Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

내생의 면역 형광 분석 및 외인성 센트로 - 동원체 단백질

Published: March 3, 2016 doi: 10.3791/53732

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

"중심절은"고전적인 유전학 억제 감수 재조합의 영역으로 정의하고 나중에 유사 분열시 정확한 염색체 분리에 필수적인 역할을한다 유사 분열 염색체의 주요 수축으로 인식되었다. "Kinetochores"은 전자 현미경에 의해 계시 된, 중심절의 표면에 미세 소관 결합 다층 구조로서 기술 하였다; "kinetochores은"나중에 유사 분열 염색체의 동원체에 지역화 거대 분자 복합체로 정의 하였다. 척추 사이 센트로 DNA 서열의 극적인 차이에도 불구하고, 구조 및 동원체 조성물은 고도로 보존된다. 스핀들 미세 소관과 동원체 사이의 역동적 인 상호 작용은 유사 분열시 염색체의 충실한 분리에 필요한 및 센트로 - 동원체 기능 리드의 결함 이수성하여 암이다.

대부분의 진핵 생물의 센트로어떠한 정의 된 DNA 서열이 없지만 171 bp의 α 위성 DNA로 이루어진 반복 alphoid DNA의 큰 배열 (0.3-5 MB)로 구성된다. 효모 신진 제외 센트로 ID가없는 DNA 서열이 아니라 히스톤 H3 변이체 CenH3 포함 특수 뉴 클레오 좀의 존재에 의해 달성된다 (센트로 단백질을 [CENP-A] 인간). 5 CENP-A의 뉴 클레오는에 지역화 171-bp의 α-위성 DNA에 포유류 kinetochores 7 바인드의 내부 플레이트. 활성 중심절이 필요 CENP-A 함유 함께 스핀들 체크 포인트를 통해 유사 분열 스핀들 및 후속주기 진행에 염색체의 부착을 조절하는 구성 적 센트로 관련 네트워크 (CCAN)과 동원체 단백질의 모집을 지시하는 뉴 클레오합니다.

상기 증거 비추어 CENP-A는 센트로 8 후성 마크 것으로 제안되었다; 그러나, 처리되는 CENP-A는 I을 인용NTO 센트로이 DNA 결합을 담당하는 요소가 아직 특징 화되지 않았다. 짧은 센트로 타겟팅 도메인 (CATD)는 CENP-A의 영역을 배 히스톤에 상주하고 CATD와 H3의 해당 영역의 교체가 센트로에 직접 H3에 충분하다. 9 몇몇 연구는 번역 후를위한 기능적 역할을 제안 수정 CENP-A 12-16의 (PTM) 그러나, 중심절에 모집에서 CENP-A의 이러한 PTMS의 분자 메커니즘은 아직 밝혀지지 않았다. 우리는 이전에 CUL4A-RBX1 - COPS8 E3 리가 활동이 동원체에 CENP-A의 CENP-A K124의 ubiquitylation 및 지역화를 위해 필요하다고보고했다. (17)

동원체 단백질의 발견 및 특성화 염색체 분리에 관한 새로운 통찰력을 주도하고있다. 18 개의 100보다 동원체 성분을 다양한 방법으로 척추 동물 세포에서 확인되었다. (19, 20) 아래형광 현미경에 kinetochores는 조립과 기능 또한 세포 내의 각 센트로 - 동원체 단백질과 단백질 - 단백질 네트워크의 세포 기능의 특성에서 오는 방법의 서. (19) 직접 시각화 및 고급 이미징 방법은 센트로 - 동원체 구성 요소의 놀라운 해상도를 제공 할 수 중심절과 kinetochores의 특정 분자 구성 요소의 직접 관찰. 또한, 특이 적 항체를 이용하여 간접 면역 형광 방법 (IIF) 염색이 관찰에 중요하다. 그러나, 특정 센트로 - 동원체 단백질의 세부 문제를 논의 IIF 프로토콜, 몇 가지에 대한 수많은 보고서에도 불구하고. 1-4 따라서, 개발하고 특히 각 센트로 - 동원체 단백질을 분석하는 IIF 염색 및 정량 IIF 분석의 방법을보고하는 것은 매우 중요합니다. IIF 염색에서, 하나의 관심 단백질의 손실을 방지하기 위해 염색 프로토콜을 진행해야하거나셀의 나머지. 그러나 고정 가끔 항원 사이트를 파괴하고, 다른 항체 - 항원 조합은 하나의 정착과 함께 제대로 작동하지만 아주 잘 다른, 21, 정착액의 선택에 크게 관심의 단백질 (들)에 따라 달라집니다. 따라서, 다른 정착 방법은 센트로 - 동원체 단백질의 IIF 염색에서 중요하다.

간접 면역 형광 (IIF) 염색 및 CENP-A와 국기 태그가 외생 CENP-A 단백질, 인간 세포에서이 단백질의 정량을 포함하여 내인성 센트로 - 동원체 단백질의 현지화를 해결하기 위해 분석의 여기에 최적화 된 방법이 개발되었다. 이러한 방법은 다른 종 센트로-동원체 단백질의 분석에 적용될 수있다.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. 세포 배양 및 형질

  1. 6 웰 폴리스티렌 플레이트 커버 유리 (22mm X 22mm)를 넣습니다. 선택적으로 코트 아래 단계에 따라 커버 유리에 유사 분열 세포를 유지하기 위해 (자재 / 장비의 목록 참조) 물에 폴리 - L - 라이신과 커버 유리, V / w 0.1 %, :
    주 : 최적의 조건은 각각의 세포주 및 애플리케이션에 대해 결정되어야한다.
    1. 물에 폴리 - L - 라이신, V / w 0.1 %와 무균 코트 문화 표면 (0.4 ㎖ / 웰의 6 자 폴리스티렌 판). 문화 표면에도 코팅을 보장하기 위해 부드럽게 바위.
    2. 5 분 후, 흡인에 의해 용액을 제거하고 철저하게 무균 조직 배양 등급 물로 표면을 씻어.
    3. 세포와 매체를 도입하기 전에 건조 적어도 2 시간.
  2. 씨 헬라 세포 (17) 또는 6 자 폴리스티렌 판에 넣어 커버 유리 (22mm X 22mm)에 17, 22 헬라 테트 오프 세포. 해당 셀 밀도가 아니라 당 5.4 × 10 5 확인하십시오. 문화 세포10 % FBS, 1 % 페니실린 - 스트렙토 마이신과 하이 글루코스 DMEM이다.
    주 : 최적의 결과를 실험적 시드에 사용할 셀 밀도를 결정한다.
  3. 18 시간 동안 5 % CO 2 분위기하에 37 ℃에서 세포를 인큐베이션.
    주 : 헬라 테트 - 오프 셀의 경우, 외래 유전자의 전사를 유도 (즉, 테트라 사이클린 / 독시사이클린) 테트라 사이클린 / 독시사이클린 않고 따라서 배양 세포의 부재하에 활성 및 pTRM4 과발현 벡터 (표 2 일시적 형질 ), 그 전사 TRE 프로모터에 의해 조절된다 (아래 참조).
  4. 시드, 트랜 세포 후 여덟 시간은 다음과 같습니다 :
    1. (20 μM 어닐링 주식을 표 1) 1.5 μL의 siRNA를 올리고 혼합하여 용액 A를 확인 및 / 또는 2.0 μg의 플라스미드 (표 2) 50 μl를 감소 혈청 배지 (자재 / 장비의 목록 참조), 5 분 동안 실온에서 품어 .
      참고 :이 분석에서,CA-UTR 된 siRNA (5 혼합물 '및 3'UTR의 siRNA; 표 1)의 공동 형질 감염 프로토콜 (3, 4) (논의 참조)에 사용 하였다.
    2. 내가 혈청 배지를 감소 50 μL에 (재료 / 장비의 목록 참조), 5 분 동안 실온에서 품어 0.75 ㎕를 형질 전환 시약을 혼합하여 용액 B를 확인합니다.
      참고 : 선택적 단계가 형질 전환 시약 II μL 1.0의 추가이다 (자재 / 장비의 목록 참조).
    3. 함께 솔루션 A와 B를 혼합하고 15 분 동안 실온에서 품어.
    4. PBS로 한번 배양 된 세포를 세척 한 후 6 웰 폴리스티렌 플레이트의 각 웰에 혈청 배지를 감소 500 μl를 추가합니다. 직접 아니라 개인의 각 솔루션 및 B (즉, RNA 및 / 또는 DNA 지질 복합체)의 혼합물을 추가합니다.
      주 : 최종 농도 3.3 ㎍ / ㎖ (플라스미드)이고; 50 nM의 (siRNA를).
    5. 4.5 시간 동안 5 % CO 2 분위기하에 37 ℃에서 세포를 인큐베이션. 높은 혈당 DMEM 재치에 매체를 변경H, 10 % FBS, 1 % 페니실린 - 스트렙토 마이신.
    6. 형질 감염 후 48 내지 72 시간 동안 5 % CO 2 분위기하에 37 ℃에서 세포를 인큐베이션.
      주 : 최적의 결과를 위해, 고정 전에 세포 성장에 대한 잠복기가 경험적으로 결정되어야하고, 단백질 결핍 및 / 또는 발현을 웨스턴 블롯 분석으로 확인되어야한다 (프로토콜 6 참조).
    7. 유사 분열 세포 분석이 관심을 경우, 고정하기 전에 배양 세포에 24 시간을 파클리탁셀 (10 nM의)를 추가하거나 고정하기 전에 배양 된 세포 2.5 시간에 TN16 (0.5 μM)를 추가합니다.

2. 세포 고정과 면역 형광 염색법이 내생 센트로 - 동원체 단백질을 감지하는 (파라 포름 알데히드 고정)

  1. 정착액, 버퍼 및 시약의 제조.
    1. 갓 PBS, pH 7.4의 4 % 파라 포름 알데히드 용액 50 ㎖를 준비한다.
      1. 환기 후드에 저어 접시에 유리 비커에 1 × PBS의 40 ML을 추가합니다. 열 동안 stirrin약 60 ° C에 g. 가열 된 PBS에 파라 포름 알데히드 분말 2g을 추가합니다.
      2. 분말 즉시 용해되지 않기 때문에, 총 1 N의 NaOH 1 ㎖을 첨가하여 pH를 서서히 올린다.
        주 : 수산화 나트륨 용액의 첨가 후 클리어한다.
      3. 파라 포름 알데히드는, 차가운 용해시키고, 용액을 필터링하면.
      4. pH 7.4의 1 N 염산으로 pH를 50 ml의 1 × PBS와 솔루션의 볼륨을 조정합니다.
        참고 : 용액의 분취 량은 냉동 또는 긴 1과 일주일 동안 2-8 ° C에 저장할 수 있습니다. 이 사용될 때까지 용액을 빙냉 4 ℃에서 보관해야한다.
    2. 10 mM 트리스 - 염산, pH가 7.5로 구성되어 버퍼 KB1, 50 ㎖를 준비; 150 mM의 NaCl을; 0.5 % BSA; 0.5 % 트리톤 X-100.
      참고 : BSA가 새로 추가해야합니다.
      참고 : 버퍼 KB 시리즈는 이전 보고서에 기술 된 버퍼 KB 기반으로 1,2,4.
    3. 10 mM 트리스 - 염산 완충액으로 구성 KB2, 50 ㎖를 준비pH가 7.5; 150 mM의 NaCl을; 및 0.5 % BSA.
      참고 : BSA가 새로 추가해야합니다.
    4. DAPI (50 NG / ㎖)를 포함하는 버퍼 KB3 1 ㎖를 준비합니다.
    5. 1 ㎎ / ㎖의 -p- 페닐 렌 디아민으로 구성되어 장착 배지 100㎖를 준비; PBS 10 %, 90 % 글리세롤.
      1. 1 N NaOH로 9.8 1 × PBS의 pH를 조정 용액에 -p- 페닐 렌 디아민을 용해하고 글리세롤을 추가합니다.
      2. 저장 -80 ° C에서 1 ml의 분취 량. 빛으로부터 보호합니다.
  2. 세포 고정 용 48 ~ 72 시간 포스트 형질 전환 (프로토콜 1 참조)에 흡인에 의해 배양 배지를 제거합니다. 한 번 PBS와 린스 세포. 세포의 표면을 방해하지 않도록 배양 웰의 측면에 PBS를 적용한다.
    주 : 셀 고정 용 최적 시점은 경험적으로 결정되어야한다.
  3. 4 ℃에서 30 분 동안 PBS 중의 4 % 파라 포름 알데히드에 세포를 고정한다. 충분히 잔류 4 % 파라 포름 알데히드를 제거하는 버퍼 KB2로 두 번 세포를 씻어.
  4. PermeabiRT에서 30 분 동안 버퍼 KB1에 샘플 발자. 버퍼 KB2 한 번 세포를 씻어하고, 비특이적 결합의 추가 블록 사이트로 실온에서 5 분 동안 버퍼 KB2를 추가합니다.
    참고 : 버퍼 KB1도 차단에 크게 기여하고있다.
  5. 집게를 사용하여 6 웰 폴리스티렌 플레이트에서 커버 유리 (22mm X 22mm)를 제거합니다. 소수성 장벽 펜을 사용하여 각 커버 유리 샘플 주위에 소수성 장벽을 형성하기 위해 옅은 녹색 사각형 또는 원을 그리, (재료 / 장비의 목록 참조). 만지거나하지 마십시오 소수성 장벽 펜으로 세포에 너무 가까이. 새로운 6 자 폴리스티렌 판의 커버 유리를 넣습니다.
  6. (; 또한 재료 / 장비 목록을 참조 200 : 100-1 1의 희석 비율) 및 항 CENP-B 항체 (1 희석 비율 : 400) 중 하나 또는 안티 차 센트로하는 항체 또는 동원체 단백질을 희석 센트로 항체 (ACA) (1 희석 비율 : 2,000) 버퍼 KB2의 센트로 위치 마커있다.
    참고 : 최적의 결과를 위해, 마지막 집중하고이 용액에 차 항체 능은 경험적으로 결정되어야한다.
  7. 세포 샘플을 몰입하기 위해 희석 차 항체의 충분한 볼륨 (약 30 μL)을 적용합니다. 37 ° C에서 1 시간 동안 세포 샘플을 인큐베이션. 세포를 버퍼 KB2로 3 회 씻어.
  8. 각 차 항체에 대해 유도 버퍼 KB2를 사용하여 형광 접합 이차 항체 (200 : 100 1~1의 희석 비)로 희석.
    주 : 최적의 결과를 위해,이 용액 이차 항체의 최종 농도는 실험적으로 결정되어야한다.
  9. 충분한 볼륨 세포 샘플을 몰입 할 수있는 희석 차 항체 (커버 유리에 30 μl를 한 방울)을 적용합니다. 37 ° C에서 1 시간 동안 세포 샘플을 인큐베이션. 30 분 (다섯 6 분 세척)의 기간 동안 세포를 버퍼 KB2 5 번 씻어.
    참고 : (세포의 손실을 최소화하기위한 즉,) 최적의 결과를 얻으려면, 최적의 세척 조건은 empirica를 결정해야한다에서야.
  10. 세포 샘플을 몰입하는 DAPI (50 NG / ㎖)를 포함하는 버퍼 KB3의 충분한 양을 적용합니다. RT에서 5 분 동안 세포 샘플을 인큐베이션. 세포를 버퍼 KB2 1-2 번 씻어.
  11. 마이크로 슬라이드에 세포 샘플이 들어있는 커버 유리를 탑재합니다.
    1. 마이크로 슬라이드의 중심 매체를 장착 한 방울을 놓는다.
    2. 세포 샘플로부터 액체를 제거하고, 손 또는 집게를 사용하여 마이크로 슬라이드의 중심에 시료를 위치. 공기 방울을 피하십시오.
    3. 종이 타월로 여분의 설치 매체를 제거합니다.

3. 셀 C 말단의 고정 및 면역 형광 염색법 국기-태그 CENP-A 단백질 (아세톤 고정)

  1. 예비
    1. 얼음처럼 차가운 75 % 아세톤을 준비합니다.
    2. 갓 0.5 % 탈지 우유와 0.5 % BSA가 포함 된 PBS (산도 7.4) 50 ㎖를 준비합니다.
    3. 갓 0.1 % 탈지 우유와 0.1 % BSA가 포함 된 PBS (산도 7.4) 50 ㎖를 준비합니다.
    4. (PBS 1 ml의 준비pH를 7.4) DAPI (50-100 NG / ㎖)을 함유.
    5. 2.1.5에 설명 된대로 설치 매체의 100 ㎖를 준비합니다.
  2. 세포 고정 용 48 ~ 72 시간 포스트 형질 전환 (프로토콜 1 참조)에 흡인에 의해 배양 배지를 제거합니다. 한 번 PBS와 린스 세포. 세포의 표면을 방해하지 않도록 배양 웰의 측면에 PBS를 적용한다.
    주 : 셀 고정 용 최적 시점은 경험적으로 결정되어야한다.
  3. 빙냉 75 % 아세톤 세포를 고정하고, -20 ° C에서 10 분 동안 세포를 배양한다. 실온에서 30 ~ 60 분 흄 후드에서 커버 유리에 건전지.
    주 : 최적의 결과를 위해, 고정 세포 건조에 필요한 시간은 경험적으로 결정되어야한다.
  4. 소수성 장벽 펜을 사용하여 각 커버 유리 샘플 주위에 소수성 장벽을 형성하기 위해 옅은 녹색 사각형 또는 원을 그리, (재료 / 장비의 목록 참조). 만지거나하지 마십시오 소수성 장벽 펜으로 세포에 너무 가까이.
  5. 블록 nonspecIFIC PBS는 실온에서 5 분 동안 0.5 % 탈지 우유, 0.5 % BSA를 함유하는 첨가하여 세포 결합 부위.
  6. (: 1000 희석 비율 1) 항 CENP-B 항체 (하나의 희석 비율 : 200) 있거나, ACA (1 : 2000 희석 비율 PBS 0.1 % 탈지 우유, 0.1 % BSA를 포함하여, 항 - 플래그 항체를 희석 ) 센트로 위치 마커있다.
    주 : 최적의 결과를 위해,이 용액에 차 항체의 최종 농도는 실험적으로 결정되어야한다.
  7. 세포 샘플을 몰입하기 위해 희석 차 항체의 충분한 볼륨 (약 30 μL)을 적용합니다. 37 ° C에서 1 시간 동안 세포 샘플을 인큐베이션. 30 분의 기간 동안 세포를 블로킹 완충액으로 5 회 헹군다.
    주 : 세포를 PBS로 세정 할 수있다. 최적의 결과 (즉, 세포의 손실을 방지하기 위해)을 위해 최적의 세정 조건은 경험적으로 결정되어야한다.
  8. 대항 형광 접합 이차 항체 (200 : 100 1~1의 희석 비)로 희석PBS 0.1 % 탈지 우유, 0.1 % BSA를 함유하는 각각의 차 항체.
    주 : 최적의 결과를 위해,이 용액 이차 항체의 최종 농도는 실험적으로 결정되어야한다.
  9. 세포 샘플을 몰입하기 위해 희석 차 항체의 충분한 볼륨 (약 30 μL)을 적용합니다. 37 ° C에서 1 시간 동안 세포 샘플을 인큐베이션. PBS는 0.1 % 탈지 우유와 0.1 % BSA를 함유하는 세포 2 번 씻어.
    혼자 PBS를 또한 세포를 세척하는 데 사용할 수 있습니다 있습니다.
  10. 세포 샘플을 몰입하는 DAPI (50 ~ 100 NG / ㎖)을 함유 PBS의 충분한 양을 적용합니다. RT에서 5 분 동안 세포 샘플을 인큐베이션. PBS로 세포에게 1-2 번 씻어.
  11. 2.11에 기재된 바와 같이 마이크로 슬라이드에 세포 샘플을 포함하는 커버 유리를 탑재.

4. 셀 N 말단의 고정 및 면역 형광 염색법 국기-태그 CENP-A 단백질 (메탄올 고정)

  1. 예비
    1. 얼음처럼 차가운 메탄올을 준비합니다.
    2. TBS 4 % 염소 혈청을 포함하는 (PH 7.4)을 준비합니다.
    3. TBS DAPI (50 ~ 100 NG / ㎖)를 함유 (PH 7.4) 1 ㎖를 준비합니다.
    4. 2.1.5에 설명 된대로 설치 매체의 100 ㎖를 준비합니다.
  2. 세포 고정 용 48 ~ 72 시간 포스트 형질 전환 (프로토콜 1 참조)에 흡인에 의해 배양 배지를 제거합니다. 한 번 TBS와 린스 세포. 세포의 표면을 방해하지 않도록 배양 웰 측으로 TBS 적용.
    주 : 셀 고정 용 최적 시점은 경험적으로 결정되어야한다.
  3. 빙냉 메탄올로 세포를 고정하고, -20 ℃에서 6 분 동안 세포를 배양한다. 충분히 잔류 메탄올을 제거하는 TBS로 두 번 세포를 씻어.
  4. 소수성 장벽 펜을 사용하여 각 커버 유리 샘플 주위에 소수성 장벽을 만들 옅은 녹색 사각형 또는 원을 그리, (재료 / 장비의 목록 참조). 만지거나하지 마십시오 소수성 장벽 펜으로 세포에 너무 가까이.
  5. CEL에 비특이적 결합 부위를 차단4 % 염소 혈청을 포함하는 추가 TBS에 의해 LS. 실온에서 10 분 동안 품어.
  6. (1,000 희석 1) 항 CENP-B 항체 (희석 비율 1 : 200) 중 하나를 4 % 염소 혈청을 함유하는 TBS의 동원체 위치 마커 등 (2000 희석 비율 1) 또는 ACA 방지 플래그 항체 희석 .
    주 : 최적의 결과를 위해,이 용액에 차 항체의 최종 농도는 실험적으로 결정되어야한다.
  7. 세포 샘플을 몰입하기 위해 희석 차 항체의 충분한 볼륨 (약 30 μL)을 적용합니다. 37 ° C에서 1 시간 동안 세포 샘플을 인큐베이션. 30 분의 기간 동안 세포를 블로킹 완충액으로 5 회 헹군다. 최적의 결과 (셀, 최소한의 손실)의 경우, 최적의 세정 조건은 경험적으로 결정되어야한다.
  8. 4 % 염소 혈청을 함유하는 TBS의 각 차 항체에 대해 유도 형광 접합 된 이차 항체 (200 : 100 1~1의 희석 비)로 희석.
    참고 : 최적의 결과를 들어, FINA이 용액에 차 항체 L의 농도는 실험적으로 결정되어야한다.
  9. 세포 샘플을 몰입하기 위해 희석 차 항체의 충분한 볼륨 (약 30 μL)을 적용합니다. 37 ° C에서 1 시간 동안 세포 샘플을 인큐베이션. 블로킹 완충액으로 세포를 3 회 헹군다.
  10. 세포 샘플을 몰입하는 DAPI (50 ~ 100 NG / ㎖)을 함유 TBS의 충분한 양을 적용합니다. RT에서 5 분 동안 세포 샘플을 인큐베이션. TBS와 세포에게 1-2 번 씻어.
  11. 2.11에 기재된 바와 같이 마이크로 슬라이드에 세포 샘플을 포함하는 커버 유리를 탑재.

5. 면역 형광 이미지 관찰, 수집, 정량 및 분석

  1. 63X 및 100X 오일 침지 렌즈, 외부 컴팩트 광원 및 CCD 디지털 카메라가 장착 된 전동식 형광 현미경으로 세포 샘플을 관찰한다.
  2. 소프트웨어를 이용하여, 디콘 볼 루션 포함한 화상 획득 및 처리를 수행A, 또는 소프트웨어의 B1과 B2는 (재료 / 장비의 목록 참조). 소프트웨어의 B1과 B2에 사용 된 모든 명령에 대한 소프트웨어 A.에 사용 된 모든 명령에 대한 보충 코드 파일 (5.2.1)를 참조하시기 바랍니다, 기업 코드 파일에 (5.2.2)를 참조하시기 바랍니다.
  3. 센트로 - 동원체 단백질의 신호를 정량화하기 위해 앞에서 설명한 방법 23-25을 사용하여 (예를 들어, 센트로에서 CENP-A의 신호를 나머지) 다음 약간의 수정과 :
    1. 선택 센트로 - 동원체 단백질의 영역과 배경의 다음과 같습니다 :
      1. 유사 분열 세포 (센트로 - 동원체 지역) DAPI로 염색 염색체와 중복 선택 영역; (즉, 세포질 영역) 염색체 외부하지만 동일한 단일 셀 내부 (배경 지역) 및 지역.
      2. 간기 세포 (센트로 - 동원체 지역) DAPI로 염색 염색질과 중복 선택 영역; (크로 마틴 외부하지만 동일한 단일 셀 내부 (배경 지역) 및 지역 <EM> 즉, 세포질 영역).
        참고 : 각각 소프트웨어 또는 소프트웨어 B2와 영역 선택에도 기업 코드 파일 (5.2.1.4.3) 또는 (5.2.2.6.4)을 참조하십시오.
    2. 다음 식을 사용하여,이 태스크에 대한 소프트웨어 또는 B를 사용하여 잔여 신호의 동원체의 백분율을 정량화 :
      센트로 - 동원체에 센트로 - 동원체 단백질의 신호를 남은
      Equation1
      b는 백그라운드 신호의 밝기이다; s는 ACA 또는 CENP-B 염색으로 확인 된 선택된 영역의 신호의 휘도이고 R 샘플의 siRNA (들) 처리 된 세포에 대한 기준 ACA 또는 CENP-B 신호이고; 및 R의 CTRL 루크 siRNA를 형질 세포에 대한 기준 ACA 또는 CENP-B 신호이다.
      주 : 이전에보고 한 바와 같이이 분석에서, CENP-B 신호 CUL4A위한 기준 신호로 사용 RBX1 하였다.
    3. 복사 후이 계산 엑셀 파일을 사용하여 전술 한 신호 정량 소프트웨어의 원시 데이터를 붙여. 또한 기업 코드 파일을 참조하십시오 자세한 내용은 (5.2.1.4) 및 (5.2.2.6 참조). 계산의 일례를 표 3에 나타낸다.
  4. 각각의 측정 수준에 대한 염색 및 이미지 수집의 변화를 제거하기 위해 최소한 20 세포를 분석 할 수 있습니다. 각각의 셀을 분석하기위한 선택적으로 다른 센트로 - 동원체 단백질 중 이러한 값을 비교 센트로 - 동원체 신호를 나머지의 "평균값"를 사용합니다.

총 단백질 6. 웨스턴 블롯 분석

  1. 버퍼 변성에 세포를 재현 탁 (20 mM 트리스 - 염산을 pH가 7.4의 50 mM의 NaCl, 0.5 % Nonidet P-40, 0.5 % 데 옥시 콜레이트, 0.5 % SDS, 1mM의 EDTA 및 완전 EDTA 프리 프로테아제 억제제 칵테일) 피사체 (26), 초음파 및 동결 해동 방법 및 측정하는 현탁액단백질 농도 다음과 같습니다 :
    1. 초음파 처리를 들면, 48 내지 72 시간의 형질 감염 후에서 6 웰 폴리스티렌 플레이트의 웰로부터 수집 개의 셀 버퍼의 50 μL를 추가 (프로토콜 1 참조). 장애 물질의 혼과 마이크로 팁이 장착 된 초음파 분쇄기를 작동 한 샘플 당 총 15 초 간헐적 인 펄스 기간 (듀티 사이클 50 %)에 대한 (자재 / 장비의 목록 참조).
    2. 동결 - 해동 과정 들어, 액체 질소로 동결하고 세포를 실온에서 세포를 해동.
    3. 상업 단백질 분석 시약 I 또는 II를 사용하여 단백질 농도를 측정 (자재 / 장비의 목록 참조).
      주 : 해물 시약 I 또는 II 중 하나와 단백질 농도의 측정 1:10의 비율로 희석된다. 이 희석에서, 버퍼의 SDS 존재는이 측정에 거의 또는 전혀 방해를 보여줍니다.
  2. 2 × 4 × SDS-PAGE 로딩 버퍼 전체 단백질의 20 ~ 30 μg의 포함 된 해물을 섞는다. 27 삶아 샘플5 분 후 전기에 대한 SDS 폴리 아크릴 아미드 겔을 변성 12.0 % -15.0 %에 그들을로드합니다.
  3. 전술 웨스턴 블럿 방법을 사용하여 PVDF 막에 SDS-PAGE에 의해 분리 된 단백질을 옮긴다. 17,24,27-31을
    1. 1 × PBS에서 5 % 무 지방 우유 멤브레인 비특이적 결합 부위를 차단하고 실온에서 1 시간 동안 희석 차 항체 용액과 함께 막을 배양한다. 각 기본 항체의 상세 정보 (예를 들면, 희석 비율) 재료 / 장비 목록을 참조하십시오.
    2. PBS-T 완충액 (진탕 각각 3-5 분 인큐베이션) 막 3-4 회 세척 한 후 (1 x PBS, 0.1 %의 트윈 20), 근적외선 (IR​​)의 혼합물에 막 부화 형광 염료 접합 이차 항체 (하나의 희석 비율 : 20,000) DyLight 접합 된 이차 항체 (하나의 희석 비율 : 20,000) 및 / 또는 양 고추 냉이 퍼 옥시 다제 (HRP)를 PBS-T에 희석 이차 항체 (π 공역; diluti을RT에서 1 시간 10,000) : 1의 비율. 각 보조 항체의 상세 정보 (예를 들면, 희석 비율) 재료 / 장비 목록을 참조하십시오.
  4. 막을 3 회 세척 한 후, 적외선 이미지 시스템 및 / 또는 면역 검출 용 화학 발광 이미 저 단백질 분석 막을 검사 (재료 / 장비의 목록 참조).
    1. 적외선 이미징 시스템을 사용하기 위해, 기업 코드 파일에 (6.4.1)를 참조하십시오.
    2. 화학 발광 이미 저를 사용하기 위해, 기업 코드 파일에 (6.4.2)를 참조하십시오. 초 고감도 강화 된 화학 발광 (ECL) 기판을 사용하여이 시스템 (자재 / 장비의 목록 참조).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

내생 CENP-A의 면역 형광 분석 CUL4A-E3 리가 아제가 동원체에 CENP-A의 현지화에 필요한 가설을 지원합니다
우리의 최근의 연구는 CUL4A-RBX1 - COPS8 E3 리가 활동이 CENP-A와 동원체에 CENP-A의 현지화에 라이신 124 (K124)의 ubiquitylation 필요하다는 것을 보여 주었다. (17) 처음에는 계면-센트로 단지 (ICEN가)에 의해 분리 하였다 안티 CENP-A : 기본 염색질 면역, 32-34는 ICEN 단백질의 일부 중심절에 CENP-A 지역화에서 중요한 역할을 할 수 있다고 가정하고있다. 따라서, siRNA를 녹다운 실험은 그 부재 발현 중심절 17 CENP-A의 비편 재화를 유발하는 단백질을 선별하도록 수행되었다 (데이터는 미도시) 비동기 성장 HeLa 세포는 회 Cullin 4A (CUL4A)의 siRNA 또는 RBX1에 siRNA를 형질 감염시켰다 (최적의 단백질 고갈에 대한 48 시간 필요CUL4A에 대한 연구 및 RBX1 72 시간). CUL4A siRNA를 형질 세포 중심절에 CENP-A 상당한 비편 재화 (도 1A-C)를 보였다. 도 2G에 도시 된 바와 같이, CUL4A siRNA를 형질 세포의 총 세포 용 해물에서의 CENP-A의 단백질 수준은 동일한 배양 조건 (룩) siRNA를 형질 세포는 루시퍼 라제에서 해물의 CENP-A의 수준과 유사 하였다. CUL4A의 siRNA는 3 'UTR (그림 2A-C)를 대상으로 할 때 CUL4A-국기 자궁외 표현 중심절에 CENP-A의 감소를 구출하기 때문에 CUL4A의 siRNA의 오프 대상 효과의 가능성은 배제했다. 전체 세포 용 해물에서의 CENP-A의 단백질 수준에 상관없이 세포주기 단계 (도 1B, 2G)와 동일한 배양 조건에서 배낭 siRNA를 형질 세포 용 해물에서의 CENP-A 수준과 유사한 것을 확인 하였다; 따라서 CUL4A 붕괴가 유발 될 가능성 있음 CENP-A 단백질 분해가 제거되었다.

35 리가이며, 3 대 요소를 포함 : cullin 비계, RING 핑거 단백질 (RBX1 또는 RBX2) 및 RBX1 또는 RBX2 의해 보충된다 유비퀴틴 충전 E2 효소 36 RING 핑거 단백질은 또한 유비퀴틴 전송을 용이 E2 효소에 근접하여 기판을 배치하는 기판 어댑터를 모집하고 있습니다. (36) RBX1 siRNA를는 상당한 감소를 유발 RBX1의 siRNA를 형질 감염된 세포의 총 세포 용 해물에서의 CENP-A 단백질 수준 루크 siRNA를 형질 감염된 세포 용 해물에서의 CENP-A의 수준과 유사 하였다되는 조건 동원체 (도 1D-F)에서의 CENP-A (도 2G). RBX1 파괴하거나 동일한 배양 조건 하에서 CUL4A의 조합 RBX1 파괴로 인해서 CENP-A 단백질의 열화 (도 2G)은 관찰되지 않았다. 오프 - 타겟 효과의 가능성RBX1의 siRNA 3 'UTR (도 2D-F)을 목표로 할 때 깃발 RBX1의 이소성 발현 중심절에 CENP-A의 감소 때문에 RBX1 구조의 siRNA (S)는 제외 하였다. 이러한 연구 결과는 CUL4A-RBX1-E3 리가 특별히 중심절에 CENP-A의 현지화를 위해 필요하다고 제안했다.

외인성 CENP-A의 면역 형광 분석 - 플래그 단백질은 CENP-A K124의 ubiquitylation가 동원체에 CENP-A의 현지화에 필수적임을 나타냅니다
이전에, 우리 면역 질량 분석 분석은 리신 124 CENP-A-플래그 (K124)는 HeLa 세포에서 ubiquitylated되는 것으로 나타났다. 17 CENP-A 뉴 클레오의 결정 구조 사이트이지만, K124은 α3 나선 상주 하지 CATD 영역 내에. (17) 또한, K124은 포유류, 조류, 도마뱀, 식물 및 균류의 그룹 (예를 들어, 새싹들 사이에서 보존된다땡 효모). 17 CENP-A 라이신 돌연변이 (그림 3A)를 구성하고 센트로에 지역화 할 수있는 능력을 시험 하였다. 유사 분열 및 상간 모두 HeLa 세포의 확산 신호와 외인성 CENP-A K124R 돌연변이의 센트로 미어 현지화의 실질적 폐지 (그림 3B, C)이 관찰되었다. 센트로 현지화 크게 둘 K9A 돌연변이에 의해 (K77은 CATD에 고유 라이신 사이트입니다) (그림 3B, C)도 K77R 돌연변이 (K9은 H3 K9 메틸화를 히스톤에 해당) 영향을받지 않았다.

이러한 결과에 기초하여, 두 가지 가설 K124의 CENP-A ubiquitylation의 생체 내 기능에 대하여 제안되어있다. 첫째, K124의 ubiquitylation의 역할은 euchromatin에 과잉 발현 및 / 또는 mislocalized CENP-A를 제거하는 유비퀴틴 - 중재 단백질 분해를위한 것입니다. 둘째, K124에 CENP-A ubiquitylation의 역할은 동원체에 CENP-A를 로딩입니다. F를 테스트하려면IRST 가능성, CENP-A-국기 야생형 및 사이클로 헥시 미드 (CHX) 후 K124R 돌연변이뿐만 아니라 내생 CENP-A 치료 CUL4A- 또는 RBX1 고갈 세포의 안정성이 해결되었다. 이러한 데이터는 (데이터 미도시). 17 K124의 ubiquitylation 아마도 과잉 발현 및 / 또는 mislocalized CENP-A를 제거하는 유비퀴틴 매개 단백질 분해에 관여하지 않는 것을 제안했다. 또한,이 K124R 돌연변이가 생체 내시험 관내 ubiquitylation 분석 모두에서 추정 monoubiquitylation 및 diubiquitylation 밴드 abrogates 것이 확인되었다 (데이터는 보이지 않음). (17)을 합하여,이 데이터 CUL4A-RBX1 착체가 "신호"ubiquitylation 기여한다는 제안 이는 중심절에서 CENP-A 현지화가 필요합니다.

외인성의 국기 면역 형광 분석 - CENP-A 단백질은 monoubiquitin 융합로드하기에 충분 있음을 나타냅니다중심절에서 CENP-A K124R
상기 결과에 기초하여, 공유 결합 monoubiquitin가 동원체 상 CENP-A 로딩하기위한 신호로서 작용한다는 가정 하였다. 이 가설, N 말단 국기 - 태그 및 C 터미널 유비퀴틴 - 융합 야생형 CENP-A 및 CENP-A가 건설되었다 K124R 돌연변이 (그림 4A)를 테스트합니다. polyubiquitylation 37-39 주요 사이트 결여 monoubiquitin 돌연변이 UB (K48R)는 또한 잠재적 polyubiquitylation에서 유비퀴틴 융합 CENP-A 단백질을 방지하기 위해 사용되었다. 안티 - 플래그 면역 신호를 캡처하여, 이러한 구조에 의해 인코딩 된 단백질의 센트로 미어 현지화 시험 하였다. 국기 - CENP-A (K124) CENP-A의 실질적 폐지 센트로 현지화 반면 (그림 4b 및도 4c, 열 [6]), 국기 - CENP-A (WT) 및 국기 - CENP-A 양 (WT) -Ub ( WT)이 그 중심 소체 현지화 (도 4b 및도 4c를 유지하고, 열 [1], [2]). 그만큼이 단백질이 실질적으로 중심절에 현지화 복원으로 국기 - CENP-A (K124R) -Ub (K48R) 단백질은 아마도, CENP-A를 monoubiquitylated 모방 (그림 4C, 비교 열 [5] [6])했던보다 효율적으로보다 CENP-A (K124R) -Ub (WT) (그림 4C는, 열을 비교 [4] - [6]). 이러한 데이터는 monoubiquitylation가 동원체에 CENP-A의 모집을위한 충분하다는 것을 보여 주었다.

그림 1
그림 1. 내생 CENP-A의 면역 형광 분석 CUL4A-E3 리가 아제는 (그림이 Niikura 등. (17)에서 채택 된) 중심절에 CENP-A의 현지화에 필요한 가설을 지원합니다. 중심절에서 CENP-A의 (A) CUL4A siRNA를 유도 비편 재화. HeLa 세포는 CUL4A 또는 루시 페라 제 (룩) siRNA를 형질 감염 (48 시간 동안 배양시켰다표 1). 스케일 바는 10 μm의 나타낸다. (B) (A)과 동일한 배양 조건을 사용 헬라 전체 세포 용 해물의 웨스턴 블롯 분석. 세포는 CUL4A의 siRNA 또는 루크의 siRNA (표 1)에 형질 전환 후 48 시간을 수확했다. GAPDH는 하중 제어 역임했다. (C) (A)에 도시 중심절에서 정량화 내생 CENP-A 신호. 신호 정규화는 배낭 siRNA를 형질 감염 세포를 사용하여 수행하고, (± SD) 평균 비율이 도시되어있다. **** P <루크 siRNA를 형질 세포 (학생의 t- 테스트) 중심절에서 CENP-A의. (D) RBX1 siRNA를 유도 비편 재화 대 0.0001. HeLa 세포는 RBX1 또는 배낭의 siRNA (들)로 형질 감염 72 시간 (표 1) 동안 인큐베이션 하였다. 스케일 바는 10 μm의를 나타냅니다. (E) (D)와 동일한 배양 조건을 사용하여 헬라 전체 세포 용 해물의 웨스턴 블롯 분석. 세포는 RBX1 오와 형질 전환 후 72 시간을 수확했다R 루크의 siRNA (들) (표 1). GAPDH는 하중 제어 역임했다. (F) (D)에 도시 중심절에서 내생 CENP-A 신호를 정량화. 신호 정규화는 배낭 siRNA를 형질 감염 세포를 사용하여 수행하고, (± SD) 평균 비율이 도시되어있다. **** P <루크 siRNA를 형질 세포 (학생의 t- 테스트) 대 0.0001. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 2
그림 1 중심절 그림과 ​​관련된 2. 기업 정보 CUL4A의 siRNA는 3 'UTR을 대상으로 할 때. (A) 외인성 CUL4A - 플래그 CENP-A의 비편 재화를 구출 (그림은 Niikura 등. (17)에서 적응되었다). 헬라 테트 - 오프 CELLS는 siRNA를에 cotransfection 후 48 시간 고정 하였다 (CUL4A # 2 : 3 'UTR 대상 또는 배낭 표 1) 플러스 플라스미드 구조체 (pTRM4-CUL4A 플래그, 벡터 표 2). 4 색의 면역 염색 : DAPI (파란색)에 대한 염색; 깃발; 내생 CENP-B (적색); 내생 CENP-A (녹색), 수행 된 플래그 양성 세포 분류되었지만 플래그 이미지는 생략된다. 참고 CUL4A # 2는도 1A-C에 도시 된 것과 동일한 대상이다. 스케일 바는 10 μm의 나타낸다. (B) (A)에 도시 한 바와 같은 배양 조건은 다음 헬라 테트 - 오프 전 세포 용 해물의 웨스턴 블롯 분석. GAPDH는 로딩 대조군으로. (A)에 도시 중심절에 (C) CENP-A 신호가 방지 플래그 항체에 의해 결합들을 분리하는 세포의 분류 후에 현미경에 의해 정량화 하였다. 정규화 신호는 룩 siRNA를 더한 벡터로 형질 감염된 세포로 수행하고, (± SD)의 평균 백분율을 나타낸다.RBX1의 siRNA는 3 'UTR을 대상으로 할 때 **** P <루크의 siRNA 플러스 벡터 (왼쪽 열, 학생의 t- 테스트)로 형질 세포 대 0.0001. (D) 외인성 국기 - RBX1은 센트로에서 CENP-A의 비편 재화를 구출 . 플러스 플라스미드 구조체 (된 pcDNA3-FLAG-RBX1, 벡터 표 2) : HeLa 세포와 72의 siRNA에 cotransfection 후 시간 (표 1 3 'UTR 대상 또는 배낭 RBX1 # 2)에 고정 하였다. 4 색의 면역 염색 : DAPI (파란색)에 대한 염색; 깃발; 내생 CENP-B (적색); 내생 CENP-A (녹색), 수행 된 플래그 양성 세포 분류되었지만 플래그 이미지는 생략된다. 스케일 바는 10 μm의를 나타냅니다. (E) (D)와 동일한 배양 조건 다음 헬라 전체 세포 용 해물의 웨스턴 블롯 분석. GAPDH는 로딩 대조군으로. (F) (D)에 도시 중심절에 CENP-A 신호가 결합하여 이들을 분리하는 세포를 선별 한 후 현미경으로 정량화 n은 안티 - 플래그 항체. 정규화 신호는 룩 siRNA를 더한 벡터로 형질 감염된 세포로 수행하고, (± SD)의 평균 백분율을 나타낸다. **** P <0.0001 루크의 siRNA 플러스 벡터 (왼쪽 열, 학생의 t- 테스트)로 형질 세포. CUL4A 및 RBX1의 (G) 고갈이 내생 CENP-A 단백질의 수준에 영향을 미치지 않았다 대. 내생 CENP-A 단백질의 수준이 헬라 전체 세포 용 해물 측정 하였다는 CUL4A, RBX1, CUL4A 플러스 RBX1, 또는 루크의 siRNA와 형질 전환 후 72 시간 수확. 48 시간 형질 전환 한 후, 세포이었다 중 (Asyn) 치료 또는 파클리탁셀 (+ 세금) 유사 분열에 체포를 유도, 그들은 24 시간 동안 배양하는 처리 하였다. GAPDH는 하중 제어 역임했습니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

32 / 53732fig3highres.jpg "너비 ="700 "/>
외인성 CENP-A-플래그 단백질의 그림 3. 면역 형광 분석은 CENP-A K124의 ubiquitylation는 (그림이 Niikura 등을 각색되었다. 17) 중심절에서 CENP-A 현지화에 필요한 것으로 나타났다. CENP-A-의 (A) 과발현 플래그 구조 (WT 및 KR 돌연변이는) 헬라 테트 오프 전체 세포 용 해물의 웨스턴 블롯 분석에 의해 확인되었다. 세포는 pTRM4-CENP-A-국기 WT, KR 돌연변이, 또는 pTRM4 벡터 (표 2)와 형질 전환 후 48 시간을 수확했다. CENP-A-국기의 과발현은 안티 - 플래그 항체가 검출되었다. GAPDH는 하중 제어 역임했다. 추정 CENP-A-플래그 이량 체 (##)와 CENP-A-플래그 단량체 (#)가 표시됩니다. 주 : SDS 내성 CENP-A 다이머는 이전에보고 된 40, 41 (B) CENP-A K124R 돌연변이 동원체에서 확산 비편 재화를 보였다.. DAPI (파란색), 국기 (의 신호 초n) 및 내인성 CENP-B (적색, 센트로 위치 제어)가 도시되어있다. 참고 : CUL4A 또는 RBX1의 siRNA를 형질 감염된 세포에서 내생 CENP-A는 달리, 확산 신호가 발현 수준은 약 10 아마도 때문에, 중심절을 대상으로하는 무능력의 표현형으로 외생 CENP-A K124R-국기를 과발현 세포에 등장 - 내인성 CENP-A보다 높은 25 배 (데이터는 도시하지 않음) 17 스케일 바 (B)에 나타낸 패턴의 파악 10 ㎛의 (C) 히스토그램을 나타낸다... 50 개 이상의 프로 / prometaphase 및 중기 세포와 실험 당 200 개 이상의 계면 세포 (N ≥ 3 실험)를 측정 하였다. (SD ±) 평균 백분율이 표시됩니다. "기타 (비 센트로)는"아마도 때문에 형질 전환 또는 다른 치료의 대부분은 손상된 세포, 죽은 세포, 또는 (만 계면에서) 핵소체 지역화와 세포를 나타냅니다. *** P <CENP-A WT-국기 (학생의 t- 테스트) 대 0.001.

그림 4
외인성 국기 - CENP-A 단백질의 그림 4. 면역 형광 분석은 CENP-A 중심절에서 CENP-A K124R 돌연변이의 monoubiquitin 융합 구조 비편 재화는 (그림이 Niikura 등. (17)에서 적응 된) 것으로 나타났다. (A) 본 연구에서 사용 된 각 구조물의 개략도 만화 (또한 표 2 참조). CENP-A (적색)과 monoubiquitin (파란색)에 K48R 돌연변이 사이트 K124R 돌연변이 사이트가 표시됩니다. (1) WT : 국기 - CENP-A (WT), (2) WT-UB (WT) : 국기 - CENP-A WT-UB (WT), (3) WT-UB (K48R) : 국기 - CENP-A WT -Ub (K48R), (4) K124R-UB (WT) : 국기 - CENP-A K124R-UB (WT), (5) K124R-UB (K48R) : 국기 - CENP-A K124R-UB (K48R), (6) K124R : 국기 - CENP-A K124R (B) 외인성 CENP-A 중심절에서 CENP-A K124R 돌연변이의 monoubiquitin 융합 구조 비편 재화.. DAPI (파란색), 국기 (녹색), 및 내인성 CENP-B (적색, 센트로 위치 제어가) 표시됩니다. 스케일 바 (C)에 도시 된 현지화 패턴의 10 μm의. (C) 히스토그램을 나타냅니다. 50 개 이상의 프로 / prometaphase 및 중기 세포와 실험 당 200 개 이상의 계면 세포 (N ≥ 3 실험)를 측정 하였다. (SD ±) 평균 백분율이 표시됩니다. **** P <0.0001 *** P <0.001 비 융합 국기 - CENP-A K124R 대 (열이 [6]) (학생의 t- 테스트). 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

siRNA의 대상 본 연구에 표시 대상 유형 siRNA의 데이터베이스 번호 앞으로 순서 (들) 소스 / 참조
루시 페라 제 (GL3) - 1 대상 RKK9 CUUACGCUGAGUACUUCGAdTdT Elbashir 등., (2001)
CENP-A CA-UTR siRNA의 풀 (2 대상 혼합물) RKK375 / 5 'UTR의 T1 CGAGCGGCGCGGACUUCUGCCdTdT Niikura 등., (2015)
RKK383 / 3 'UTR의 T1 UCCUGCACCCAGUGUUUCUGUdGdT Niikura 등., (2015)
CUL4A #1 1 대상 CRKK178 / RKK309 / T1 AGCGAUCGUAAUCAAUCCUGA Niikura 등., (2015)
# 2 (3'UTR) 1 대상 CRKK181 / RKK331 / T4 AUGCGGGUUUGAAAUAUGACA Niikura 등., (2015)
RBX1 / ROC1 #1 siRNA를 풀 (4 대상 혼합물) CRKK198 / RKK411 / T1 GAAGCGCUUUGAAGUGAAA Niikura 등., (2015)
CRKK198 / RKK413 / T2 GCAUAGAAUGUCAAGCUAA Niikura 등., (2015)
CRKK198 / RKK415 / T3 GCAAGAAGCGCUUUGAAGU Niikura 등., (2015)
CRKK198 / RKK417 / T4 CAACAGAGAGUGGGAAUUC Niikura 등., (2015)
# 2 (3 'UTR) 1 대상 CRKK206 / RKK425 / T8 UUCCCUGCUGUUACCUAAUUA Niikura 등., (2015)

본 연구에 사용 된 표 1의 siRNA 서열.

B 번호 관련 특성 (들) 소스 / 참조
B288 pTRM4 Niikura 등., (2006)
B2067 pTRM4 인간 CENP-A-국기 Niikura 등., (2015)
B2281 pTRM4 인간 CENP-A K9A-국기 Niikura 등., (2015)
B2387 pTRM4 인간 CENP-A K77R - 국기 Niikura 등., (2015)
B2388 pTRM4 - 구호 물자N CENP-A K124R-국기 Niikura 등., (2015)
B2512 pTRM4 - 국기 - 인간 CENP-A Niikura 등., (2015)
B2579 pTRM4 - 국기 - 인간 CENP-A K124R Niikura 등., (2015)
B2513 pTRM4 - 국기 - 인간 CENP-A-UB (WT) Niikura 등., (2015)
B2559 pTRM4 - 국기 - 인간 CENP-A K124R-UB (WT) Niikura 등., (2015)
B2515 pTRM4 - 국기 - 인간 CENP-A-UB (K48R) Niikura 등., (2015)
B2560 pTRM4 - 국기 - 인간 CENP-A K124R-UB (K48R) Niikura 등., (2015)
B2759 pTRM4 인간 CUL4A-국기 Niikura 등., (2015)
B2624 한 pcDNA3TM - 국기 - 인간 RBX1 Niikura등., (2015)
B1491 된 pcDNA3-국기 Niikura 등., (2015)

본 연구에 사용 된 표 2 플라스미드 벡터.

R (항 CENP-B) 샘플 B (항 CENP-B) R 샘플 (감산) 비율 (S 샘플 : R 샘플) 수정 비율 (S 샘플 : R 샘플)
(520) (514) 6 -4.167 0.000
(535) (445) (90) -1.033 0.000
(515) (431) (84) 0.274 0.274
(562) 483 79 0.506 0.506
(902) (562) (340) 0.509 0.509
1,203 (703) (500) -0.560 0.000
1,014 589 (425) -0.819 0.000
768 (510) (258) -1.345 0.000
555 458 97 -1.845 0.000
781 576 (205) -1.146 0.000
556 (436) (120) 0.758 0.758
(534) 493 (41) -1.634 0.000
(702) 543 159 0.667 0.667
(482) 429 (53) -1.000 0.000 (654) (531) (123) 0.740 0.740
1,190 (607) 583 0.384 0.384
(552) (454) 98 0.969 0.969
489 (413) (76) 0.539 0.539
(511) (452) 59 -3.186 0.000
485 475 (10) -2.700 0.000
481 (441) (40) -1.475 0.000
합집합 5.347
평균 0.255
R (항 CENP-B) CTRL B (항 CENP-B) 비율 (S Ctrl 키 : R Ctrl 키) 수정 비율 (S Ctrl 키 : R Ctrl 키)
543 483 (60) 3.017 3.017
(526) 466 (60) 2.667 2.667
(532) (460) (72) 1.792 1.792
(507) 457 (50) 3.520 3.520
491 458 (33) 4.273 4.273
545 (464) (81) 2.160 2.160
(518) 484 (34) 3.559 3.559
(461) (404) 57 2.404 2.404
487 (447) (40) 3.550 3.550
(534) 477 57 3.965 3.965
(528) (456) (72) 3.097 3.097
(707) (601) (106) 1.868 1.868
(615) (528) 87 2.828 2.828
(660) 481 179 1.620 1.620
565 476 89 1.607 1.607
(527) (455) (72) 3.583 3.583
(560) 474 (86) 2.930 2.930
(510) (451) 59 4.017 4.017
729 586 (143) 2.678 2.678
(634) 576 (58) 3.655 3.655
(507) 476 (31) 3.935 3.935
합집합 62.725
평균 2.987
센트로에서 CENP-A 신호를 남은 (%) 8.5

. 표 3. 센트로 (%)로 잔류 CENP-A 신호의 계산의 예는도 2F에서 프로 / Prometaphase의 일례가 도시되어 샘플은도 2F에서 RBX1 # 2 (3'UTR) + VEC (중심 열인 ) 및 제어 루크 + VEC 그림 2 층에서 (왼쪽 열)입니다. 결과에서 CENP-A 신호 잔존센트로 (%) = (0.255 / 2.987)를 100 = 8.5 % 얻는다 X (또는 [5.347 / 62.725]가 [예 21 전지는 2 개의 샘플 사이 분석 동일한 총 세포 수 100 = 8.5 %에 X). B 값이 S 값보다 크면 (감산 값이 음수 인 경우, 즉,) 비 보정 값이 0.00으로 설정되어 있습니다.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

최근 몇 년 동안 많은 연구가 고정 된 세포에 대해 서로 다른 양적 현미경 분석법을 개발 하였다. (42) 진행을 센트로 - 동원체 생물학에 자주 세포 내 공간 - 시간 규제의 변화하는 기능을 반영하고있는 단백질의 센트로 별 또는 동원체 특정 기능에 대한 이해가 필요 세포주기 중에 이러한 단백질. 따라서, 우리가 IIF 염색 구체적으로 다르​​게 취급 샘플에 적용 할 수있는 내인성 및 외인성 CENP-A 단백질의 상대적인 수준을 분석하는 정량적 IIF 분석 방법을 개발했다. 현재 우리는이 연구에서 프로토콜 2를 사용하여 내생 CENP-I, CENP-H, KNL1, Hec1 및 Ska1의 성공적인 IIF 염색을 달성 (. Niikura (24)와 데이터가 표시되지 참조; 재료 / 장비의 목록을 항체의 내용) . 미래에는, 하나의 (상이한 센트로-동원체 단백질의 수준을 정량화하기 endog을 모두 동일한 방법을 적용 할 수있다특정 항체를 선택) enous 및 외래 단백질을 플래그 - 태그, 그러나, 우리의 IIF 방법은 살아있는 세포 또는 전체 세포주기 중 특정 하나의 세포에서이 단백질의 검출을 포함하지 않습니다. 이러한 절차는 고정 분리 된 커버에 처리 될 셀을 필요로하기 때문에, 우리는 매우 상이한 샘플들 사이의 신호를 비교하고 분석의 정확성을 높이기 위해 정규화 목적 기준 신호 (예를 들면, ACA 또는 CENP-B)를 도입했다. ACA는 내인성 및 / 또는 외인성 CENP-A 신호, CENP-B를 포함하기 때문에 CENP-A 신호의 정량 분석​​의 정밀도의 관점에서 ACA보다 정상화 목적 기준 신호 비교에 더 적합 할 것 같은. CENP-B의 아미노 말단 영역 alphoid DNA의 CENP-B 박스 서열의 17 bp의 모티프와 결합하고, CENP-B의 카르복시 말단 영역은 동종이 량체를 형성한다. 43,44 CENP-B 완전 colocalize 않는다 CENP-A 및 / 또는 기타와 CENTRomere-동원체 단백질은, 그러나, 밀접하게 그들과 관련이있다. 45 항 CENP-C 항체와 면역은 일반적으로 그러나 항 CENP-B는 종종 두 자매 동원체를 연결하는 하나의 밝은 막대로 나타납니다. (46) 염색, 두 개의 분리 된 지점을 제공하는 동안 우리 매크로 스케일 현미경 관찰 일부 CENP-B 신호는 분명히 관찰 각도와 사용 정착액의 유형에 따라 부분적으로도, 특히 초기 분열 단계 (후반 중기보다 의향-prometaphase)에서, CENP-A 신호와 중첩 (데이터는 보이지 않음). 센트로-동원체 단백질의 대부분의 지역화에 의존하지만 반대로, CENP-A 신호 정량적 IIF 분석에서, 기준 신호의 단백질 지역화, 고갈 및 / 또는 적정 분석 CENP-A의 기능 장애에 의해 영향을 받아서는 안 중심절에서 CENP-A 현지화. 47, 48 CENP-A-독립적 인 동원체 어셈블리는 CENP의 DNA 결합 영역을 대체하여 설립자궁외 궤적에이 단백질을 모집 다른 염색체 타겟팅 도메인이 -C 및 CENP-T. 또한 49,50은 최근의 작업은 내부 동원체 구성 요소 CENP-C 병렬 CENP-T의 행위에 KMN 네트워크를 모집하는 것으로 나타났다 또한 kinetochores. 51-54, 니시노 등의 알은. 정규 뉴 클레오 단백질을 넘어 '히스톤 코드'를 연장, DNA와 연락처를 생성하는 CENP-TWSX 복잡한 형태 그 고유의 뉴 클레오 같은 구조를 제안했다. (55) 때문에 CENP-의 센트로 현지화 C는 CENP-A의 센트로 지역화에 의존, 47, 48 CENP-TWSX 또는 특히 CENP-T는 다른 단백질 후보 (들) CENP-A의 정량적 IIF 분석에서 기준 신호를 제공하도록 될 수있다. 그러나, 참조 신호에 대한 후보는 신중하게 중심절에서 현지화가 CENP-A의 고갈 및 / 또는 기능 장애에 의해 영향 여부를 확인하는 분석하기 전에 테스트해야합니다. 유사 고려다른 센트로-동원체 단백질의 정량 분석​​법 IIF주의해야한다 : 레퍼런스 신호 단백질 현지화 적정 분석 대상 단백질의 결핍 및 / 또는 기능 장애에 의해 영향을받지 않을 것이다. 이전 연구에서, 우리는 다른 중앙 외측 동원체 단백질의 정량 IIF 분석을위한 기준 신호로서 ACA를 사용했다. 24 ACA는 위치 제어와 같은 단일 CENP-B보다 적절한 옵션뿐만 아니라 레퍼런스 신호, 만약 수 ACA 전술 한 바와 같이 신호 CENP-B와 목적 단백질의 결핍 및 / 또는 목적 단백질의 기능 장애뿐만 colocalization을 영향을받지 않는 것이 나쁘다.

보도 르 등. 센트로 CENP-A 수준은 센트로 CENP-A의 양이 세포 콘텐츠에 정비례 변화 질량 작용에 의해 조절되는 것으로보고 하였다. 56 그들은 또한 CENP-A 발현의 일시적 유도의 신속한 증가를 초래되었습니다 센트로 미어 CENP-A 레벨. 반대로, 우리가 CA-UTR 된 siRNA (UTR의 siRNA 5 '및 3'의 혼합물 표 1)와 pTRM4 발현 벡터에 cotransfection 후 센트로 지역화, 국기 - 태그 CENP-A WT와 큰 세포 인구를 관찰 (데이터하지 ) 표시; 이 인구 만 pTRM4 발현 벡터로 형질 전환 한 후 볼보다도 컸다. 발현 pTRM4 의해 구동 된 외인성 플래그 - 태그 CENP-A 단백질의 수준이, 내인성 CENP-A보다 더 높은 강도 (10 ~ 25 배까지) 약 1.0-1.4 주문 하였다 (데이터는 보이지 않음). 특정 임계 값 이상의 외래 CENP-A (WT)의 발현에 악영향을 적절한 센트로 미어 현지화에 영향을 미칠 수있는 것으로 추측된다.

본 프로토콜에 고정 네이티브 상태에 가능한 인접 상황 셀룰러 구조 및 환경을 유지하는 중요한 단계이다. 세포를 고정하면 하나 INTE 단백질 손실을 방지하기 위해 염색 프로토콜을 진행해야휴식 또는 셀의 나머지. 그러나 고정 가끔 항원 사이트를 파괴하고, 다른 항체 - 항원 조합이 서로 잘 하나 고정액으로 제대로 작동하지만. (21)이 때문에 변화의, 정착액의 선택은 크게 관심의 단백질 (들)에 따라 달라집니다. 고정의 시간 길이는 크게 면역 염색으로 단백질 (들)의 검출에 영향을 미칠 수 있고, 더 짧은 정착은 항원 성을 유지하기 위해 일반적으로 더 좋다. (57)을 따라서, 특히 불확실 다른 센트로-동원체 단백질의 새로운 타겟 염색 절차를 결정할 때 새로운 항체로 작업 할 때 현지화하거나, 하나는 최적의 조건을 찾기 위해 고정 및 버퍼의 여러 가지 방법을 테스트해야합니다. 본 프로토콜에 인기 휘발 두 종류의 선택 하였다 : 알데히드 고정 제 (프로토콜 2) 및 유기 용제 (프로토콜 3, 4). 고정 제의 순도는 매우 중요합니다. 프로토콜 4 년, 4 % 염소 혈청 especia를 사용에서야 비특이적 백그라운드를 감소시키기 위해 세포 표면의 IgG 수용체를 차단한다. (57)을 일반적으로, 혈청을 일차 항체 무관 바람직 이차 항체와 동일한 종으로부터 종이어야의 IgG 수용체를 차단. 57

본 프로토콜의 각 일차 항체의 선택은 성공적인 면역을 달성 가장 중요한 단계이다. 최대 특이 순도 친화력 및 결합력을 가진 항체가 바람직하다. 단일 클론 항체에 대한 좋은 시작 농도는 일반적으로 1-5 μg의 / ㎖이다. 폴리 클로 날 항체의 재고를 준비 전형적인 희석 1:20 내지 1 범위 :. 500 (57) 하나는 경험적 차 항체의 적절한 농도와 각 시료 희석액을 결정해야한다. 샘플은 부드럽게 누 볐어하지만 균일 한 염색 배양 동안 건조하지해야합니다. 차 항체 및 보조의 배양과 광범위한 세척ntibody 다른 종으로부터의 면역 글로불린과 교차 반응을 방지하기 위해 필요할 수있다. 그러나, 최적의 세척 상태가 반올림하고 (즉, 유사 분열 흔들림 오프)를 흔들 때 분리합니다. 성공을위한 58 세포, 특히 유사 분열 세포의 손실을 방지하기 위해 경험적으로 결정해야 2 차 항체에 결합하기 위해 선택해야합니다 높은 친화력 차 항체. 예를 들어, 비특이적 IgG의 Fc 수용체에 대한 이차 항체의 Fc 부분의 결합을 방지하기 위해, FB (AB ') 2 단편이 아닌 전체 항체에 사용될 수있다. (57)를 많은 이차 항체, 배양 시간은 30 분으로 최소화 될 수있다 RT에서 비특이적 인 배경을 줄일 수 있습니다.

프로토콜 (5) 이외에, 레이저 스캐닝 공 초점 현미경 검출 지역화 및 형광 특성 센트로-동원체 단백질의 기능 해석에 유리할 수있다. 재료 / 산업 장비의 목록에 나타낸 바와 같이NT, 알렉사 플 루어 488와 알렉사 플 루어 594 아마 본 프로토콜에서 가장 자주 사용되는 형광 염료입니다. 샘플 개의 및 / 또는 상이한 센트로-동원체 단백질을 검출하기 위해, 하나 하나의 단백질을 검출하기 위해 사용 된 항체는 상기 제 단백질의 검출을 방해하지 않도록한다. 본 프로토콜에서 57 개의 일차 항체를 혼합하여 적용 동시에. 그러나, 하나는 개별적으로 함께 일차 또는 이차 항체를 적용하기 전에, 각 단백질에 대한 면역 상태를 최적화한다 : 두 단백질 두 센트로-동원체 성분의 경우와 가까운 위치에있는 경우, 하나의 차 항체는 구조적으로 결합하는 것을 방지 할 수있다 두 번째 차 항체. 다른 스펙트럼의 채널로 하나의 염료 "누설"에서 신호를 방지 난이도 : 다중 신호 검출의 또 다른 관심사는 스펙트럼 오버랩 문제이다. 이 문제는 대회에 대한 더 어려워진다알 간섭 필터는 염료의 수가 증가함에 따라 해결 설정하거나 샘플 overenhanced 신호를 포함하는 경우 (예를 들어, 본 연구에서 ACA 또는 항 - 플래그 신호)자가 형광의 간섭을 포함. 형광도의 문제 해결은 다른 연구에서 수행되었다. 본 연구에서 57,59,60, 각 채널에서 단일 레이블 컨트롤 형광 필터 세트를 최적화하는 것은 이러한 문제 (아래 참조)을 피하기 위해 대부분의 경우에 충분하다.

본 각 프로토콜에서, 적절한 컨트롤은 필수적이다. 면역 염색이 시작되기 전에 모든 새로운 차 항체를 특징으로한다. 해당되는 경우 항체의 특이성은 웨스턴 블롯 분석에 의해 확인되어야한다. 또, 염색은 세포 표면에 비특이적 결합에 의해 야기되지 않는다는 것을 확인 수득되어야하고, 특히 일차 항체의 최적 농도는 작업 희석액을 사용하여 결정되어야(즉, 결합 곡선이 개발되어야한다). 음성 대조군 (즉, 염색 공정에서 차 항체의 부재)를 포함한다. 대조군의 또 다른 방법은 일차 항체에 대해 동일 종의 IgG 통상의 치환이다. 여러 라벨 검출하기위한 하나의 스펙트럼 중첩 아티팩트 (즉, 블리드 - 스루, 크로스, 크로스 토크를 방지하는 이차 항체 (배경 제어)뿐만 아니라 단일 레이블 제어없이 컨트롤을 제조하거나, 전술 한 바와 같이 "누출"을 염색해야 ). 하나는 올바른 신호 "잘못된"필터를 통해 신호를 비교 계산 모든 제거하려면 다음 비율을 사용하여 "누출"및 실제 유통 및 / 또는 형광 라벨의 공동 현지화를 계산하여 "유출"의 비율을 정량화 할 수있다. (60) 배경 제어 신호 이득의 한계를 설정하는 각 채널에 독립적으로 검사하고 ADA으로 상쇄되어야최종 이미징 pted. 각각의 채널에서 자기 형광도의 레벨이 실질적으로 변화하기 때문에 다중 라벨 샘플의 이미지를 얻기 위해 사용되는 모든 채널은 독립적 인 백그라운드 보정을 실시해야한다. 상기 인접 채널들로 "누설"검출하지 않고, 각 채널의 가능한 신호 이득의 양을 결정하기 위해 요구되는 바와 같이 "유출"제어한다. (60)

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

저자는 더 경쟁 재정적 이해 관계가 없음을 선언합니다.

Acknowledgments

이 작품은 NIH 부여 GM68418에 의해 지원되었다.

Materials

Name Company Catalog Number Comments
Lipofectamin 2000 Life Technologies/Invitrogen 11668 transfection reagent I
Lipofectamin RNAiMAX Life Technologies/Invitrogen 13778 transfection reagent II
Opti-MEM I Life Technologies/Invitrogen 31985 Reduced serum media, warm in 37 °C water bath before use
High-glucose DMEM (Dulbecco’s modified Eagle’s medium) Life Technologies/BioWhittaker 12-604 high-glucose DMEM, warm in 37 °C water bath before use
Fetal Bovine Serum, certified, heat inactivated, US origin Life Technologies/Gibco 10082 FBS (fetal bovine serum)
Poly-L-Lysine SOLUTION SIGMA-SLDRICH P 8920 Poly-L-Lysine, 0.1% w/v, in water
UltraPure Distilled Water Life Technologies/Invitrogen/Gibco 10977 Sterile tissue culture grade water 
Micro Cover glass (22 mm x 22 mm)  Surgipath 105 Cover glass (22 mm x 22 mm) 
6 Well Cell Culture Cluster Fisher/Corning Incorporated 07-200-83 6-well polystyrene plate 
Penicillin, Streptomycin; Liquid Fisher/Gibco 15-140 Penicillin-streptomycin
PAP PEN  Binding Site AD100.1 Hydrophobic barrier pen (for a water repellant barrier in immunofluorescent staining)
Paclitaxel (Taxol) SIGMA-SLDRICH T7402 Taxol for mitotic cell analysis
TN-16, microtubule inhibitor (TN16) Enzo Life Sciences BML-T120 TN16 for mitotic cell analysis
BSA (bovine serum albumin) SIGMA-SLDRICH A7906 Blocking reagent
Triton X-100 SIGMA-SLDRICH T8787 Detergent for permeabilization
Paraformaldehyde SIGMA-SLDRICH P6148 Fixation reagant
DAPI SIGMA-SLDRICH D9542 For nuclear staining
p-phenylenediamine SIGMA-SLDRICH P6001 For mounting medium
VWR Micro Slides, Frosted VWR International 48312-013 Micro slides 
Anti-CENP-A antibody Stressgen/Enzo Life Sciences KAM-CC006 Mouse monoclonal antibody; dilution ratio of 1:100 (IIF), 1:5000 (WB)
Anti-CENP-B antibody Novus Biologicals H00001059-B01P Mouse monoclonal antibody; dilution ratio of 1:200 (IIF, methanol/acetone fixation)-1:400 (IIF, paraformaldehyde fixation)
Anti-CENP-B antibody  abcam ab25734 Rabbit polyclonal antibody; dilution ratio of 1:200 (IIF, methanol/acetone fixation)-1:400 (IIF, paraformaldehyde fixation)
Anti-centromere antibody (ACA) Fitzgerald Industries International, Inc. 90C-CS1058 Human centromere antiserum; dilution ratio of 1:2000 (IIF)
Anti-CENP-H antibody Bethyl Laboratories BL1112 (A400-007A) Rabbit polyclonal antibody; dilution ratio of 1:200 (IIF)
Anti-CENP-H antibody BD 612142 Mouse monoclonal antibody; dilution ratio of 1:200 (IIF)
Anti-CENP-I antibody N/A, Dr. Katusmi Kitagawa N/A, Dr. Katusmi Kitagawa Rabbit polyclonal antibody; dilution ratio of 1:1000 (IIF); Niikura et al., Oncogene, 4133-4146 (2006)
Anti-KNL1 antibody Novus Biologicals NBP1-89223 Rabbit polyclonal antibody; dilution ratio of 1:100 (IIF)
Anti-Hec1 antibody Novus Biologicals / GeneTex NB 100-338 / GTX70268 Mouse monoclonal antibody; dilution ratio of 1:100 (IIF)
Anti-Hec1 antibody GeneTex GTX110735 Rabbit polyclonal antibody; dilution ratio of 1:100 (IIF)
Anti-Ska1 antibody abcam ab46826 Rabbit polyclonal antibody; dilution ratio of 1:100 (IIF)
Anti-Flag antibody SIGMA-ALDRICH F3165 Mouse monoclonal antibody; dilution ratio of 1:1000 (IIF), 1:5000 (WB)
Anti-Flag antibody SIGMA-ALDRICH F7425 Rabbit polyclonal antibody; dilution ratio of 1:1000 (IIF), 1:5000 (WB)
Anti-CUL4A antibody N/A, Dr. Pradip Raychaudhuri N/A, Dr. Pradip Raychaudhuri Rabbit polyclonal antibody; dilution ratio of 1:3000 (WB); Shiyanov et al., The Journal of biological chemistry, 35309-35312 (1999)
Anti-RBX1 antibody Cell Signaling 4397 Rabbit polyclonal antibody; dilution ratio of 1:2000 (WB)
Anti-GAPDH antibody Chemicon MAB374 Mouse monoclonal antibody; dilution ratio of 1:5000 (WB)
Alexa Fluor 488 Goat Anti-Mouse IgG Life Technologies/Invitrogen A11001 fluorophore-conjugated secondary antibody (Affinity-purified secondary antibody)
Alexa Fluor 594 Goat Anti-Mouse IgG Life Technologies/Invitrogen A11005 fluorophore-conjugated secondary antibody (Affinity-purified secondary antibody)
Alexa Fluor 488 Goat Anti-Rabbit IgG Life Technologies/Invitrogen A11008 fluorophore-conjugated secondary antibody (Affinity-purified secondary antibody)
Alexa Fluor 594 Goat Anti-Rabbit IgG Life Technologies/Invitrogen A11012 fluorophore-conjugated secondary antibody (Affinity-purified secondary antibody)
Non fat powdered milk (approved substitution for carnation powdered milk) Fisher Scientific NC9255871 (Reorder No. 190915; Lot# 90629) Skim milk
Leica DM IRE2 motorized fluorescence microscope  Leica motorized fluorescence microscope 
HCX PL APO 63x oil immersion lens Leica LEICA HCX PL APO NA 1.40 OIL PH 3 CS 63X oil immersion lens
HCX PL APO 100x oil immersion lens Leica LEICA HCX PL APO NA 1.40 OIL PHE 100X oil immersion lens
Leica EL6000 compact light source Leica External compact light source for fluorescent excitation
ORCA-R2 Digital CCD camera  Hamamatsu C10600-10B digital CCD camera 
Openlab version 5.5.2 Scientific Imaging Software  Perkin Elmer/Improvision For image observation, acquisition, quantification, and analysis
Velocity version 6.1.1 3D Image Analysis Software  Perkin Elmer/Improvision For image observation, acquisition, quantification, and analysis
Complete EDTA-free protease inhibitor cocktail Roche 11873580001/11836170001 Protease inhibitor cocktail tablets
PlusOne 2-D Quant Kit Amersham Biosciences 80-6483-56 Commercial protein assay reagent I for measurement of protein concentration (compatible with 2% SDS)
Bio-Rad Protein Assay Bio-Rad 500-0006 Commercial protein assay reagent II for measurement of protein concentration (compatible with 0.1% SDS)
Immobilon-FL EMD Millipore IPFL00010 PVDF membrane for transferring
IRDye 800CW Goat Anti-Mouse IgG LI-COR Biosciences 926-32210 IR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:20000 (IIF)
IRDye 680 Goat Anti-Rabbit IgG LI-COR Biosciences 926-32221 IR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:20000 (IIF)
Goat anti-Mouse IgG DyLight 549 Fisher Scientific PI35507 DyLight-conjugated secondary antibodyIR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:20000 (IIF)
Goat anti-Rabbit DyLight 649 Fisher Scientific PI35565 DyLight-conjugated secondary antibodyIR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:20000 (IIF)
Goat anti-mouse IgG-HRP Santa Cruz SC-2005 HRP-conjugated secondary antibodyDyLight-conjugated secondary antibodyIR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:10000 (IIF)
Goat anti-rabbit IgG-HRP Santa Cruz SC-2004 HRP-conjugated secondary antibodyDyLight-conjugated secondary antibodyIR fluorescent dye-conjugated secondary antibody (Affinity-purified secondary antibody); dilution ratio of 1:10000 (IIF)
Openlab version 5.5.2. Scientific Imaging Software  Improvision/PerkinElmer Software A
Volocity version 6.3 3D Image Analysis Software (Volocity Acquisition) PerkinElmer Software B1
Volocity version 6.3 3D Image Analysis Software (Volocity Quantification) PerkinElmer Software B2
Branson SONIFIER 450 Sonicator
Branson Ultrasonics sonicator Microtip Step, Solid, Threaded 9.5 mm VWR Scientific Products Inc.  33995-325 Disruptor horn for sonication
Branson Ultrasonics sonicator Microtip Tapered 6.5 mm VWR Scientific Products Inc.  33996-185 Microtip for sonication
Odyssey CLx Infrared imaging System  LI-COR Biosciences Infrared imaging system for immunoblot detection
Image Studio Analysis Software Ver 4.0  LI-COR Biosciences Software C
Molecular Imager Versadoc MP4000 System  Bio-Rad Chemiluminescence imager for immunoblot detection
Quantity One 1-D analysis software  Bio-Rad Software D
SuperSignal West Femto Maximum Sensitivity Substrate Thermo 34095 Ultra-sensitive enhanced chemiluminescent (ECL) substrate

DOWNLOAD MATERIALS LIST

References

  1. DeLuca, J. G., et al. Hec1 and nuf2 are core components of the kinetochore outer plate essential for organizing microtubule attachment sites. Molecular biology of the cell. 16, 519-531 (2005).
  2. Earnshaw, W. C., Halligan, N., Cooke, C., Rothfield, N. The kinetochore is part of the metaphase chromosome scaffold. J Cell Biol. 98, 352-357 (1984).
  3. Hoffman, D. B., Pearson, C. G., Yen, T. J., Howell, B. J., Salmon, E. D. Microtubule-dependent changes in assembly of microtubule motor proteins and mitotic spindle checkpoint proteins at PtK1 kinetochores. Molecular biology of the cell. 12, 1995-2009 (2001).
  4. Regnier, V., et al. CENP-A is required for accurate chromosome segregation and sustained kinetochore association of BubR1. Mol Cell Biol. 25, 3967-3981 (2005).
  5. Bernad, R., Sanchez, P., Losada, A. Epigenetic specification of centromeres by CENP-A. Exp Cell Res. 315, 3233-3241 (2009).
  6. Black, B. E., Cleveland, D. W. Epigenetic centromere propagation and the nature of CENP-a nucleosomes. Cell. 144, 471-479 (2011).
  7. Warburton, P. E., et al. Immunolocalization of CENP-A suggests a distinct nucleosome structure at the inner kinetochore plate of active centromeres. Curr Biol. 7, 901-904 (1997).
  8. Karpen, G. H., Allshire, R. C. The case for epigenetic effects on centromere identity and function. Trends Genet. 13, 489-496 (1997).
  9. Black, B. E., et al. Structural determinants for generating centromeric chromatin. Nature. 430, 578-582 (2004).
  10. Black, B. E., et al. Centromere identity maintained by nucleosomes assembled with histone H3 containing the CENP-A targeting domain. Mol Cell. 25, 309-322 (2007).
  11. Fachinetti, D., et al. A two-step mechanism for epigenetic specification of centromere identity and function. Nat Cell Biol. 15, 1056-1066 (2013).
  12. Zeitlin, S. G., Shelby, R. D., Sullivan, K. F. CENP-A is phosphorylated by Aurora B kinase and plays an unexpected role in completion of cytokinesis. The Journal of cell biology. 155, 1147-1157 (2001).
  13. Zhang, X., Li, X., Marshall, J. B., Zhong, C. X., Dawe, R. K. Phosphoserines on maize CENTROMERIC HISTONE H3 and histone H3 demarcate the centromere and pericentromere during chromosome segregation. The Plant cell. 17, 572-583 (2005).
  14. Goutte-Gattat, D., et al. Phosphorylation of the CENP-A amino-terminus in mitotic centromeric chromatin is required for kinetochore function. Proc Natl Acad Sci U S A. 110, 8579-8584 (2013).
  15. Bailey, A. O., et al. Posttranslational modification of CENP-A influences the conformation of centromeric chromatin. Proc Natl Acad Sci U S A. 110, 11827-11832 (2013).
  16. Samel, A., Cuomo, A., Bonaldi, T., Ehrenhofer-Murray, A. E. Methylation of CenH3 arginine 37 regulates kinetochore integrity and chromosome segregation. Proc Natl Acad Sci U S A. 109, 9029-9034 (2012).
  17. Niikura, Y., et al. CENP-A K124 Ubiquitylation Is Required for CENP-A Deposition at the Centromere. Dev Cell. (2015).
  18. Chan, G. K., Liu, S. T., Yen, T. J. Kinetochore structure and function. Trends in cell biology. 15, 589-598 (2005).
  19. Hori, T., Okada, M., Maenaka, K., Fukagawa, T. CENP-O class proteins form a stable complex and are required for proper kinetochore function. Molecular biology of the cell. 19, 843-854 (2008).
  20. Fukagawa, T., Earnshaw, W. C. The centromere: chromatin foundation for the kinetochore machinery. Developmental cell. 30, 496-508 (2014).
  21. Kedersha, N. The Proteintech Blog.Proteintech. Grainger, D. Proteintech Group. (2012).
  22. Clontech Laboratories, Inc. HeLa Tet-Off Advanced Cell Line. Available from: http://www.clontech.com/CR/Products/Inducible_Systems/Tetracycline-Inducible_Expression/ibcGetAttachment.jsp?cItemId=26908&fileId=6712191&sitex=10020:22372:US (2012).
  23. Meraldi, P., Sorger, P. K. A dual role for Bub1 in the spindle checkpoint and chromosome congression. EMBO J. 24, 1621-1633 (2005).
  24. Niikura, Y., et al. 17-AAG, an Hsp90 inhibitor, causes kinetochore defects: a novel mechanism by which 17-AAG inhibits cell proliferation. Oncogene. 25, 4133-4146 (2006).
  25. Yang, Z., et al. Silencing mitosin induces misaligned chromosomes, premature chromosome decondensation before anaphase onset, and mitotic cell death. Mol Cell Biol. 25, 4062-4074 (2005).
  26. Wang, H., et al. Histone H3 and H4 ubiquitylation by the CUL4-DDB-ROC1 ubiquitin ligase facilitates cellular response to DNA damage. Mol Cell. 22, 383-394 (2006).
  27. Lamb, J. R., Tugendreich, S., Hieter, P. Tetratrico peptide repeat interactions: to TPR or not to TPR? Trends Biochem Sci. 20, 257-259 (1995).
  28. Kitagawa, K., Skowyra, D., Elledge, S. J., Harper, J. W., Hieter, P. SGT1 encodes an essential component of the yeast kinetochore assembly pathway and a novel subunit of the SCF ubiquitin ligase complex. Mol Cell. 4, 21-33 (1999).
  29. Niikura, Y., Dixit, A., Scott, R., Perkins, G., Kitagawa, K. BUB1 mediation of caspase-independent mitotic death determines cell fate. J Cell Biol. 178, 283-296 (2007).
  30. Niikura, Y., Kitagawa, K. Identification of a novel splice variant: human SGT1B (SUGT1B). DNA Seq. 14, 436-441 (2003).
  31. Niikura, Y., Ogi, H., Kikuchi, K., Kitagawa, K. BUB3 that dissociates from BUB1 activates caspase-independent mitotic death (CIMD). Cell Death Differ. 17, 1011-1024 (2010).
  32. Ando, S., Yang, H., Nozaki, N., Okazaki, T., Yoda, K. CENP-A, -B, and -C chromatin complex that contains the I-type alpha-satellite array constitutes the prekinetochore in HeLa cells. Mol Cell Biol. 22, 2229-2241 (2002).
  33. Izuta, H., et al. Comprehensive analysis of the ICEN (Interphase Centromere Complex) components enriched in the CENP-A chromatin of human cells. Genes to cells : devoted to molecular & cellular mechanisms. 11, 673-684 (2006).
  34. Obuse, C., et al. Proteomics analysis of the centromere complex from HeLa interphase cells: UV-damaged DNA binding protein 1 (DDB-1) is a component of the CEN-complex, while BMI-1 is transiently co-localized with the centromeric region in interphase. Genes Cells. 9, 105-120 (2004).
  35. Merlet, J., Burger, J., Gomes, J. E., Pintard, L. Regulation of cullin-RING E3 ubiquitin-ligases by neddylation and dimerization. Cell Mol Life Sci. 66, 1924-1938 (2009).
  36. Bennett, E. J., Rush, J., Gygi, S. P., Harper, J. W. Dynamics of cullin-RING ubiquitin ligase network revealed by systematic quantitative proteomics. Cell. 143, 951-965 (2010).
  37. Antonelli, A., et al. Efficient inhibition of macrophage TNF-alpha production upon targeted delivery of K48R ubiquitin. Br J Haematol. 104, 475-481 (1999).
  38. Codomo, C. A., Furuyama, T., Henikoff, S. CENP-A octamers do not confer a reduction in nucleosome height by AFM. Nat Struct Mol Biol. 21, 4-5 (2014).
  39. Thrower, J. S., Hoffman, L., Rechsteiner, M., Pickart, C. M. Recognition of the polyubiquitin proteolytic signal. The EMBO journal. 19, 94-102 (2000).
  40. Yoda, K., et al. Human centromere protein A (CENP-A) can replace histone H3 in nucleosome reconstitution in vitro. Proc Natl Acad Sci U S A. 97, 7266-7271 (2000).
  41. Shelby, R. D., Vafa, O., Sullivan, K. F. Assembly of CENP-A into centromeric chromatin requires a cooperative array of nucleosomal DNA contact sites. J Cell Biol. 136, 501-513 (1997).
  42. Majumder, S., Fisk, H. A. Quantitative immunofluorescence assay to measure the variation in protein levels at centrosomes. J Vis Exp. (2014).
  43. Masumoto, H., Masukata, H., Muro, Y., Nozaki, N., Okazaki, T. A human centromere antigen (CENP-B) interacts with a short specific sequence in alphoid DNA, a human centromeric satellite. J Cell Biol. 109, 1963-1973 (1989).
  44. Yoda, K., Kitagawa, K., Masumoto, H., Muro, Y., Okazaki, T. A human centromere protein, CENP-B, has a DNA binding domain containing four potential alpha helices at the NH2 terminus, which is separable from dimerizing activity. J Cell Biol. 119, 1413-1427 (1992).
  45. Sugata, N., et al. Human CENP-H multimers colocalize with CENP-A and CENP-C at active centromere--kinetochore complexes. Hum Mol Genet. 9, 2919-2926 (2000).
  46. Earnshaw, W. C., Ratrie, H. 3rd, Stetten, G. Visualization of centromere proteins CENP-B and CENP-C on a stable dicentric chromosome in cytological spreads. Chromosoma. 98, 1-12 (1989).
  47. Goshima, G., Kiyomitsu, T., Yoda, K., Yanagida, M. Human centromere chromatin protein hMis12, essential for equal segregation, is independent of CENP-A loading pathway. J Cell Biol. 160, 25-39 (2003).
  48. Liu, S. T., Rattner, J. B., Jablonski, S. A., Yen, T. J. Mapping the assembly pathways that specify formation of the trilaminar kinetochore plates in human cells. J Cell Biol. 175, 41-53 (2006).
  49. Gascoigne, K. E., Cheeseman, I. M. T time for point centromeres. Nat Cell Biol. 14, 559-561 (2012).
  50. Gascoigne, K. E., et al. Induced ectopic kinetochore assembly bypasses the requirement for CENP-A nucleosomes. Cell. 145, 410-422 (2011).
  51. Nishino, T., et al. CENP-T provides a structural platform for outer kinetochore assembly. EMBO J. 32, 424-436 (2013).
  52. Malvezzi, F., et al. A structural basis for kinetochore recruitment of the Ndc80 complex via two distinct centromere receptors. EMBO J. 32, 409-423 (2013).
  53. Schleiffer, A., et al. CENP-T proteins are conserved centromere receptors of the Ndc80 complex. Nat Cell Biol. 14, 604-613 (2012).
  54. Rago, F., Gascoigne, K. E., Cheeseman, I. M. Distinct organization and regulation of the outer kinetochore KMN network downstream of CENP-C and CENP-T. Curr Biol. 25, 671-677 (2015).
  55. Nishino, T., et al. CENP-T-W-S-X forms a unique centromeric chromatin structure with a histone-like fold. Cell. 148, 487-501 (2012).
  56. Bodor, D. L., et al. The quantitative architecture of centromeric chromatin. Elife. 3, e02137 (2014).
  57. Oliver, C. Ch 58. Molecular Biomethods Handbook. Rapely, R., Walker, J. M. Humana Press. 1063-1079 (2008).
  58. Terasima, T., Tolmach, L. J. Changes in x-ray sensitivity of HeLa cells during the division cycle. Nature. 190, 1210-1211 (1961).
  59. Levenson, G. B. R. Ch 8. Biomedical Photonics Handbook. Vo-Dinh, T. uan CRC Press LLC. 8-19 (2003).
  60. Sanderson, J. Fluorescence bleed-though. Available from: http://www.gum2012.fionastoreydesign.co.uk/Downloads/Bleed through text.pdf (2011).
내생의 면역 형광 분석 및 외인성 센트로 - 동원체 단백질
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Niikura, Y., Kitagawa, K. Immunofluorescence Analysis of Endogenous and Exogenous Centromere-kinetochore Proteins. J. Vis. Exp. (109), e53732, doi:10.3791/53732 (2016).More

Niikura, Y., Kitagawa, K. Immunofluorescence Analysis of Endogenous and Exogenous Centromere-kinetochore Proteins. J. Vis. Exp. (109), e53732, doi:10.3791/53732 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter