af hydrofobe barriere pen (se liste over materialer / udstyr), tegne en bleg grøn firkant eller cirkel for at danne en hydrofob barriere omkring hver dækglas prøve. Rør ikke ved, eller komme for tæt på cellerne med den hydrofobe barriere pen.
  5. Bloker nonspecSp ec ifik bindingssteder på cellerne ved at tilsætte PBS indeholdende 0,5% skummetmælk og 0,5% BSA i 5 minutter ved stuetemperatur.
  6. Anvendelse af PBS indeholdende 0,1% skummetmælk og 0,1% BSA, fortyndes et anti-Flag-antistof (1: 1.000 fortyndingsforhold) og enten et anti-CENP-B-antistof (fortynding på 1: 200) eller ACA (1: 2.000 fortyndingsforhold ) som en centromerfusion placering markør.
    Bemærk: For at opnå optimale resultater skal den endelige koncentration af det primære antistof i denne opløsning bestemmes empirisk.
  7. Påfør et tilstrækkeligt volumen (ca. 30 ul) af den fortyndede primære antistof til at fordybe celleprøven. Inkubér celleprøven i 1 time ved 37 ° C. Skyl cellerne 5 gange med den blokerende buffer i en periode på 30 min.
    Bemærk: Celler kan skylles med PBS. For at opnå optimale resultater (dvs. at undgå tab af celler), skal de optimale vaskebetingelser bestemmes empirisk.
  8. Fortynd en fluorofor-konjugeret sekundært antistof (fortynding på 1: 100 til 1: 200) rettet modden enkelte primære antistof i PBS indeholdende 0,1% skummetmælk og 0,1% BSA.
    Bemærk: For at opnå optimale resultater skal den endelige koncentration af det sekundære antistof i denne opløsning bestemmes empirisk.
  9. Påfør et tilstrækkeligt volumen (ca. 30 ul) af den fortyndede sekundære antistof for at fordybe celleprøven. Inkubér celleprøven i 1 time ved 37 ° C. Skyl cellerne 2 gange med PBS indeholdende 0,1% skummetmælk og 0,1% BSA.
    Bemærk: PBS alene kan også bruges til at vaske cellerne.
  10. Påfør en tilstrækkelig mængde af PBS indeholdende DAPI (50-100 ng / ml) for at fordybe celleprøven. Inkubér celleprøven i 5 minutter ved stuetemperatur. Skyl cellerne 1-2 gange med PBS.
  11. Monter dækglasset indeholdende celleprøven på mikro dias som beskrevet i 2.11.

4. Cell Fiksering og immunfluorescensfarvning af N-terminalt FLAG-mærket CENP-A-proteiner (Methanol Fiksering)

  1. Forberedelse
    1. Forbered iskold methanol.
    2. Forbered TBS (pH 7,4) indeholdende 4% gedeserum.
    3. Forbered 1 ml TBS (pH 7,4) indeholdende DAPI (50-100 ng / ml).
    4. Forbered 100 ml montering medium som beskrevet i 2.1.5.
  2. Fjern dyrkningsmediet ved aspiration ved 48-72 timer efter transfektion (se protokol 1) for celle fiksering. Skyl celler gang med TBS. Påfør TBS til siden af ​​kultur brønde for at undgå at forstyrre overfladen af ​​celler.
    Bemærk: Den optimale tidspunkt for celle fiksering skal bestemmes empirisk.
  3. Fikseres cellerne i iskold methanol, og inkuber cellerne i 6 min ved -20 ° C. Kuvetterne skylles to gange med TBS til tilstrækkeligt fjerne resterende methanol.
  4. Ved hjælp af en hydrofob barriere pen (se liste over materialer / udstyr), tegne en bleg grøn firkant eller cirkel for at skabe en hydrofob barriere omkring hver dækglas prøve. Rør ikke ved, eller komme for tæt på cellerne med den hydrofobe barriere pen.
  5. Blokere uspecifikke bindingssteder på cells ved at tilføje TBS indeholdende 4% gedeserum. Inkuber i 10 minutter ved stuetemperatur.
  6. Fortynd et anti-Flag-antistof (1: 1.000 fortynding) og enten et anti-CENP-B-antistof (fortynding på 1: 200) eller ACA (1: 2.000 fortyndingsforhold) som en centromer placering markør i TBS indeholdende 4% gedeserum .
    Bemærk: For at opnå optimale resultater skal den endelige koncentration af det primære antistof i denne opløsning bestemmes empirisk.
  7. Påfør et tilstrækkeligt volumen (ca. 30 ul) af den fortyndede primære antistof til at fordybe celleprøven. Inkubér celleprøven i 1 time ved 37 ° C. Skyl cellerne 5 gange med den blokerende buffer i en periode på 30 min. For at opnå optimale resultater (dvs. den minimale tab af celler), skal den optimale vask tilstand bestemmes empirisk.
  8. Fortynd en fluorofor-konjugeret sekundært antistof (fortynding på 1: 100 til 1: 200) rettet mod hvert primært antistof i TBS indeholdende 4% gedeserum.
    Bemærk: For at opnå optimale resultater, den final koncentrationen af ​​det sekundære antistof i denne opløsning skal bestemmes empirisk.
  9. Påfør et tilstrækkeligt volumen (ca. 30 ul) af den fortyndede sekundære antistof for at fordybe celleprøven. Inkubér celleprøven i 1 time ved 37 ° C. Skyl cellerne 3 gange med blokeringsbuffer.
  10. Påfør en tilstrækkelig mængde TBS indeholdende DAPI (50-100 ng / ml) for at fordybe celleprøven. Inkubér celleprøven i 5 minutter ved stuetemperatur. Skyl cellerne 1-2 gange med TBS.
  11. Monter dækglas, der indeholder celleprøven på mikro dias som beskrevet i 2.11.

5. Immunofluorescens Billede Observation, Acquisition, Kvantificering og analyse

  1. Observere celleprøven gennem en motoriseret fluorescensmikroskop udstyret med en 63X og 100X olieimmersion linse, en ekstern kompakt lyskilde, og en digital CCD-kamera.
  2. Udfør erhvervelse og behandling billede, herunder udfoldning, ved hjælp af SoftwareEn eller Softwares B1 og B2 (se liste over materialer / udstyr). Se supplerende kode filer (5.2.1) for alle kommandoer, der bruges i Software A. For alle kommandoer, der bruges i Softwares B1 og B2, se (5.2.2) i supplerende kode filer.
  3. Brug en tidligere beskrevet metode 23-25 ​​at kvantificere signaler af centromerfusioner-kinetochore proteiner (f.eks resterende signaler af CENP-A på centromeren) med de følgende mindre ændringer:
    1. Vælg område af centromerfusioner-kinetochore proteiner og af baggrunden som følger:
      1. Mitotisk celle: (centromer-kinetochore region) Vælg område overlapper med kromosomer farvet med DAPI; (baggrund regionen) og området uden kromosomer men inde i identisk enkelt celle (dvs. cytosolisk region).
      2. Interfase celle: (centromer-kinetochore region) Vælg område overlapper med kromatin farvet med DAPI; (Baggrund regionen) og området uden kromatin men inde i identiske enkelt celle (<em> dvs. cytosolisk region).
        Bemærk: Se også Supplerende kode filer (5.2.1.4.3) eller (5.2.2.6.4) for områdevalg med Software A eller software B2 hhv.
    2. Kvantificer procentdelen af ​​tilbageværende signaler ved de centromerer ved hjælp af Software A eller B. For denne opgave, skal du bruge følgende formel:
      Resterende signaler af centromer-kinetochore protein ved centromeren-kinetochore
      ligning1
      hvor s er det signal lysstyrke valgte område, hvilket bekræftes af ACA eller CENP-B farvning; b er baggrunden signal lysstyrke, r prøve er henvisning ACA eller CENP-B-signaler for siRNA (er) -behandlede celler; og r ctrl er referencen ACA eller CENP-B-signaler til Luc siRNA-transficerede celler.
      Bemærk: I denne analyse blev CENP-B-signaler anvendt som referencesignaler for CUL4A og RBX1 som beskrevet i tidligere rapporter.
    3. Brug en Excel-fil til denne beregning efter at kopiere og indsætte de rå data fra signalet kvantificering softwaren beskrevet ovenfor. Se også Supplerende kode Filer: (5.2.1.4) og (5.2.2.6) for yderligere oplysninger. Et eksempel på beregning er vist i tabel 3.
  4. Analyser mindst 20 celler til at fjerne variation i farvning og erhvervelse billede for hver måling niveau. Valgfrit bruge "gennemsnitsværdi" af resterende centromerfusioner-kinetochore signaler for hver analyserede celle at sammenligne disse værdier mellem forskellige centromerfusioner-kinetochore proteiner.

6. Western blot-analyse af Total protein

  1. Resuspender cellerne i denaturerende puffer A (20 mM Tris-HCI, pH 7,4; 50 mM NaCI; 0,5% Nonidet P-40; 0,5% deoxycholat; 0,5% SDS; 1 mM EDTA, og fuldstændig EDTA-fri proteaseinhibitor cocktail), 26 emne suspensionen til en lydbehandling og frysning-optøning proces, og foranstaltningproteinkoncentrationer som følger:
    1. For lydbehandlingsprocessen, tilsættes 50 pi puffer A til cellerne opsamlet fra to brønde i en 6-brønds polystyrenplade på 48-72 timer efter transfektion (se protokol 1). Betjen en sonikator udstyret med disruptor horn og mikrospids (se liste over materialer / udstyr) for total 15 sek intermitterende-puls varighed (arbejdscyklus 50%) pr én prøve.
    2. For frysning-optøning proces, fryse celler med flydende nitrogen og optø cellerne ved stuetemperatur.
    3. Mål proteinkoncentrationer anvendelse af et kommercielt protein assayreagens I eller II (se liste over materialer / udstyr).
      Bemærk: Lysater fortyndes med forholdet 1:10 i målingen af ​​proteinkoncentrationer med enten reagens I eller II. Ved denne fortynding, SDS til stede i buffer A viser lille eller ingen indblanding i denne måling.
  2. Bland lysatet indeholdende 20-30 ug totalt protein med 2 × eller 4 × SDS-PAGE loadingbuffer. 27 Kog prøverne for5 min og derefter indlæse dem på en 12,0% -15,0% denaturerende SDS-polyacrylamid gel til elektroforese.
  3. Overfør proteinerne separeret ved SDS-PAGE på en PVDF membran ved anvendelse af en Western blotting metode beskrevet tidligere. 17,24,27-31
    1. Blokere ikke-specifikke bindingssteder på membranen med 5% fedtfri mælk i 1 × PBS, og derefter inkubere membranen med opløsninger af fortyndede primære antistoffer i 1 time ved stuetemperatur. Se liste over materialer / Udstyr til detaljerede oplysninger (f.eks fortyndingsforhold) af hver primære antistof.
    2. Efter vask af membranen 3-4 gange (hver 3- til 5-min inkubation med omrystning) med PBS-T-buffer (1 × PBS og 0,1% Tween-20), inkubere membranen i en blanding af nær-infrarød (IR) fluorescerende farvestof-konjugeret sekundære antistoffer (fortynding på 1: 20.000), DyLight-konjugerede sekundære antistoffer (fortynding på 1: 20.000), og / eller peberrodsperoxidase (HRP) -konjugeret sekundære antistoffer (fortyndet i PBS-T; dilutiom forhold på 1: 10.000) i 1 time ved stuetemperatur. Se liste over materialer / Udstyr til detaljerede oplysninger (f.eks fortyndingsforhold) af hvert sekundært antistof.
  4. Vask membranen 3 gange, og derefter scanne membranen til at analysere proteiner med det infrarød billeddannelse og / eller kemiluminescens imager for immunoblot detektion (se liste over materialer / udstyr).
    1. For at bruge infrarød billeddannelse, se (6.4.1) i supplerende kode filer.
    2. For at bruge chemiluminescens imager, se (6.4.2) i supplerende kode filer. Brug en ultra-følsom forstærket kemiluminescerende (ECL) substrat (se liste over materialer / udstyr) til dette system.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Immunofluorescensanalyse af endogen CENP-A understøtter den hypotese, at CUL4A-E3 ligase er nødvendig for lokalisering af CENP-A til centromerer
Vores seneste undersøgelser viste, at CUL4A-RBX1-COPS8 E3 ligase aktivitet er nødvendig for ubiquitylering af lysin 124 (K124) på CENP-A og lokalisering af CENP-A til centromerer. 17 Oprindeligt var interfasen-centromer kompleks (Içen) isoleret ved anti-CENP-a: nativt chromatin immunoprecipitation, 32-34 og det er blevet antaget, at nogle af de Içen proteiner kan spille en rolle i lokalisering CENP-a til centromerer. Derfor blev udført siRNA Knockdown eksperimenter til screening for proteiner, hvis fravær af ekspression inducerede flytning af CENP-A ved centromerer 17 (data ikke vist): asynkront voksende HeLa-celler blev transficeret med Cullin 4A (CUL4A) siRNA eller RBX1 siRNA for de tider, kræves for optimal protein depletion (48 timerr for CUL4A og 72 timer for RBX1). Celler transficeret med CUL4A siRNA viste en signifikant delokalisering af CENP-A ved centromerer (Figur 1A-C). Som det ses i figur 2G, protein niveauer af CENP-A i totale cellelysater af CUL4A siRNA-transficerede celler lignede CENP-A-niveauer i lysater fra luciferase (Luc) siRNA-transficerede celler under de samme dyrkningsbetingelser. Muligheden for off-target effekter af CUL4A siRNA blev udelukket, fordi ektopisk ekspression af CUL4A-Flag reddet reduktionen af CENP-A ved centromerer når CUL4A siRNA målrettet 3'UTR (figur 2A-C). Protein- niveauerne af CENP-A i totale cellelysater blev bekræftet at være magen til CENP-A-niveauer i lysater fra Luc siRNA-transficerede celler under de samme dyrkningsbetingelser uanset cellecyklus fase (figur 1B, 2G); således, den mulighed, at CUL4A depletion forårsaget CENP-A proteinnedbrydning blev elimineret.

35 og indeholder 3 hovedelementer: en cullin stillads, en RING finger protein (RBX1 eller RBX2) og et ubiquitin-ladet E2-enzym, der er rekrutteret af RBX1 eller RBX2, 36 a RING finger protein rekrutterer også substrat adapter, der placerer substrater i nærhed til E2-enzym for at lette ubiquitin overførsel. 36 RBX1 siRNA'er inducerede en signifikant reduktion af CENP-A ved centromerer (Figur 1D-F) under de forhold, som protein niveauer af CENP-A i alt cellelysater af RBX1 siRNA-transficerede celler lignede CENP-A niveauer i lysater fra Luc siRNA-transficerede celler (figur 2G). Nedbrydning af CENP-A protein enten ved RBX1 depletering eller ved kombinationen af CUL4A og RBX1 udtømning under de samme dyrkningsbetingelser blev ikke observeret (fig 2G). Muligheden for off-target virknings af RBX1 siRNA blev udelukket, fordi ektopisk udtryk for Flag-RBX1 reddet reduktionen af CENP-A ved centromerer når RBX1 siRNA målrettet 3'UTR (figur 2D-F). Disse resultater antydede, at CUL4A-RBX1-E3 ligase er nødvendigt for, at lokalisering af CENP-A til centromerer.

Immunofluorescensanalyse af eksogent CENP-A - Flag proteiner indikerer, at CENP-A K124 ubiquitylering er afgørende for lokalisering af CENP-A til centromerer
Tidligere viste vores immunopræcipitation-massespektrometrianalyse at lysin 124 (K124) af CENP-A-Flag er ubiquitylated i HeLa-celler. 17 i krystalstrukturen af CENP-A nukleosom, K124 bor i α3 helix, selvom webstedet er ikke inden for CATD region. 17 Desuden er K124 konserveret blandt pattedyr, fugle, firben, planter og en gruppe af svampe (f.eks budding gær). 17 CENP-A lysin-mutanter (figur 3A) blev konstrueret og testet deres evne til at lokalisere til centromeren. Væsentlig ophævelse af centromerregionen lokalisering af exogent CENP-A K124R mutant med diffuse signaler i både mitotiske og interfase HeLa-celler blev observeret (figur 3B, C). Centromer lokalisering blev ikke signifikant påvirket hverken K9A mutationer (K9 svarer til histon H3 K9 methylering) eller K77R mutationer (K77 er en unik lysin sted i CATD) (figur 3B, C).

Baseret på disse resultater, er to hypoteser foreslået vedrørende in vivo funktion af CENP-A ubiquitylering på K124. Først rolle K124 ubiquitylering er for ubiquitinmedieret proteolyse at eliminere overudtrykt og / eller mislocalized CENP-A til euchromatin. For det andet, hvilken rolle CENP-A ubiquitylering på K124 er til lastning CENP-A på centromerer. For at teste fFØRSTE mulighed blev stabiliteter CENP-A-Flag vildtype og K124R mutanten samt endogen CENP-A, efter cycloheximid (CHX) behandling af CUL4A- eller RBX1-depleterede celler rettet. Disse data antydede, at ubiquitylering af K124 sandsynligvis ikke er involveret i ubiquitinmedieret proteolyse at eliminere overudtrykt og / eller mislocalized CENP-A (data ikke vist). 17. Det blev endvidere bekræftet, at K124R-mutationen ophæver formodede monoubiquitylation og diubiquitylation bands, både i in vivo og in vitro ubiquitylering assays (data ikke vist). 17 Kollektivt antyder disse data, at CUL4A-RBX1 kompleks bidrager til "signalering" ubiquitylering, som er nødvendig for CENP-A lokalisering på centromerer.

Immunofluorescensanalyse af eksogent Flag - CENP-A-proteiner indikerer, at monoubiquitin fusion er tilstrækkelig til at indlæseCENP-A K124R på ​​centromerer
Baseret på ovenstående resultater blev det antaget, at kovalent bundet monoubiquitin tjener som et signal for CENP-A indlades centromerer. For at teste denne hypotese, en N-terminal Flag-tagget og C-terminale ubiquitin-kondenserede vildtype CENP-A og en K124R mutant CENP-A blev konstrueret (figur 4A). Den monoubiquitin mutant Ub (K48R), som mangler en større site for polyubiquitylation 37-39 blev også anvendt til at forhindre ubiquitin-kondenserede CENP-A protein fra potentiel polyubiquitylation. Ved at opfange anti-FLAG immunfluorescerende signaler, blev centromerregionen lokalisering af proteiner kodet af disse konstruktioner testes. Henviser Flag-CENP-A (K124) i det væsentlige ophævet centromer lokalisering af CENP-A (figur 4B og 4C, kolonne [6]), både Flag-CENP-A (WT) og Flag-CENP-A (WT) -Ub ( WT) opretholdt deres centromer lokalisering (figur 4B og 4C, søjler [1] og [2]). DetFlag-CENP-A (K124R) -Ub (K48R) protein formentlig efterlignede monoubiquitylated CENP-A, da dette protein væsentligt restaureret lokalisering til centromerer (figur 4C, sammenligne kolonner [5] og [6]) mere effektivt end gjorde CENP-A (K124R) -Ub (WT) (figur 4C, sammenlign kolonner [4] - [6]). Disse data viste, at monoubiquitylation er tilstrækkelig til rekruttering af CENP-A til centromerer.

Figur 1
Figur 1. Immunofluorescensanalyse af endogen CENP-A understøtter den hypotese, at CUL4A-E3 ligase er nødvendig for lokalisering af CENP-A til centromerer (figurerne blev tilpasset fra Niikura et al. 17). (A) CUL4A siRNA induceret delokalisering af CENP-A ved centromerer. HeLa-celler blev transficeret med CUL4A eller luciferase (Luc) siRNA og inkuberet i 48 timer (Tabel 1). Scale bar repræsenterer 10 um. (B) Western blot-analyse af HeLa hele cellelysater anvender samme dyrkningsbetingelser som i (A). Celler blev høstet 48 timer efter transfektion med CUL4A siRNA eller Luc siRNA (tabel 1). GAPDH tjente som en loading kontrol. (C) Kvantitetsbestemte endogene CENP-A-signaler på centromerer vist i (A). Normalisering af signaler blev udført ved anvendelse Luc siRNA-transficerede celler, og de gennemsnitlige procentdele (± SD) er vist. **** P <0,0001 vs Luc siRNA-transficerede celler (Students t-test). (D) RBX1 siRNA induceret delokalisering af CENP-A fra centromerer. HeLa-celler blev transficeret med RBX1 eller Luc siRNA (er) og inkuberes i 72 timer (tabel 1). Scale bar repræsenterer 10 um. (E) Western blot-analyse af HeLa hele cellelysater anvender samme dyrkningsbetingelser som i (D). Celler blev høstet 72 timer efter transfektion med RBX1 oR Luc siRNA (s) (tabel 1). GAPDH tjente som en loading kontrol. (F) Kvantificeret endogene CENP-A-signaler på centromerer vist i (D). Normalisering af signaler blev udført ved anvendelse Luc siRNA-transficerede celler, og de gennemsnitlige procentdele (± SD) er vist. **** P <0,0001 vs Luc siRNA-transficerede celler (Students t-test). Klik her for at se en større version af dette tal.

Figur 2
Figur 2. Supplerende information relateret til figur 1 centromerer (figurerne blev tilpasset fra Niikura et al. 17). (A) Eksogen CUL4A-Flag reddet flytning af CENP-A, når CUL4A siRNA målrettet 3'UTR. HeLa Tet-Off cells blev fastsat til 48 timer efter cotransfektion med siRNA (CUL4A # 2: 3'UTR mål eller Luc, tabel 1) plus plasmidkonstruktionen (pTRM4-CUL4A-Flag- eller vektoren; tabel 2). 4-farve immunfarvning: farvning for DAPI (blå); Flag; endogen CENP-B (rød); og endogent CENP-A (grøn), blev udført, og Flag-positive celler blev sorteret, men Flag billeder er udeladt for enkelthedens skyld. Bemærk: CUL4A # 2 er den samme mål, som dem der er vist i figur 1A-C. Scale bar repræsenterer 10 um. (B) Western blot-analyse af HeLa Tet-Off helcellelysater efter samme dyrkningsbetingelser som vist i (A). GAPDH tjente som en loading kontrol. (C) CENP-A-signaler på centromerer vist i (A) blev kvantificeret ved mikroskopi efter sortering af celler at isolere de er bundet af et anti-Flag-antistof. Normalisering af signaler blev udført med celler transficeret med Luc siRNA plus vektor, og den gennemsnitlige procentdele (± SD) er vist.**** P <0,0001 vs celler transficeret med Luc siRNA plus vektor (venstre kolonne, t-test). (D) Eksogen Flag-RBX1 reddet flytning af CENP-A på centromeren når RBX1 siRNA målrettet 3'UTR . HeLa-celler blev fastsat til 72 timer efter cotransfektion med siRNA (RBX1 # 2: 3'UTR mål eller Luc, tabel 1) plus plasmidkonstruktionen (pcDNA3-Flag-RBX1 eller vektoren; tabel 2). 4-farve immunfarvning: farvning for DAPI (blå); Flag; endogen CENP-B (rød); og endogent CENP-A (grøn), blev udført, og Flag-positive celler blev sorteret, men Flag billeder er udeladt for enkelthedens skyld. Scale bar repræsenterer 10 um. (E) Western blot-analyse af HeLa hele cellelysater efter samme dyrkningsbetingelser som i (D). GAPDH tjente som en loading kontrol. (F) CENP-A-signaler på centromerer vist i (D) blev kvantificeret ved mikroskopi efter sortering af celler for at isolere dem bundet af en n anti-Flag-antistof. Normalisering af signaler blev udført med celler transficeret med Luc siRNA plus vektor, og den gennemsnitlige procentdele (± SD) er vist. **** P <0,0001 vs celler transficeret med Luc siRNA plus vektor (venstre kolonne, t-test). (G) Udtømning af CUL4A og RBX1 påvirkede ikke niveauerne af endogent CENP-A protein. Niveauer af endogent CENP-A protein måltes i HeLa hele cellelysater høstet 72 timer efter transfektion med CUL4A, RBX1, CUL4A plus RBX1 eller Luc siRNA. Otteogfyrre timer efter transfektion blev celler enten ubehandlede (Asyn) eller behandlet med paclitaxel (+ Tax) at inducere standsning i mitose, og de var dyrket i 24 timer. GAPDH tjente som en belastning kontrol. Klik her for at se en større version af dette tal.

32 / 53732fig3highres.jpg "width =" 700 "/>
Figur 3. Immunofluorescensanalyse af exogene CENP-A-Flag-proteiner viste, at CENP-A K124 ubiquitylering er påkrævet for CENP-A lokalisering på centromerer (figurerne blev tilpasset fra Niikura et al. 17). (A) Overekspression af CENP-A- flag-konstruktioner (WT og KR mutanter) blev bekræftet ved Western blot-analyse af HeLa Tet-Off helcellelysater. Celler blev høstet 48 timer efter transfektion med pTRM4-CENP-A-Flag WT, KR-mutanter, eller pTRM4 vektor (tabel 2). Overekspression af CENP-A-Flag blev påvist ved et anti-Flag-antistof. GAPDH tjente som en belastning kontrol. Formodede CENP-A-Flag dimer (##) og CENP-A-Flag monomer (#) er vist. Bemærk: SDS-resistente CENP-A-dimerer er tidligere blevet beskrevet 40,41 (B) The CENP-A K124R mutant viste diffunderet delokalisering fra centromerer.. Signaler fra DAPI (blå), Flag (green), og endogen CENP-B (rød, en centromer styrested) er vist. Bemærk: I modsætning til endogen CENP-A i celler transficeret med CUL4A eller RBX1 siRNA, diffuse signaler viste sig i celler, der overudtrykte eksogene CENP-A K124R-Flag som en fænotype af manglende evne til at være målrettet mod centromerer, formentlig fordi dens udtryk niveauet er ca. 10 - til 25-fold højere end den for endogent CENP-A (data ikke vist) 17 Målestok søjle repræsenterer 10 um (C) Histogrammer af lokaliseringsmønstre vist i (B)... Mere end 50 pro / prometafasen og metafasecellerne og mere end 200 interfaseceller celler pr eksperiment blev talt (n ≥ 3 eksperimenter). De gennemsnitlige procentdele (± SD) er vist. "Andre (Non-centromer)" indikerer meste beskadigede celler, døde celler eller celler med nucleolar lokalisering (kun i interfase), formentlig på grund af transfektion eller andre behandlinger. *** P <0,001 vs. CENP-A WT-Flag (t-test).

Figur 4
Figur 4. Immunofluorescensanalyse af eksogene Flag-CENP-A-proteiner viste, at CENP-A monoubiquitin fusion reddet flytning af CENP-A K124R mutant fra centromerer (Tallene blev tilpasset fra Niikura et al. 17). (A) Skematisk tegninger af hver konstruktion anvendt i denne undersøgelse (se også tabel 2). Den K124R mutation site på CENP-A (rød) og K48R mutationen site på monoubiquitin (blå) er vist. (1) WT: Flag-CENP-A WT, (2) WT-Ub (WT): Flag-CENP-A WT-Ub (WT), (3) WT-Ub (K48R): Flag-CENP-A WT -Ub (K48R), (4) K124R-Ub (WT): Flag-CENP-A K124R-Ub (WT), (5) K124R-Ub (K48R): Flag-CENP-A K124R-Ub (K48R), (6) K124R: Flag-CENP-A K124R (B) Eksogen CENP-A monoubiquitin fusion reddet delokalisering af CENP-A K124R mutant fra centromerer.. DAPI (blå), Flag (grøn), og endogene CENP-B (rød, en centromer placering kontrol) er vist. Scale bar repræsenterer 10 um. (C) Histogrammer af lokaliseringsmønstre vist i (C). Mere end 50 pro / prometafasen og metafasecellerne og mere end 200 interfaseceller celler pr eksperiment blev talt (n ≥ 3 eksperimenter). De gennemsnitlige procentdele (± SD) er vist. **** P <0,0001 og *** P <0,001 vs ikke-smeltet Flag-CENP-A K124R (kolonne [6]) (t-test). Klik her for at se en større version af dette tal.

target siRNA Angivelse i nærværende undersøgelse Target typen siRNA database nummer Forward sekvens (er) Kilde / reference
Luciferase (GL3) - 1 mål RKK9 CUUACGCUGAGUACUUCGAdTdT Elbashir et al., (2001)
CENP-A CA-UTR siRNA pool (2 mål blanding) RKK375 / 5 'UTR t1 CGAGCGGCGCGGACUUCUGCCdTdT Niikura et al., (2015)
RKK383 / 3'UTR t1 UCCUGCACCCAGUGUUUCUGUdGdT Niikura et al., (2015)
CUL4A # 1 1 mål CRKK178 / RKK309 / t1 AGCGAUCGUAAUCAAUCCUGA Niikura et al., (2015)
# 2 (3'UTR) 1 mål CRKK181 / RKK331 / t4 AUGCGGGUUUGAAAUAUGACA Niikura et al., (2015)
RBX1 / ROC1 # 1 siRNA pool (4 mål blanding) CRKK198 / RKK411 / t1 GAAGCGCUUUGAAGUGAAA Niikura et al., (2015)
CRKK198 / RKK413 / t2 GCAUAGAAUGUCAAGCUAA Niikura et al., (2015)
CRKK198 / RKK415 / t3 GCAAGAAGCGCUUUGAAGU Niikura et al., (2015)
CRKK198 / RKK417 / t4 CAACAGAGAGUGGGAAUUC Niikura et al., (2015)
# 2 (3 'UTR) 1 mål CRKK206 / RKK425 / t8 UUCCCUGCUGUUACCUAAUUA Niikura et al., (2015)

Tabel 1. siRNA sekvenser anvendt i denne undersøgelse.

B nummer Relevant egenskab (er) Kilde / reference
B288 pTRM4 Niikura et al., (2006)
B2067 pTRM4-humant CENP-A-Flag Niikura et al., (2015)
B2281 pTRM4-humant CENP-A K9A-Flag Niikura et al., (2015)
B2387 pTRM4-humant CENP-A K77R-Flag Niikura et al., (2015)
B2388 pTRM4-human CENP-A K124R-Flag Niikura et al., (2015)
B2512 pTRM4-Flag-humant CENP-A Niikura et al., (2015)
B2579 pTRM4-Flag-human CENP-A K124R Niikura et al., (2015)
B2513 pTRM4-Flag-humant CENP-A-Ub (WT) Niikura et al., (2015)
B2559 pTRM4-Flag-human CENP-A K124R-Ub (WT) Niikura et al., (2015)
B2515 pTRM4-Flag-human CENP-A-Ub (K48R) Niikura et al., (2015)
B2560 pTRM4-Flag-human CENP-A K124R-Ub (K48R) Niikura et al., (2015)
B2759 pTRM4-human CUL4A-Flag Niikura et al., (2015)
B2624 pcDNA3-Flag-menneskelige RBX1 Niikuraet al., (2015)
B1491 pcDNA3-Flag Niikura et al., (2015)

Tabel 2. Plasmidvektorer anvendt i denne undersøgelse.

R (anti-CENP-B) prøve b (anti-CENP-B) R prøve (subtraheres) Ratio (S prøve: R prøve) Korrigeret Ratio (S prøve: R prøve)
520 514 6 -4,167 0.000
535 445 90 -1,033 0.000
515 431 84 0,274 0,274
562 483 79 0,506 0,506
902 562 340 0,509 0,509
1203 703 500 -0,560 0.000
1014 589 425 -0,819 0.000
768 510 258 -1,345 0.000
555 458 97 -1,845 0.000
781 576 205 -1,146 0.000
556 436 120 0,758 0,758
534 493 41 -1,634 0.000
702 543 159 0,667 0,667
482 429 53 -1,000 0.000 654 531 123 0.740 0.740
1190 607 583 0,384 0,384
552 454 98 0,969 0,969
489 413 76 0,539 0,539
511 452 59 -3,186 0.000
485 475 10 -2,700 0.000
481 441 40 -1,475 0.000
Sum 5,347
Gennemsnit 0,255
R (anti-CENP-B) ctrl b (anti-CENP-B) Ratio (S ctrl: R ctrl) Korrigeret Ratio (S ctrl: R ctrl)
543 483 60 3,017 3,017
526 466 60 2.667 2.667
532 460 72 1,792 1,792
507 457 50 3,520 3,520
491 458 33 4,273 4,273
545 464 81 2.160 2.160
518 484 34 3,559 3,559
461 404 57 2,404 2,404
487 447 40 3.550 3.550
534 477 57 3,965 3,965
528 456 72 3,097 3,097
707 601 106 1,868 1,868
615 528 87 2,828 2,828
660 481 179 1.620 1.620
565 476 89 1,607 1,607
527 455 72 3,583 3,583
560 474 86 2,930 2,930
510 451 59 4,017 4,017
729 586 143 2,678 2,678
634 576 58 3,655 3,655
507 476 31 3,935 3,935
Sum 62,725
Gennemsnit 2,987
Resterende CENP-A-signaler på centromer (%) 8.5

. Tabel 3. Et eksempel på beregning af resterende CENP-A-signaler på centromer (%) Et eksempel på Pro / prometafasen i figur 2F er vist: prøve er RBX1 # 2 (3'UTR) + Vec (midtersøjle i figur 2F ) og kontrol er Luc + Vec (venstre kolonne i figur 2F). Som et resultat, resterende CENP-A-signaler påcentromer (%) = (0,255 / 2,987) x opnås 100 = 8,5% (Eller [5,347 / 62,725] x 100 = 8,5% med samme totale antal celler [dvs 21 celler] analyseret mellem to prøver). Bemærk, at hvis b-værdi er mere end S-værdi (dvs. hvis trækkes værdien er negativ), korrigeret forhold værdi er sat til 0,00.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

I de senere år er mange undersøgelser har udviklet forskellige kvantitativ mikroskopi analyser til fikserede celler. 42 Progress in centromerfusion-kinetochore biologi kræver ofte en forståelse af centromeren-specifik eller kinetochore-specifik funktionen af proteiner, hvoraf subcellulære rumlige-tidsmæssige regulering afspejler de skiftende funktioner disse proteiner under cellecyklusen. Derfor her udviklede vi metoder til IIF farvning og en kvantitativ IIF assay til specifikt at analysere de relative niveauer af endogen og eksogene CENP-A proteiner, som kan finde anvendelse i forskelligt behandlede prøver. I øjeblikket har vi opnået en succes IIF farvning af endogen CENP-I, CENP-H, KNL1, Hec1, og Ska1 hjælp protokol 2 i denne undersøgelse (se Niikura et al 24 og data ikke vist;. Liste over materialer / udstyr om oplysninger af antistoffer) . Fremover kan man anvende den samme metode til at kvantificere niveauet for forskellige centromerfusioner-kinetochore proteiner (både endogenous og Flag-tagget exogene proteiner) vælge de specifikke antistoffer dog vores IIF metoder ikke omfatte påvisning af disse proteiner i levende celler eller i en bestemt enkelt celle under hele cellecyklus. Fordi disse procedurer kræver celler, der skal fastsættes og behandles på separate dækglas, vi introducerede referencesignaler (f.eks ACA eller CENP-B) med henblik på normalisering for at nogenlunde sammenligne signaler mellem forskellige prøver og øge nøjagtigheden af analysen. Fordi ACA inddrage endogene og / eller eksogene CENP-A-signaler, CENP-B som reference signal med henblik på normalisering ville være mere passende til sammenligning, end ville ACA med hensyn til rigtigheden af ​​den kvantitative analyse af CENP-A-signaler. Den aminoterminale region af CENP-B binder til 17-bp motiv af CENP-B box sekvens i alphoid DNA, og den carboxyterminale region af CENP-B danner homodimerer. 43,44 CENP-B ikke colocalize fuldstændigt med CENP-A og / eller andre centromere-kinetochore proteiner, imidlertid er tæt forbundet med dem. 45, mens immunofluorescens med anti-CENP-C-antistoffer typisk giver to adskilte pletter, farvning med anti-CENP-B vises ofte som et enkelt lyse bar forbinder begge søster centromerer. 46 imidlertid i vores makro-skala mikroskopisk observation, nogle CENP-B-signaler tilsyneladende overlappe CENP-A-signaler, især på tidligere mitotiske stadier (profase-prometafasen end sent metafase), også delvis afhængig af observational vinkel og den type fikseringsmiddel anvendes (data ikke vist). I modsætning hertil en kvantitativ IIF assay af CENP-A-signaler, protein lokalisering af referencesignaler bør ikke berøres af udtømning og / eller dysfunktion af CENP-A for objektiv analyse, selv om lokalisering af de fleste af de centromerfusioner-kinetochore proteiner er afhængig af CENP-A lokalisering på centromerer. 47,48 CENP-A-uafhængig kinetochore samlingen er etableret ved at erstatte de DNA-bindende regioner af CENPC og CENP-T med alternative kromosom-targeting domæner der rekrutterer disse proteiner til ektopisk loci. 49,50 Desuden anførte seneste arbejde, at de indre kinetochore komponenter CENP-C og CENP-T handle parallelt for at rekruttere KMN netværket til kinetochores. 51-54 desuden Nishino et al. foreslået, at CENP-TWSX komplekse former et unikt nukleosom-lignende struktur til at generere kontakter med DNA, udvide 'histon koden "ud over kanoniske nucleosomstørrelse proteiner. 55 Fordi centromer lokalisering af CENP- C er afhængig af centromeren lokalisering af CENP-a, kunne 47,48 CENP-TWSX eller især CENP-T være et andet protein kandidat (er) for at tilvejebringe referencesignaler i et kvantitativt IIF assay af CENP-a. Dog bør kandidaten for reference signalering omhyggeligt testet før analysen at bestemme, om lokalisering på centromerer påvirkes af udtømning og / eller dysfunktion af CENP-A. analogt overvejelsebør tages for kvantitative IIF analyser af andre centromerfusioner-kinetochore proteiner: protein lokalisering af referencesignaler bør ikke berøres af udtømning og / eller dysfunktion af target protein til objektiv analyse. I den tidligere undersøgelse, vi brugte ACA som reference signal til kvantitativ IIF analysen af andre centrale-ydre kinetochore proteiner. 24 ACA kunne være en mere hensigtsmæssig løsning end enkelt CENP-B som en position kontrol samt en reference signal, hvis ACA signaler påvirkes ikke af udtømning og / eller dysfunktion af målproteinet, men co-lokalisering af målproteinet med CENP-B er dårlig som nævnt ovenfor.

Bodor et al. rapporterede, at centromere CENP-A-niveauer reguleres af masseaktioner, dvs. mængden af centromere CENP-A varierer direkte i forhold til det cellulære indhold. 56 De viste også, at forbigående induktion af CENP-A ekspression fører til en hurtig stigning i centromerregionen CENP-A-niveau. Omvendt vi observerede en stor cellepopulation med centromer-lokaliseret, Flag-tagget CENP-A WT efter cotransfektion af pTRM4 ekspressionsvektoren med CA-UTR siRNA'er (en blanding af 5 'og 3' UTR siRNA; Tabel 1) (data ikke vist); denne population var større end den, der ses efter transfektion med kun pTRM4 ekspressionsvektor. Niveauet af exogent Flag-tagget CENP-A protein, hvis ekspression blev drevet af pTRM4, var ca. 1,0 til 1,4 størrelsesordener (10- til 25-fold) højere end for endogent CENP-A (data ikke vist). Det er spekuleret at ekspressionen af ​​eksogen CENP-A WT over en bestemt tærskel vil kunne mindske sin rette centromerregionen lokalisering.

I de foreliggende protokoller, fiksering er et kritisk trin at opretholde cellulær struktur og miljøet som proksimale situationen som muligt til den native tilstand. Når cellerne er faste, skal man fortsætte med farvningsprotokollen at undgå tab af proteinet af intehvile eller resten af ​​cellen. Imidlertid fiksering ødelægger antigene steder lejlighedsvis, og forskellige antistof-antigen-kombinationer arbejder dårligt med en fiksativ, men meget godt med en anden. 21 På grund af denne variation, valget af fiksativ høj grad afhænger af protein (er) af interesse. Den tidslængde fiksering kan have stor indflydelse på påvisning af protein (er) ved immunfarvning, og kortere fiksering er generelt bedre til at fastholde antigenicitet. 57 Derfor, når fastlæggelsen farvningsprocedurer for et nyt mål for andre centromerfusioner-kinetochore proteiner, især for usikker lokalisering, eller når man arbejder med en ny antistof, bør man afprøve flere metoder til fiksering og buffere for at finde den optimale tilstand. I de foreliggende protokoller blev der udvalgt to klasser af populære fikseringsmidler: aldehyd fikseringsmidler (protokol 2) og organiske opløsningsmidler (protokoller 3 og 4). Renheden af ​​fikseringsmidler er også ekstremt vigtigt. I protokol 4, er 4% gedeserum brugt especially at blokere IgG receptorer på celleoverfladen for at reducere ikke-specifik baggrund. 57 Generelt serum til blokering IgG receptorer skal være fra en art ikke er relateret til det primære antistof og fortrinsvis fra den samme art som det sekundære antistof. 57

I hver af de foreliggende protokoller, valget af primære antistof er den mest kritiske skridt til at opnå vellykket immunfarvning. Antistoffet med den største specificitet, renhed, affinitet og aviditet er ønsket. Et godt udgangspunkt koncentration for monoklonale antistoffer er sædvanligvis 1-5 ug / ml. Typiske fortyndinger af stamopløsningen polyklonale antistoffer varierer fra 1:20 til 1:. 500 57 Man skal empirisk at bestemme den passende koncentration af det primære antistof og fortyndingsmidlet for hver prøve. Prøverne skal forsigtigt rystet, men ikke tørret under inkubation for homogen farvning. Omfattende vask mellem inkubation af primært antistof og sekundært enntibody kan være nødvendigt for at undgå krydsreaktion med immunoglobuliner fra andre arter. Dog skal den optimale vask betingelse bestemmes empirisk for at undgå tab af celler, især mitotiske celler, som afrunder og løsrive når den rystes (dvs. mitotisk shake-off). 58 For succes, skal et sekundært antistof vælges til at binde til det primære antistof med høj affinitet. For eksempel for at undgå ikke-specifik binding af Fc-delen af det sekundære antistof til IgG Fc-receptorer, Fb (ab ') 2-fragmenter kan anvendes i stedet for hele antistof. 57 For mange sekundære antistoffer, kan inkubationstiden minimeres til 30 min ved stuetemperatur for at reducere ikke-specifik baggrund.

Foruden protokol 5, kan laser-scanning konfokal mikroskopi være fordelagtigt at opdage og analysere lokalisering og funktion centromerfusioner-kinetochore proteiner med de fluorescerende egenskaber. Som det fremgår af listen over stoffer / Equipment, Alexa Fluor 488 og Alexa Fluor 594 er formentlig den mest anvendte fluorescerende farvestoffer i de nuværende protokoller. For at detektere to og / eller flere forskellige centromerfusioner-kinetochore proteiner i prøven, må man sikre, at antistofferne anvendes til påvisning ét protein ikke hindrer påvisning af det andet protein. 57 I de foreliggende protokoller, er to primære antistoffer blandes og anvendes på samme tid. Imidlertid bør man optimere Immunofarvningen betingelser for hvert protein separat inden anvendelsen af ​​de primære eller sekundære antistoffer sammen: hvis de to proteiner er i tæt nærhed som i tilfældet med to centromer-kinetochore komponenter, kan én primær antistof strukturelt forhindre bindingen af andet primære antistof. En anden bekymring for afsløring multiple signal er problemet med spektral overlapning: vanskeligheden ved forebyggelse signal fra et farvestof "lækker" i den spektrale kanal af en anden. Dette problem bliver vanskeligere for konventionenal interferensfilter indstiller at løse som antallet af farvestoffer øges, eller hvis prøven indeholder overenhanced signaler (f.eks ACA eller anti-Flag-signaler i den foreliggende undersøgelse), herunder indblanding af autofluorescens. Fejlfinding af autofluorescens er blevet gennemført i andre undersøgelser. 57,59,60 I den foreliggende undersøgelse, optimering af fluorescerende filtersæt med single-label kontrol i hver kanal er tilstrækkelig i de fleste tilfælde for at undgå disse problemer (se nedenfor).

I hver af de foreliggende protokoller, ordentlig kontrol er afgørende. Hver ny primært antistof bør karakteriseres før immunfarvning begynder. Specificiteten af ​​antistoffet bør bekræftes ved Western blot-analyse, hvis det er relevant. Desuden bør der opnås bekræftelse af, at farvningen ikke skyldes uspecifik binding til celleoverfladen, og den optimale arbejdsforhold koncentration af et bestemt primært antistof bør bestemmes ved anvendelse af seriefortyndinger(Dvs. der bør udvikles en bindende kurve). En negativ kontrol (dvs. fravær af det primære antistof fra farvningen processen) bør medtages. En anden mulighed for negativ kontrol er udskiftningen af ​​normale IgG fra den samme art for det primære antistof. Til påvisning af flere etiketter, må man forberede kontroller uden sekundære antistoffer (baggrunden kontrol) samt single-label kontrol for at undgå spektral overlapning artefakter (dvs. bløder-through, crossover, crosstalk, eller farvestof "utæt", som beskrevet ovenfor ). Man kan kvantificere den del af "utætte" ved at sammenligne signaler gennem de "forkerte" filtre med det korrekte signal, ved hjælp af disse forhold for at fjerne beregningsmæssigt alle "lækker", og beregne den reelle fordeling og / eller co-lokalisering af fluorescerende markør. 60 bør undersøges Styringen baggrund selvstændigt med hver kanal for at indstille grænserne for signal gain og offset til at være adapted ved den endelige billeddannelse. Alle kanaler der vil blive anvendt til at opnå et billede af en multipel-label prøve skal underkastes uafhængig baggrund korrektion, fordi niveauet af autofluorescens i hver kanal varierer væsentligt. De "utætte" kontroller, som beskrevet ovenfor er forpligtet til at bestemme mængden af signal forstærkning muligt i hver kanal uden at afsløre "lække" ind i tilstødende kanaler. 60

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne erklærer, at de ikke har nogen konkurrerende finansielle interesser.

Acknowledgments

Dette arbejde blev støttet af NIH tilskud GM68418.

Materials

Name Company Catalog Number Comments
Lipofectamin 2000 Life Technologies/Invitrogen 11668 transfection reagent I
Lipofectamin RNAiMAX Life Technologies/Invitrogen 13778 transfection reagent II
Opti-MEM I Life Technologies/Invitrogen 31985 Reduced serum media, warm in 37 °C water bath before use
High-glucose DMEM (Dulbecco’s modified Eagle’s medium) Life Technologies/BioWhittaker 12-604 high-glucose DMEM, warm in 37 °C water bath before use
Fetal Bovine Serum, certified, heat inactivated, US origin Life Technologies/Gibco 10082 FBS (fetal bovine serum)
Poly-L-Lysine SOLUTION SIGMA-SLDRICH P 8920 Poly-L-Lysine, 0.1% w/v, in water
UltraPure Distilled Water Life Technologies/Invitrogen/Gibco 10977 Sterile tissue culture grade water 
Micro Cover glass (22 mm x 22 mm)  Surgipath 105 Cover glass (22 mm x 22 mm) 
6 Well Cell Culture Cluster Fisher/Corning Incorporated 07-200-83 6-well polystyrene plate 
Penicillin, Streptomycin; Liquid Fisher/Gibco 15-140 Penicillin-streptomycin
PAP PEN  Binding Site AD100.1 Hydrophobic barrier pen (for a water repellant barrier in immunofluorescent staining)
Paclitaxel (Taxol) SIGMA-SLDRICH T7402 Taxol for mitotic cell analysis
TN-16, microtubule inhibitor (TN16) Enzo Life Sciences BML-T120 TN16 for mitotic cell analysis
BSA (bovine serum albumin) SIGMA-SLDRICH A7906 Blocking reagent
Triton X-100 SIGMA-SLDRICH T8787 Detergent for permeabilization
Paraformaldehyde SIGMA-SLDRICH P6148 Fixation reagant
DAPI SIGMA-SLDRICH D9542 For nuclear staining
p-phenylenediamine SIGMA-SLDRICH P6001 For mounting medium
VWR Micro Slides, Frosted VWR International 48312-013 Micro slides 
Anti-CENP-A antibody Stressgen/Enzo Life Sciences KAM-CC006 Mouse monoclonal antibody; dilution ratio of 1:100 (IIF), 1:5000 (WB)
Anti-CENP-B antibody Novus Biologicals H00001059-B01P Mouse monoclonal antibody; dilution ratio of 1:200 (IIF, methanol/acetone fixation)-1:400 (IIF, paraformaldehyde fixation)
Anti-CENP-B antibody  abcam ab25734 Rabbit polyclonal antibody; dilution ratio of 1:200 (IIF, methanol/acetone fixation)-1:400 (IIF, paraformaldehyde fixation)
Anti-centromere antibody (ACA) Fitzgerald Industries International, Inc. 90C-CS1058 Human centromere antiserum; dilution ratio of 1:2000 (IIF)
Anti-CENP-H antibody Bethyl Laboratories BL1112 (A400-007A) Rabbit polyclonal antibody; dilution ratio of 1:200 (IIF)
Anti-CENP-H antibody BD 612142 Mouse monoclonal antibody; dilution ratio of 1:200 (IIF)
Anti-CENP-I antibody N/A, Dr. Katusmi Kitagawa N/A, Dr. Katusmi Kitagawa Rabbit polyclonal antibody; dilution ratio of 1:1000 (IIF); Niikura et al., Oncogene, 4133-4146 (2006)
Anti-KNL1 antibody Novus Biologicals NBP1-89223 Rabbit polyclonal antibody; dilution ratio of 1:100 (IIF)
Anti-Hec1 antibody Novus Biologicals / GeneTex NB 100-338 / GTX70268 Mouse monoclonal antibody; dilution ratio of 1:100 (IIF)
Anti-Hec1 antibody GeneTex GTX110735 Rabbit polyclonal antibody; dilution ratio of 1:100 (IIF)
Anti-Ska1 antibody abcam ab46826 Rabbit polyclonal antibody; dilution ratio of 1:100 (IIF)
Anti-Flag antibody SIGMA-ALDRICH F3165 Mouse monoclonal antibody; dilution ratio of 1:1000 (IIF), 1:5000 (WB)
Anti-Flag antibody SIGMA-ALDRICH F7425 Rabbit polyclonal antibody; dilution ratio of 1:1000 (IIF), 1:5000 (WB)
Anti-CUL4A antibody N/A, Dr. Pradip Raychaudhuri N/A, Dr. Pradip Raychaudhuri Rabbit polyclonal antibody; dilution ratio of 1:3000 (WB); Shiyanov et al., The Journal of biological chemistry, 35309-35312 (1999)
Anti-RBX1 antibody Cell Signaling 4397 Rabbit polyclonal antibody; dilution ratio of 1:2000 (WB)
Anti-GAPDH antibody Chemicon MAB374 Mouse monoclonal antibody; dilution ratio of 1:5000 (WB)
Alexa Fluor 488 Goat Anti-Mouse IgG Life Technologies/Invitrogen A11001 fluorophore-conjugated secondary antibody (Affinity-purified secondary antibody)
Alexa Fluor 594 Goat Anti-Mouse IgG Life Technologies/Invitrogen A11005 fluorophore-conjugated secondary antibody (Affinity-purified secondary antibody)
Alexa Fluor 488 Goat Anti-Rabbit IgG Life Technologies/Invitrogen A11008 fluorophore-conjugated secondary antibody (Affinity-purified secondary antibody)
Alexa Fluor 594 Goat Anti-Rabbit IgG Life Technologies/Invitrogen A11012 fluorophore-conjugated secondary antibody (Affinity-purified secondary antibody)
Non fat powdered milk (approved substitution for carnation powdered milk) Fisher Scientific NC9255871 (Reorder No. 190915; Lot# 90629) Skim milk
Leica DM IRE2 motorized fluorescence microscope  Leica motorized fluorescence microscope 
HCX PL APO 63x oil immersion lens Leica LEICA HCX PL APO NA 1.40 OIL PH 3 CS 63X oil immersion lens
HCX PL APO 100x oil immersion lens Leica LEICA HCX PL APO NA 1.40 OIL PHE 100X oil immersion lens
Leica EL6000 compact light source Leica External compact light source for fluorescent excitation
ORCA-R2 Digital CCD camera  Hamamatsu C10600-10B digital CCD camera 
Openlab version 5.5.2 Scientific Imaging Software  Perkin Elmer/Improvision For image observation, acquisition, quantification, and analysis
Velocity version 6.1.1 3D Image Analysis Software  Perkin Elmer/Improvision For image observation, acquisition, quantification, and analysis
Complete EDTA-free protease inhibitor cocktail Roche 11873580001/11836170001 Protease inhibitor cocktail tablets
PlusOne 2-D Quant Kit Amersham Biosciences 80-6483-56 Commercial protein assay reagent I for measurement of protein concentration (compatible with 2% SDS)
Bio-Rad Protein Assay Bio-Rad 500-0006 Commercial protein assay reagent II for measurement of protein concentration (compatible with 0.1% SDS)
Immobilon-FL EMD Millipore IPFL00010 PVDF membrane for transferring
IRDye 800CW Goat Anti-Mouse IgG LI-COR Biosciences 926-32210 IR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:20000 (IIF)
IRDye 680 Goat Anti-Rabbit IgG LI-COR Biosciences 926-32221 IR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:20000 (IIF)
Goat anti-Mouse IgG DyLight 549 Fisher Scientific PI35507 DyLight-conjugated secondary antibodyIR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:20000 (IIF)
Goat anti-Rabbit DyLight 649 Fisher Scientific PI35565 DyLight-conjugated secondary antibodyIR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:20000 (IIF)
Goat anti-mouse IgG-HRP Santa Cruz SC-2005 HRP-conjugated secondary antibodyDyLight-conjugated secondary antibodyIR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:10000 (IIF)
Goat anti-rabbit IgG-HRP Santa Cruz SC-2004 HRP-conjugated secondary antibodyDyLight-conjugated secondary antibodyIR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:10000 (IIF)
Openlab version 5.5.2. Scientific Imaging Software  Improvision/PerkinElmer Software A
Volocity version 6.3 3D Image Analysis Software (Volocity Acquisition) PerkinElmer Software B1
Volocity version 6.3 3D Image Analysis Software (Volocity Quantification) PerkinElmer Software B2
Branson SONIFIER 450 Sonicator
Branson Ultrasonics sonicator Microtip Step, Solid, Threaded 9.5 mm VWR Scientific Products Inc.  33995-325 Disruptor horn for sonication
Branson Ultrasonics sonicator Microtip Tapered 6.5 mm VWR Scientific Products Inc.  33996-185 Microtip for sonication
Odyssey CLx Infrared imaging System  LI-COR Biosciences Infrared imaging system for immunoblot detection
Image Studio Analysis Software Ver 4.0  LI-COR Biosciences Software C
Molecular Imager Versadoc MP4000 System  Bio-Rad Chemiluminescence imager for immunoblot detection
Quantity One 1-D analysis software  Bio-Rad Software D
SuperSignal West Femto Maximum Sensitivity Substrate Thermo 34095 Ultra-sensitive enhanced chemiluminescent (ECL) substrate

DOWNLOAD MATERIALS LIST

References

  1. DeLuca, J. G., et al. Hec1 and nuf2 are core components of the kinetochore outer plate essential for organizing microtubule attachment sites. Molecular biology of the cell. 16, 519-531 (2005).
  2. Earnshaw, W. C., Halligan, N., Cooke, C., Rothfield, N. The kinetochore is part of the metaphase chromosome scaffold. J Cell Biol. 98, 352-357 (1984).
  3. Hoffman, D. B., Pearson, C. G., Yen, T. J., Howell, B. J., Salmon, E. D. Microtubule-dependent changes in assembly of microtubule motor proteins and mitotic spindle checkpoint proteins at PtK1 kinetochores. Molecular biology of the cell. 12, 1995-2009 (2001).
  4. Regnier, V., et al. CENP-A is required for accurate chromosome segregation and sustained kinetochore association of BubR1. Mol Cell Biol. 25, 3967-3981 (2005).
  5. Bernad, R., Sanchez, P., Losada, A. Epigenetic specification of centromeres by CENP-A. Exp Cell Res. 315, 3233-3241 (2009).
  6. Black, B. E., Cleveland, D. W. Epigenetic centromere propagation and the nature of CENP-a nucleosomes. Cell. 144, 471-479 (2011).
  7. Warburton, P. E., et al. Immunolocalization of CENP-A suggests a distinct nucleosome structure at the inner kinetochore plate of active centromeres. Curr Biol. 7, 901-904 (1997).
  8. Karpen, G. H., Allshire, R. C. The case for epigenetic effects on centromere identity and function. Trends Genet. 13, 489-496 (1997).
  9. Black, B. E., et al. Structural determinants for generating centromeric chromatin. Nature. 430, 578-582 (2004).
  10. Black, B. E., et al. Centromere identity maintained by nucleosomes assembled with histone H3 containing the CENP-A targeting domain. Mol Cell. 25, 309-322 (2007).
  11. Fachinetti, D., et al. A two-step mechanism for epigenetic specification of centromere identity and function. Nat Cell Biol. 15, 1056-1066 (2013).
  12. Zeitlin, S. G., Shelby, R. D., Sullivan, K. F. CENP-A is phosphorylated by Aurora B kinase and plays an unexpected role in completion of cytokinesis. The Journal of cell biology. 155, 1147-1157 (2001).
  13. Zhang, X., Li, X., Marshall, J. B., Zhong, C. X., Dawe, R. K. Phosphoserines on maize CENTROMERIC HISTONE H3 and histone H3 demarcate the centromere and pericentromere during chromosome segregation. The Plant cell. 17, 572-583 (2005).
  14. Goutte-Gattat, D., et al. Phosphorylation of the CENP-A amino-terminus in mitotic centromeric chromatin is required for kinetochore function. Proc Natl Acad Sci U S A. 110, 8579-8584 (2013).
  15. Bailey, A. O., et al. Posttranslational modification of CENP-A influences the conformation of centromeric chromatin. Proc Natl Acad Sci U S A. 110, 11827-11832 (2013).
  16. Samel, A., Cuomo, A., Bonaldi, T., Ehrenhofer-Murray, A. E. Methylation of CenH3 arginine 37 regulates kinetochore integrity and chromosome segregation. Proc Natl Acad Sci U S A. 109, 9029-9034 (2012).
  17. Niikura, Y., et al. CENP-A K124 Ubiquitylation Is Required for CENP-A Deposition at the Centromere. Dev Cell. (2015).
  18. Chan, G. K., Liu, S. T., Yen, T. J. Kinetochore structure and function. Trends in cell biology. 15, 589-598 (2005).
  19. Hori, T., Okada, M., Maenaka, K., Fukagawa, T. CENP-O class proteins form a stable complex and are required for proper kinetochore function. Molecular biology of the cell. 19, 843-854 (2008).
  20. Fukagawa, T., Earnshaw, W. C. The centromere: chromatin foundation for the kinetochore machinery. Developmental cell. 30, 496-508 (2014).
  21. Kedersha, N. The Proteintech Blog.Proteintech. Grainger, D. Proteintech Group. (2012).
  22. Clontech Laboratories, Inc. HeLa Tet-Off Advanced Cell Line. Available from: http://www.clontech.com/CR/Products/Inducible_Systems/Tetracycline-Inducible_Expression/ibcGetAttachment.jsp?cItemId=26908&fileId=6712191&sitex=10020:22372:US (2012).
  23. Meraldi, P., Sorger, P. K. A dual role for Bub1 in the spindle checkpoint and chromosome congression. EMBO J. 24, 1621-1633 (2005).
  24. Niikura, Y., et al. 17-AAG, an Hsp90 inhibitor, causes kinetochore defects: a novel mechanism by which 17-AAG inhibits cell proliferation. Oncogene. 25, 4133-4146 (2006).
  25. Yang, Z., et al. Silencing mitosin induces misaligned chromosomes, premature chromosome decondensation before anaphase onset, and mitotic cell death. Mol Cell Biol. 25, 4062-4074 (2005).
  26. Wang, H., et al. Histone H3 and H4 ubiquitylation by the CUL4-DDB-ROC1 ubiquitin ligase facilitates cellular response to DNA damage. Mol Cell. 22, 383-394 (2006).
  27. Lamb, J. R., Tugendreich, S., Hieter, P. Tetratrico peptide repeat interactions: to TPR or not to TPR? Trends Biochem Sci. 20, 257-259 (1995).
  28. Kitagawa, K., Skowyra, D., Elledge, S. J., Harper, J. W., Hieter, P. SGT1 encodes an essential component of the yeast kinetochore assembly pathway and a novel subunit of the SCF ubiquitin ligase complex. Mol Cell. 4, 21-33 (1999).
  29. Niikura, Y., Dixit, A., Scott, R., Perkins, G., Kitagawa, K. BUB1 mediation of caspase-independent mitotic death determines cell fate. J Cell Biol. 178, 283-296 (2007).
  30. Niikura, Y., Kitagawa, K. Identification of a novel splice variant: human SGT1B (SUGT1B). DNA Seq. 14, 436-441 (2003).
  31. Niikura, Y., Ogi, H., Kikuchi, K., Kitagawa, K. BUB3 that dissociates from BUB1 activates caspase-independent mitotic death (CIMD). Cell Death Differ. 17, 1011-1024 (2010).
  32. Ando, S., Yang, H., Nozaki, N., Okazaki, T., Yoda, K. CENP-A, -B, and -C chromatin complex that contains the I-type alpha-satellite array constitutes the prekinetochore in HeLa cells. Mol Cell Biol. 22, 2229-2241 (2002).
  33. Izuta, H., et al. Comprehensive analysis of the ICEN (Interphase Centromere Complex) components enriched in the CENP-A chromatin of human cells. Genes to cells : devoted to molecular & cellular mechanisms. 11, 673-684 (2006).
  34. Obuse, C., et al. Proteomics analysis of the centromere complex from HeLa interphase cells: UV-damaged DNA binding protein 1 (DDB-1) is a component of the CEN-complex, while BMI-1 is transiently co-localized with the centromeric region in interphase. Genes Cells. 9, 105-120 (2004).
  35. Merlet, J., Burger, J., Gomes, J. E., Pintard, L. Regulation of cullin-RING E3 ubiquitin-ligases by neddylation and dimerization. Cell Mol Life Sci. 66, 1924-1938 (2009).
  36. Bennett, E. J., Rush, J., Gygi, S. P., Harper, J. W. Dynamics of cullin-RING ubiquitin ligase network revealed by systematic quantitative proteomics. Cell. 143, 951-965 (2010).
  37. Antonelli, A., et al. Efficient inhibition of macrophage TNF-alpha production upon targeted delivery of K48R ubiquitin. Br J Haematol. 104, 475-481 (1999).
  38. Codomo, C. A., Furuyama, T., Henikoff, S. CENP-A octamers do not confer a reduction in nucleosome height by AFM. Nat Struct Mol Biol. 21, 4-5 (2014).
  39. Thrower, J. S., Hoffman, L., Rechsteiner, M., Pickart, C. M. Recognition of the polyubiquitin proteolytic signal. The EMBO journal. 19, 94-102 (2000).
  40. Yoda, K., et al. Human centromere protein A (CENP-A) can replace histone H3 in nucleosome reconstitution in vitro. Proc Natl Acad Sci U S A. 97, 7266-7271 (2000).
  41. Shelby, R. D., Vafa, O., Sullivan, K. F. Assembly of CENP-A into centromeric chromatin requires a cooperative array of nucleosomal DNA contact sites. J Cell Biol. 136, 501-513 (1997).
  42. Majumder, S., Fisk, H. A. Quantitative immunofluorescence assay to measure the variation in protein levels at centrosomes. J Vis Exp. (2014).
  43. Masumoto, H., Masukata, H., Muro, Y., Nozaki, N., Okazaki, T. A human centromere antigen (CENP-B) interacts with a short specific sequence in alphoid DNA, a human centromeric satellite. J Cell Biol. 109, 1963-1973 (1989).
  44. Yoda, K., Kitagawa, K., Masumoto, H., Muro, Y., Okazaki, T. A human centromere protein, CENP-B, has a DNA binding domain containing four potential alpha helices at the NH2 terminus, which is separable from dimerizing activity. J Cell Biol. 119, 1413-1427 (1992).
  45. Sugata, N., et al. Human CENP-H multimers colocalize with CENP-A and CENP-C at active centromere--kinetochore complexes. Hum Mol Genet. 9, 2919-2926 (2000).
  46. Earnshaw, W. C., Ratrie, H. 3rd, Stetten, G. Visualization of centromere proteins CENP-B and CENP-C on a stable dicentric chromosome in cytological spreads. Chromosoma. 98, 1-12 (1989).
  47. Goshima, G., Kiyomitsu, T., Yoda, K., Yanagida, M. Human centromere chromatin protein hMis12, essential for equal segregation, is independent of CENP-A loading pathway. J Cell Biol. 160, 25-39 (2003).
  48. Liu, S. T., Rattner, J. B., Jablonski, S. A., Yen, T. J. Mapping the assembly pathways that specify formation of the trilaminar kinetochore plates in human cells. J Cell Biol. 175, 41-53 (2006).
  49. Gascoigne, K. E., Cheeseman, I. M. T time for point centromeres. Nat Cell Biol. 14, 559-561 (2012).
  50. Gascoigne, K. E., et al. Induced ectopic kinetochore assembly bypasses the requirement for CENP-A nucleosomes. Cell. 145, 410-422 (2011).
  51. Nishino, T., et al. CENP-T provides a structural platform for outer kinetochore assembly. EMBO J. 32, 424-436 (2013).
  52. Malvezzi, F., et al. A structural basis for kinetochore recruitment of the Ndc80 complex via two distinct centromere receptors. EMBO J. 32, 409-423 (2013).
  53. Schleiffer, A., et al. CENP-T proteins are conserved centromere receptors of the Ndc80 complex. Nat Cell Biol. 14, 604-613 (2012).
  54. Rago, F., Gascoigne, K. E., Cheeseman, I. M. Distinct organization and regulation of the outer kinetochore KMN network downstream of CENP-C and CENP-T. Curr Biol. 25, 671-677 (2015).
  55. Nishino, T., et al. CENP-T-W-S-X forms a unique centromeric chromatin structure with a histone-like fold. Cell. 148, 487-501 (2012).
  56. Bodor, D. L., et al. The quantitative architecture of centromeric chromatin. Elife. 3, e02137 (2014).
  57. Oliver, C. Ch 58. Molecular Biomethods Handbook. Rapely, R., Walker, J. M. Humana Press. 1063-1079 (2008).
  58. Terasima, T., Tolmach, L. J. Changes in x-ray sensitivity of HeLa cells during the division cycle. Nature. 190, 1210-1211 (1961).
  59. Levenson, G. B. R. Ch 8. Biomedical Photonics Handbook. Vo-Dinh, T. uan CRC Press LLC. 8-19 (2003).
  60. Sanderson, J. Fluorescence bleed-though. Available from: http://www.gum2012.fionastoreydesign.co.uk/Downloads/Bleed through text.pdf (2011).
Immunofluorescens Analyse af endogene og eksogene Centromer-kinetochore Proteiner
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Niikura, Y., Kitagawa, K. Immunofluorescence Analysis of Endogenous and Exogenous Centromere-kinetochore Proteins. J. Vis. Exp. (109), e53732, doi:10.3791/53732 (2016).More

Niikura, Y., Kitagawa, K. Immunofluorescence Analysis of Endogenous and Exogenous Centromere-kinetochore Proteins. J. Vis. Exp. (109), e53732, doi:10.3791/53732 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter