Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Bioengineering

Rapid Patterning sottrattiva di strati cellulare dal vivo con una sonda Microfluidic

Published: September 15, 2016 doi: 10.3791/54447

Abstract

La sonda microfluidica (MFP) facilita l'esecuzione di chimica locale su substrati biologici confinando volumi nanolitri di liquidi. Utilizzando uno particolare implementazione della MFP, gerarchico idrodinamico confinamento flusso (hHFC), più liquidi vengono contemporaneamente portati in contatto con un substrato. azione chimica locale e la sagomatura del liquido utilizzando il hHFC, viene sfruttata per creare modelli cellulari da lisi a livello locale e rimuovere le cellule. Utilizzando la capacità di scansione del MFP, vengono creati i modelli definiti dall'utente su monostrati di cellule. Questo protocollo consente un rapido, in tempo reale e patterning cellulare spazialmente controllata, che può permettere selettivo cellula-cellula e cellula-matrice studi di interazione.

Introduction

Nel loro ambiente nativo, le cellule nei tessuti biologici percepiscono una serie di segnali biochimici e fisici che dirigono la loro crescita, l'organizzazione e lo sviluppo. La comprensione di questi segnali richiede un esame selettivo delle interazioni cellula-cellula e cellula-matrice. Questo richiede lo sviluppo di metodi per monostrati cellulari patterning. Metodi per tipi di cellule diverse geometricamente separati nella cultura (patterning) consentono ampi studi di segnali chimici e fisici in biologia cellulare. La maggior parte degli attuali approcci per strati di cellule patterning 1-4 dipendono da depositare proteine ​​di adesione cellulare su superfici o utilizzando stampini microfabbricate per la crescita selettiva su substrati. Al contrario, qui vi presentiamo un metodo per rapidamente monostrati cellulari modello in situ, cioè cellule in coltura, eliminando le cellule in regioni selezionate del monostrato. I metodi che eseguono tale sottrattivo patterning 5-9 usually richiedono substrati specializzati, il trattamento delle superfici, operazione complessa, di contatto fisico o ablazione utilizzando un laser, involontariamente colpisce le cellule vive. Noi qui utilizziamo una sonda microfluidica (MFP) 10,11, un non-contatto di scansione tecnologia microfluidica che limita idrodinamico un liquido su un substrato. Una componente importante della MFP è la testa microfabbricazione contenente microcanali (Figura 1). La piattaforma associata consiste di pompe a siringa per il controllo del liquido, le fasi per la scansione di controllo e un microscopio invertito per la visualizzazione e feedback (Figura 2). Nella sua configurazione di base, la testa MFP comprende due microcanali con aperture all'apice, uno per iniettare un liquido trattamento e l'altro per l'aspirazione del liquido di lavorazione iniettato insieme ad un liquido di immersione (Figura 3A). Durante il funzionamento MFP, l'apice è ad una distanza fissa dal substrato. Quando la portata di aspirazione (Qa) è sufficiente superiore al tasso di flusso di iniezione (Q i), cioè, Q a: Q i ≥ 2.5, il liquido di elaborazione è confinata sul substrato. Questo si traduce in un confinamento flusso idrodinamico (HFC). La regione in cui il liquido di lavorazione è a diretto contatto con il substrato viene definito l'impronta. Per le condizioni tipiche di funzionamento, il flusso del liquido trasformazione nella HFC è caratterizzata da un basso numero di Reynolds (Re ≈ 10 -2) e un numero elevato Péclet (Pe ≈ 10 2). Ciò implica flussi liquidi in regime laminare con convezione essendo la principale modalità di trasferimento di massa di specie chimiche. I modelli numerici e analitici per il confinamento del flusso sono descritte altrove 12 - 14.

In questo lavoro, si usa il metodo di confinare contemporaneamente più liquidi di lavorazione, che si chiama HFC gerarchico (hHFC) 14. Per implementare hHFC con la MFP, due additional aperture sono necessari per fornire una sorgente secondaria di iniezione e aspirazione. Questo ci permette di confinare un liquido all'interno di un secondo liquido. Gli interni benefici (trasformazione) liquidi vengano protetti da detriti vaganti sul substrato dal (schermatura) liquido esterno. Inoltre, hHFC permette il funzionamento in due modi: (i) la modalità nested, in cui il liquido di elaborazione nei contatti HFC interne della superficie (Figura 3B), e (ii) il modo pizzicato, in cui il liquido interno perde contatto e solo il liquido esterno è in contatto con il substrato (Figura 3C). La commutazione tra le due modalità permette agli utenti di effettuare o interrompere l'elaborazione del substrato e si ottiene controllando la testina-superficie o cambiando il rapporto tra i flussi di iniezione (Q i2 / Q i1). Per una data geometria del canale, l'impronta del liquido di elaborazione sul substrato può essere controllata modulando condizioni di flusso (Figura 3D). hydr sodioossido (NaOH) è usato come liquido di elaborazione interna per lisare le cellule, e il lisato viene continuamente aspirato dalla superficie. Poiché gli effetti chimiche del liquido di elaborazione sono localizzati al footprint HFC interna, le celle adiacenti restano imperturbato, che consente studi spazio-temporali delle interazioni cellula-cellula. La funzionalità di scansione della MFP permette la creazione di geometrie definite dall'utente di modelli cellulari (Figura 4). Inoltre, la scelta di NaOH come liquido di elaborazione accoglie analisi del DNA a valle (Figura 7).

Protocol

1. MFP Capo e Piattaforma pulizia e la preparazione

NOTA: Questo protocollo utilizza verticalmente orientata ibrido al silicio-vetro MFP dirige 15,16. La componente di silicio della testa contiene i microcanali, che sono inciso ad una profondità di 100 micron. Il silicio attaccato viene incollata al vetro utilizzando bonding anodico. Il design canale comprende un modello composto da sei canali, due ciascuno per iniezione e aspirazione, e due per l'iniezione del liquido di immersione (Figura 1). I canali utilizzati per l'iniezione di liquido di immersione ricostituire i mezzi di comunicazione che circonda il campione biologico, evitando così perdite a causa di aspirazione ed evaporazione. I canali interni e canali esterni utilizzati nei lavori in corso sono 100 × 100 micron e 200 × 100 micron rispettivamente. fabbricazione Post e di trasformazione, le teste MFP con canali chiari e apici lucido si ottengono.

  1. Preparazione della stazione di pompaggio e dei fluidiapparato
    1. Utilizzare capillari con 1/16 '' (1,59 mm) di diametro esterno e 0,02 '' (0,51 mm) di diametro interno per tutti i tubi collegati alle siringhe. Variare dimensioni capillare basato sull'applicazione e ottenere i connettori e raccordi appropriati per interfacciare la testa MFP con le siringhe. Utilizzare acqua ultrapura ovunque siano necessarie diluizioni.
    2. siringhe pulite (250 - 500 volumi mL) e siringhe stantuffi di ultrasuoni in soluzione di candeggina 0,5% in acqua ultrapura prima to e post esperimenti sulle cellule vive. Sciacquare abbondantemente con acqua. Riempire con acqua immergendo le loro punte completamente in un bagno d'acqua ed aspirando con lo stantuffo. Eliminare il liquido, mentre nel bagno d'acqua con l'albero siringa contattare la guarnizione all'uscita della siringa. Ripetere aspirare e di spurgo fino a quando non bolle d'aria si vedono nelle colonne siringa.
    3. Collegare riempite le pompe a siringa con connettori Luer-Lock. Utilizzare una valvola interruttore montato sullapompe per dirigere il liquido dalla siringa ad uno dei due capillari che portano sia alla testa MFP o ai serbatoi di liquido (Figura 6). (Se non valvola di commutazione è disponibile vedere la sezione 1.4.4). Eliminare entrambi i capillari con acqua dalle siringhe ad una portata di circa 10 - 50 microlitri / min, a seconda delle dimensioni della siringa fino a circa 10 ml di acqua viene lasciata nelle siringhe.
    4. Pre-inserire i capillari eliminati in un apposito microfluidica connettore / adattatore che si interfaccia con le vias canale nella testa (ad esempio, il connettore M1 - vedi Materiali).
  2. Preparazione testa MFP
    1. Pulire la testa MFP mediante ultrasuoni utilizzando un detergente per la pulizia vetreria standard o 0,5% di candeggina per la pulizia rigorosa, per 5 min. Eliminare canali con acqua immergendo l'apice in acqua e applicando vuoto per le vias.
    2. Controllare i canali allo stereomicroscopio per i potenziali ostacoli (intasamento) e retorba il passaggio precedente, se necessario.
    3. Montare la testa pulita sul supporto testa e avvitare il connettore con il tubo pre-inserito e purgato sulla testa. Avvitare il supporto della testina al Z-fase, che viene utilizzato per il controllo della distanza gap tra la testa e il monostrato cellulare.
  3. Calibrazione le fasi di scansione della piattaforma MFP
    1. Eseguire la calibrazione punto finale della X, Y e Z fasi prima di collegare il capo alla piattaforma, secondo il protocollo del produttore con un'interfaccia software appropriato. stadi calibrati garantire la precisione nel posizionamento della testa MFP.
    2. Ottenere un grezzo distanza gap zero (azzeramento) portando la testa MFP su un vetrino da camera, senza cellule e scendere lentamente a 5 micron passi. A contatto con il substrato della sonda, devono essere osservate anelli di Newton. Questa è una stima approssimativa. Una posizione esatta deve essere ottenuto dopo la regolazione complanarità dell'apice sonda al substrate.
    3. Per garantire complanarità dell'apice della sonda, regolare l'inclinazione della testa utilizzando un goniometro (all'interfaccia della testa e la fase Z). Quando formata affinché anelli di Newton sono simmetriche (Figura 1). Spostare il micron MFP testa 20 di distanza dal substrato e regolare l'inclinazione con il goniometro. Repeat scendere, l'azzeramento e la regolazione dell'inclinazione fino anelli di Newton sono simmetriche a contatto. Con inclinazione regolabile, impostare la posizione z che produce anelli di Newton simmetrici come zero.
      NOTA: Il Z-fase controlla la distanza testa-a-substrato, mentre lo stadio XY controlla la scansione del substrato (Figura 2). Una spiegazione dettagliata si trova nel nostro precedente lavoro 14.
  4. Preparati chimici per la rimozione di strati di cellule locali
    Attenzione: Dove (ad esempio, guanti di nitrile, occhiali di sicurezza) per le sostanze chimiche in fase di preparazione del caso, dotazioni di sicurezza uso. Utilizzare un hoo fumid se necessario per la preparazione di soluzioni. Preparare tutte le sostanze chimiche e buffer con acqua ultrapura come diluente.
    1. Preparare 50 mM soluzione di NaOH come liquido di trasformazione per il canale di iniezione interna (i2 con portata Q I2 in Figura 1).
    2. Preparare la soluzione tampone di estrazione richiesto per l'iniezione esterna (i1 con portata Q I1 in figura 1), composto di 1 mM di acido etilendiamminotetraacetico (EDTA), 0,5% Tween 20 e 10 pM rodamina B in 50 mM Tris (idrossimetil) amminometano a pH 8. Per lo spurgo, utilizzare acqua nelle siringhe di aspirazione.
    3. Filtrare tutte le soluzioni che utilizzano un filtro siringa da 0,2 micron. Degas tutte le soluzioni filtrati utilizzando un essiccatore fino alla fermata aria disciolta gorgogliare in superficie.
    4. Utilizzando la linea di drenaggio collegata alle pompe a siringa, spurgare l'acqua rimanente e aspirare le soluzioni degassati nelle siringhe a 40 microlitri / min fino a che le siringhe sono pieni (250 o 500 microlitri).Questo assicura riempimento senza bolle delle siringhe, connettori e capillari. Il sistema di valvole a due capillare siringa-switch permette riempimento del siringhe metà esperimento. In assenza di una tale valvola interruttore, scollegare i capillari dalla testa e riempire i capillari e la siringa aspirando soluzioni degassato prima ricollegarli alla testa.
    5. Aspirare il trattamento e schermatura liquidi attraverso i capillari consente l'utilizzo di piccoli volumi durante il funzionamento. Se le sostanze chimiche possono essere preparati in grandi volumi, riempire siringhe con le soluzioni richieste direttamente. Ad esempio, le siringhe aspirazione contenenti acqua possono essere riempiti con questo approccio.
    6. Eliminare i capillari alla testa MFP con i liquidi assegnati per ciascun canale, come definito in 1.4.1 e 1.4.2.
      NOTA: La soluzione tampone di estrazione protegge il NaOH in confinamento interna e la componente rodamina nel buffer facilita la visualizzazione dei thuna e hHFC durante il funzionamento.
    7. Se le cellule sono over-confluenti, con aggregati di cellule che appaiono sulla superficie colta, integrare il tampone di estrazione con il 10% proteinasi K. Ciò integra l'azione di NaOH su tali aggregati sciogliendo proteine ​​denaturate il lisato entra nei canali di aspirazione. Questo impedisce l'intasamento dei canali durante il funzionamento.
  5. Preparazione di monostrati di cellule su vetrini da camera
    Attenzione: utilizzare una cappa di coltura cellulare per la coltura delle cellule e gestire apparati come da regolamenti stabiliti dal responsabile della biosicurezza del laboratorio. Nota particolari esigenze di linee cellulari specifici e adattare il protocollo e le attrezzature di conseguenza.
    1. Incubatori di coltura cellulare Usa (al 5% di CO 2 e a 37 ° C) per la cultura e l'espansione delle cellule da modellati. Eseguire l'espansione utilizzando protocolli standard di coltura cellulare 17,18 in fiasche T. Utilizzare mezzi di coltura secondo i requisiti del cel specifical la linea (ad esempio, siero e antibiotici integrati per la coltura DMEM MCF7 e MDAMB 231).
    2. Giunti confluenza cellulare nelle fiasche di coltura, trypsinize e raccogliere le cellule e sementi 2 × 10 5 cellule / cm 2 in ciascuna delle slitte 2-camera per patterning e cultura oltre 48 ore. Utilizzare le cellule in una delle camere come controllo per la crescita cellulare e la vitalità.
    3. Raggiunto confluenza delle cellule su vetrini da camera, incubare le cellule per 45 minuti con 500 soluzione colorante cellule inseguitore microlitri (ad esempio, verde - CMFDA o arancione - CMRA) ad una concentrazione 10 mM preparata in terreno privo di siero. Questo viene fatto per la visualizzazione delle cellule durante patterning. Lavare le cellule etichettate con PBS delicatamente vampate ciascuna camera con una pipetta, e, successivamente, della cultura le cellule in mezzi di siero-integrato per gli esperimenti patterning.
    4. Ottenere un immagine di riferimento della superficie cellulare delle cellule-inseguitore macchiate ai fini del conteggio delle cellule. Questo viene fatto per garantireconfluenza dello strato di cellule. Inoltre, serve come aiuto per gli esperimenti di quantificazione se il recupero del campione e l'analisi del DNA sono obiettivi.
      NOTA: Nel caso in cui la vitalità delle cellule deve essere valutato durante patterning, le cellule possono essere colorati con un / kit di citotossicità morti vivono in conformità alle istruzioni del produttore.

2. Creazione del Hierarchical idrodinamico flusso confinamento (hHFC)

  1. Spostare il MFP sul monostrato cellulare ad una distanza gap di 50 um dal vetrino. Questa distanza lacuna, garantendo nel contempo il contatto del hHFC conti anche per la superficie monostrato e variazione di spessore.
  2. Iniettare NaOH a 6 o 8 ml / min attraverso i2. Valutare altre portate (cioè, Q I1, Q A1 e A2 Q) utilizzando le regole di flusso di figura 3.
  3. Modulare la dimensione del HFC interna cambiando il rapporto Q I2 / Q I1 base alle siringhe per iniezione.Ad esempio, utilizzare un Q I1 tra 1,3 microlitri / min e 4 microlitri / min, con la Q I2 fissato a 8 microlitri / min, che si traduce in un ingombro NaOH di 150 - 300 cellule (100 - 200 micron 2 / cell) ( Figura 3D).
  4. Iniettare mezzo completo dalle più esterni aperture sulla testa MFP a una portata di 20 microlitri / min per spiegare evaporazione dei media e aspirazione durante il funzionamento del hHFC.

3. monostrati cellulari patterning Uso hHFC

Nota: Il modello di scansione determina le aree del monostrato cellulare dove si estraggono le cellule (patterning sottrattiva), lasciando le cellule rimanenti per studiare questioni biologiche specifiche. Questo modello può essere linee rette o una matrice di punti, per esempio. modelli complessi richiedono la progettazione di un adatto traiettoria di scansione. Ad esempio, una scansione traiettoria scacchi fornisce una griglia di aree di celle (mostrato ad esempio in figura 4A

  1. Impostare il software fase per la scansione della sonda sul monostrato cellulare in modelli definiti dall'utente testa (modificando X, Y e Z) ad una velocità di scansione di 10 micron / s ad una distanza gap di 50 micron.
  2. Con l'nidificata hHFC in funzione e in contatto con il monostrato, la scansione della MFP con traiettoria del modello desiderato per effettuare la rimozione delle cellule modellata.
  3. Per una co-coltura dopo il primo ritiro tipo di cellula, seminare una linea cellulare diverso per colmare le lacune, utilizzando i metodi descritti nella sezione 1.5. Spostare tra le modalità annidati e pizzicato (aumentando la distanza divario, per esempio) per controllare la rimozione delle cellule.
    NOTA: La velocità di scansione può avere essere dell'inchiestagated per altre linee cellulari. La velocità di scansione utilizzato in questa rimozione completa delle cellule effetti dimostrativi sulle regioni digitalizzati per linee cellulari.

4. lavorazione a valle per il campionamento e il DNA Amplificazione

  1. Preparare la stazione di campionamento per l'analisi a valle del lisato. Per la stazione di campionamento, utilizzare un 3D stampato a 8-striscia portaprovette PCR. In alternativa, scegliere una portatubi appropriata per servire come questo adattatore, che può essere montato entro l'intervallo di scansione della testa fuori dal substrato. Pulire il portaprovette con il 70% di etanolo o altri decontaminanti superficiali basate sulla stringenza desiderato per l'applicazione. Utilizzare una clip magnetica sul supporto tubo per fissarlo sul supporto substrato.
  2. Dopo aver preparato la stazione di campionamento, posizionare la stampante multifunzione testa 100 micron dal monostrato. Iniziare funzionamento del hHFC con 50 mM soluzione di NaOH come liquido di trasformazione per il canale di iniezione interna con portate di 1, 6, -7 E -17,5 microlitri / min per Q I1, I2 Q, Q e Q A1 A2 rispettivamente.
    1. Una volta che il confinamento flusso è stabilizzata (in circa 10 sec), scendere la testa della sonda ad una distanza gap di 50 micron per eseguire basato NaOH lisi locale della sotto-popolazione scelto di celle con la hHFC. Una volta che la lisi del sub-popolazione è completa (circa 30 secondi per ogni impronta), orientare la testa verso i tubi nella stazione di campionamento. Espellere il lisato raccolti nelle provette per PCR direttamente (Figura 6).
  3. Per l'elaborazione a valle del lisato, prima neutralizzare il pH della soluzione miscelando il lisato con tampone Tris (1: 1). Dopo la neutralizzazione, riscaldare il lisato a 95 ° C per 30 min. Quindi caricare direttamente il lisato in un flusso di lavoro standard di qPCR come previsto dal fornitore dello strumento.

Representative Results

Il protocollo descritto per la rapida patterning sottrattiva di monostrati cellulari è dimostrata utilizzando una piattaforma multi componente MFP (figure 1 e 2). Il protocollo impiega gerarchico confinamento flusso idrodinamico (hHFC; la figura 3) da trattare e rimuovere le cellule da monostrati di cellule, usando NaOH come liquido di elaborazione locale. La configurazione hHFC comprende un HFC interna ed una esterna HFC. Il NaOH confinato nel hHFC interna introduce azione chimica e taglio sulle cellule a contatto. All'interno di questo ingombro, le cellule sono omogeneamente esposte all'azione chimica di NaOH, a causa di trasferimento di massa di convezione guidato all'interno e con diffusione trascurabile alla regione di fuori del contenimento. Il taglio sulle cellule d'altra parte, può essere modificata variando la portata di NaOH. Per semplificare parametri operativi, abbiamo scelto di rendere l'azione chimica il meccanismo dominante di rimozione delle cellule rispetto alla cesoia. Astimare la forza di taglio applicata dal hHFC sulla superficie, un modello ad elementi finiti è stato costruito utilizzando Comsol Multiphysics 5.0. Le simulazioni sono state condotte utilizzando il modulo CFD per flussi laminari. Due condizioni limite di ingresso alle aperture di iniezione della geometria e due condizioni al contorno di uscita verso le aperture di aspirazione (Figura 5) sono stati applicati per la gamma di portate e dimensioni dell'apertura utilizzati nella dimostrazione corrente. Nel modello ottenuto, le regole di flusso dettate il profilo di taglio, mentre le portate definiti grandezza del taglio sulla superficie. In pratica, una combinazione di entrambi determina se il hHFC contatto con la superficie. Tenendo a mente questi fattori, abbiamo deciso di trovare una gamma di portate per il funzionamento al fine di ottenere la rimozione delle cellule chimicamente dominante. Per creare un hHFC, usiamo la regola del flusso di aspirazione totale al rapporto di portata iniezione di 3.5. Le altre regole di flusso utilizzate sono state definite per ridurre al minimo intasamento all'interno dei canali di aspirazione,che può essere causato da proteine ​​denaturate che attaccano alle superfici di canale. Utilizzando il modello sviluppato, abbiamo trovato portate da 5 a 10 microlitri / min traslante ad uno sforzo di taglio tra 1 e 3 N / m 2. Senza l'effetto chimico di NaOH, per esempio nel caso del tampone di estrazione, la sollecitazione di taglio non sarebbe tale da eliminare le cellule 19. All'interno della gamma osservato, notiamo che il funzionamento a portate superiori è più pratico a causa perturbazioni nel percorso di flusso a portate basse aspirazione (cioè, Q I2 <4 microlitri / min) a causa di detriti cellulari nei canali.

Considerando il profilo di taglio studiato e considerazioni pratiche, portate NaOH (Q I2) di 6 e 8 microlitri / min sono utilizzate per gli esperimenti patterning e Q I1, Q A1 e Q A2 secondo le regole di flusso mostrato in figura 3. Il rapporto dei flussi iniezione (Q I2 / Q I1) permette us per modulare ulteriormente la dimensione dell'impronta hHFC (Figura 3D e Figura 4B), il principio sottostante elaborato da Autebert et al. 14. Usare l'abilità liquido-sagomatura della hHFC accoppiata con alta risoluzione capacità di scansione della piattaforma MFP, dimostriamo generazione griglia live-cell alle scale multiple e mostrare inoltre, l'applicazione del protocollo proposta per sviluppare co-colture (Figura 4C).

La piattaforma permette anche di effettuare il recupero del campione lisato per l'analisi a valle. Per mostrare la qualità del lisato ottenuto, abbiamo provato localmente lisate cellule da uno e cinque impronte in due esperimenti indipendenti, che mostra la variazione della quantità di DNA ottenuti dal lisato (Figura 7). Qui, abbiamo amplificato il DNA contenuto nel lisato utilizzando primer beta-actina (in avanti: GGATGCAGAAGGAGATCACT e retromarcia: CGATCCACACGGAGTACTTG ) Con 4 ml di lisato neutralizzata in ciascuna reazione PCR.

Figura 1
Figura 1. I moduli della piattaforma MFP e la testa. (A) I moduli operativi della piattaforma comprendono siringhe, stadi motorizzati e un controller motorizzato. L'MFP è collegata ad un motore Z fasi per controllare la distanza spazio tra la testina e il substrato, ed il porta substrato è attaccato al X e Y stadi motorizzati che costituiscono il sistema di scansione. (B) La testa MFP ha vias fluidici per collegare la stazione di pompaggio, i fori di montaggio per montare la testa sul Z-stage, e canali che esce dal vertice lucido. L'apice è impostato complanare al substrato di coltura cellulare. anelli di Symmetric Newton possono essere osservati quando l'apice e il substrato sono complanari ed a contatto. p_upload / 54447 / 54447fig1large.jpg "target =" _ blank "> Clicca qui per vedere una versione più grande di questa figura.

figura 2
Figura 2. piattaforma MFP. La piattaforma di scansione ad alta risoluzione è dotato di un supporto testata lavorata interfacciamento con il Z-stadio ad alta precisione motorizzato. La porta substrato è collegato allo stadio XY per scopi di scansione. Per il recupero del lisato per l'analisi a valle, una stazione di campionamento 3D stampato viene troncato magneticamente al lato della porta substrato (mostrato in riquadro). Pompe a siringa, un microscopio invertito, regolatori e display sono situati attorno alla piattaforma. Cliccate qui per vedere una versione più grande di questa figura.

3 "src =" / files / ftp_upload / 54447 / 54447fig3.jpg "/>
Figura 3. gerarchica confinamento flusso idrodinamico (hHFC) per controllo spaziale e temporale della rimozione delle cellule. (A) Schema di un singolo HFC. (B) nidificati e (C) Modalità di funzionamento pizzicato hHFC. (D) L'immagine dell'impronta per due diversi rapporti di flusso di iniezione / aspirazione. Cliccate qui per vedere una versione più grande di questa figura.

Figura 4
Figura 4. Modelli di monostrati cellulari utilizzando l'MFP. (A) generazione delle cellule-griglia per la scansione programmata della MFP su un monostrato di cellule MDA-MB-231. Le cellule sono state colorate con tinture cella-tracker verde. (B) L'impronta per i diversi rapporti di iniezione (n) Su un monostrato cellulare MCF7. Lo schema mostra la variazione prevista in forma di HFC interna con un cambio di n. (C) modellato co-coltura con patterning sottrattiva di MCF7 monostrato seguita da semina MDA-MB-231 cellule nelle regioni sottratte. Cliccate qui per vedere una versione più grande di questa figura.

Figura 5
Figura 5. sollecitazione di taglio sulla superficie quando si applica hHFC. Lo sforzo di taglio sulla superficie aumenta linearmente con la portata di iniezione interna. Il punto di taglio più alto si trova tra le due aperture interne (in basso a destra ad incasso), in cui è confinato il liquido di elaborazione (linee di flusso rosso, in alto a sinistra nel riquadro). Le dimensioni dell'apertura utilizzati nel modello ad elementi finiti sono 200, 100, 100 e 200 micron per i1, i2, a1e A2, rispettivamente. Clicca qui per vedere una versione più grande di questa figura.

Figura 6
Figura 6. Modalità di funzionamento della piattaforma MFP per eseguire la rimozione delle cellule e patterning. (A) Schema del percorso del flusso di patterning sottrattiva da lisi cellulare. Per semplicità, solo uno di ciascuno percorsi di iniezione e del flusso di aspirazione sono mostrati. Le siringhe sono riempite con la valvola di scarico nelle pompe. i1 e i2 sono utilizzati per l'iniezione di tampone di estrazione e NaOH rispettivamente. (B) Schema del percorso di flusso per il recupero lisato. Questo percorso di flusso viene attivata dopo la raccolta del lisato cellulare per l'analisi utilizzando il percorso di flusso in (A). Si prega Click qui per vedere una versione più grande di questa figura.

Figura 7
Figura 7. Analisi A valle del DNA da lisato cellulare utilizzando qPCR. Trame (A) amplificazione del DNA in lisato estratto da 5 tracce (5 FP) e 1 impronta (1 fp). I controlli sono stati estratti dopo la raccolta lisato per entrambi i casi. (B) Melt curve di DNA amplificati dal lisato mostra la qualità del DNA estratto. qPCR è stata eseguita (N = 2, n = 3) per amplificare il gene β-actina. Fai clic qui per vedere una versione più grande di questa figura.

Figura S
Figura S1. Un'immagine in scala di progettazione del canale per la testa MFP a 6 canaliutilizzati per esperimenti patterning. Canali svolgono la hHFC sono 200, 100, 100, 200 micron di larghezza e 100 micron di profondità. I due canali più esterni, che ricostituire il liquido di immersione sono 500 micron di larghezza e 100 micron di profondità. Un file GDS per lo stesso disegno è stato fornito come complementare a questo articolo. Clicca qui per vedere una versione più grande di questa figura.

Discussion

Vi presentiamo un protocollo versatile per il patterning sottrattiva di monostrati cellulari che consente una rapida generazione di modelli di cellulari spazialmente definiti. lisi selettiva di monostrati di cellule viene eseguita utilizzando NaOH come liquido elaborazione nel hHFC. Il NaOH denatura istantaneamente le proteine ​​contenute nella membrana cellulare. Si consiglia l'uso di 50 mm la concentrazione di NaOH per garantire un trattamento a valle del lisato. Questa concentrazione può essere aumentata per più rapida rimozione delle cellule, disponibile lisato lavorazione a valle non è un obiettivo. Il hHFC assicura che le aree circostanti non trasformate del monostrato cellulare rimangono inalterate e sono disponibili sia per espandere il modello o sondare altre proprietà delle cellule.

La velocità di rimozione delle cellule è funzione sia della chimica e shear presentato dal flusso. Abbiamo scelto un raggio di azione di portate ad avere la chimica rimozione delle cellule dominante. velocità di scansione di 10 - 20 & #181; m / sec con una iniezione portata NaOH di 6 - 8 microlitri / min sono utilizzati per facilitare 'rapida' patterning sottrattiva. Il rapido tasso di rimozione delle cellule affronta alcune sfide affrontate da stampa di superficie patterning approcci basati 20,21. Questi metodi richiedono un meccanismo per limitare la crescita delle cellule in aree spazialmente definiti, per esempio, mediante deposizione selettiva di proteine ​​di adesione cellulare mediante stampa a microcontatto e successiva semina delle cellule per ottenere il pattern. Essi sono limitati da bassa produttività e richiedono diversi passaggi sequenziali per la generazione del tracciato, nonché un nuovo stencil / timbro per ciascun modello. Il metodo descritto non richiede la crescita selettiva delle cellule in aree definite, e supera diversi limiti eseguendo patterning sottrattiva in contrasto con la stampa, pur non richiedere alcun trattamento aggiuntivo del substrato di coltura cellulare.

Con il protocollo descritto in questo documento, il throughput di monostrati di cellule patterningè aumentata, ottenendo immediato riscontro visivo del modello generato. Questo facilita la modifica in tempo reale dei modelli. Tale controllo può essere cruciale in scenari in cui vitalità cellulare su una data superficie non è omogenea. Un altro vantaggio del metodo è che la stessa testa e la chimica possono essere utilizzati per generare pattern multipli, riducendo così il numero di passaggi necessari per generare un monostrato di cellule fantasia.

Le dimensioni dei canali nella testa e la geometria della testa può essere scalata a seconda delle esigenze dell'applicazione, consentendo di controllare la risoluzione del patterning. Tutti gli esperimenti nei lavori in corso sono stati eseguiti utilizzando una testa MFP di dimensioni apertura fissa, in particolare con aperture interne a 100 × 100 micron e aperture esterne a 200 × 100 micron. Questo disegno di aperture esterne più grandi è stato scelto per garantire il funzionamento continuo del hHFC senza intasare delle aperture bydetriti cellulari randagio. Abbiamo testato testine con dimensioni apertura interna 50 × 50 micron e 50 micron spaziatura tra di loro, con risultati positivi nella rimozione di cellule. L'utilizzo di aperture più piccole, fino a 10 × 10 micron con 10 micron spaziatura, permetterebbe di scala a una dimensione più piccola orma (~ 30 × 30 micron), consentendo in tal modo una maggiore risoluzione in patterning. Abbiamo osservato questioni operative con apertura di dimensioni inferiori a 10 micron a causa di intasamento da particolato. A causa di tali difficoltà operative, 100 micron è il limite di corrente di risoluzione e quindi una limitazione della tecnica descritta. Tuttavia, siamo in grado di affrontare questo con la capacità sagomatura liquida del hHFC. Abbiamo dimostrato che la risoluzione di rimozione delle cellule può essere sintonizzata per un dato insieme di dimensioni apertura controllando Q I2 / Q I1 (Figura 4b) e il divario apice-to-substrato 10,14. Le fasi utilizzate nel lavoro corrente ha una dimensione minima del gradino di 100 nm.Una combinazione di questi parametri controllabili può migliorare la risoluzione spaziale di rimozione delle cellule in termini di dimensioni ingombro e distanza di ricezione.

Se fantasia co-colture sono desiderati per studiare le interazioni cellula-cellula specifici tra diversi tipi di cellule, semina sequenziale e patterning possono essere eseguite utilizzando il protocollo descritto. Infine, DNA amplificabile di alta qualità può essere ottenuto dal lisato, come evidente dal singolare picco nel DNA sciogliere curva (vedere la Figura 7). Abbiamo valutato una quantità di DNA di circa 1,6 ng da una singola impronta (circa 300 cellule) utilizzando qPCR, che è vicino al aspettativa teorica (6-8 pg / cell). Questo indica una quantità di DNA estratto adatto per diversi processi a valle ovviando uso di metodi di isolamento del DNA. Questo apre nuove strade per la DNA-analisi-basata locale sondaggio di cellule in coltura. La capacità di hHFC per modellare liquidi può anche essere usato per depositare cellule vive e proteine ​​su acsuperfici vata, che in combinazione con il patterning sottrattiva e sequenziale co-coltura presentata in questo protocollo consente la creazione di modelli complessi cellula e cellula-matrice su substrati di coltura. La versatilità e il controllo è fornito da hHFC basata patterning sottrattiva di monostrati cellulari e la possibilità di effettuare analisi del DNA sulle cellule estratte, fornisce un nuovo potente strumento impostato biologi effettuare studi spazialmente risolti coinvolgono interazioni cellulari.

Materials

Name Company Catalog Number Comments
Materials
Microfluidic Probe (MFP) Silicon/glass hybrid probe head with channels patterned in silicon. Fabrication done in-house at IBM Research - Zürich
Lab Tek II Chamber slides with 2 chambers ThermoFisher scientific, USA 154461 2 Chamber chamber slides for cell culture with each chamber providing an area of 4 cm2 and capable of holding up to 3 ml of media volume
Chemicals and cell lines
Sodium Hydroxide, Tris-Cl, Ethylenediaminetetraaceticacid, Rhodamine B SigmaAldrich chemicals, USA S5881, 252859,  E9884, R6626 Chemicals used for processing and shielding liquids
Proteinase K Qiagen, Germany 19131 protease to digest denatuired proteins
Deconex 16 Plus Bohrer Chemie, Switzerland Universal cleaning agent for labaratory consumables. Used for non stringent cleaning.
DNA away  ThermoFisher scientific, USA 7010 Surface decontaminant that denatures DNA and DNAases.
DMEM, high glucose, GLUTAMAX supplement ThermoFisher scientific, USA 10566-016 Culturing medium for epithelial cells.
CellTracker Green CMFDA dye ThermoFisher scientific, USA C7025 Membrane permeant live cell labeling dye. Dye active for 72 hours.
CellTracker Orange CMRA dye ThermoFisher scientific, USA C34551
β-actin genomic primers for qPCR Integrated DNA technologies, USA Custom oligos used for DNA quality validation and qPCR.
MCF7 breast carcinoma cells ATCC, USA ATCC HTB-22 Cell lines used to produce co-cultures.
MDA-MB-231 breast carcinoma cells ATCC, USA ATCC HTB-26
Equipment and fluidic connections
Motorized high precision stages Custom machined components.  Linear axis motors from LANG GmBH, Germany Customized linear axis stages from LT series 3 × LT for 3 axes. LSTEP controller used for interfacing stages and PC through RS 232 port.
Syringes Hamilton, Switzerland 1700 TLLX series Interchangeable with syringes provided by other manufacturers with a 250-500 µl range.
Nemesys low pressure syringe pumps cetoni GmbH, Germany Component of pumping station.
Circular M1-connector Dolomite microfluidics, United Kingdom  3000051 Interface between vias in MFP head and tubing
Tilt/rotation stage Goniometer OptoSigma, USA KKD-25C Goniometer to adjust coplanarity of MFP apex
DS Fi2 HD color camera (CCD)  Nikon, Switzerland Controlled using DS-U3 controller unit
Software
Win - Commander LANG GmBH, Germany Stage control software.
Qmix Elements cetoni GmbH, Germany Pump control software.
NIS Elements Nikon, Switzerland Basic research module for image acquisition and analysis.

DOWNLOAD MATERIALS LIST

References

  1. Théry, M. Micropatterning as a tool to decipher cell morphogenesis and functions. J. Cell Sci. 123, (Pt 24), 4201-4213 (2010).
  2. Goubko, C. A., Cao, X. Patterning multiple cell types in co-cultures: A review. Mater. Sci. Eng. C. 29, (6), 1855-1868 (2009).
  3. Kaji, H., Camci-Unal, G., Langer, R., Khademhosseini, A. Engineering systems for the generation of patterned co-cultures for controlling cell-cell interactions. Biochim. Biophys. Acta. 1810, (3), 239-250 (2011).
  4. Cho, C. H., Park, J., Tilles, A. W., Berthiaume, F., Toner, M., Yarmush, M. L. Layered patterning of hepatocytes in co-culture systems using microfabricated stencils. Biotechniques. 48, (1), 47-52 (2010).
  5. Schütze, K., Lahr, G. Identification of expressed genes by laser-mediated manipulation of single cells. Nat. Biotechnol. 16, (8), 737-742 (1998).
  6. Salazar, G. T. A., Wang, Y., et al. Micropallet arrays for the separation of single, adherent cells. Anal. Chem. 79, (2), 682-687 (2007).
  7. Guillaume-Gentil, O., Zambelli, T., Vorholt, J. A. Isolation of single mammalian cells from adherent cultures by fluidic force microscopy. Lab Chip. 14, (2), 402-414 (2014).
  8. Iwata, F., Adachi, M., Hashimoto, S. A single-cell scraper based on an atomic force microscope for detaching a living cell from a substrate. J. Appl. Phys. 118, (13), (2015).
  9. Riahi, R., Yang, Y., Zhang, D. D., Wong, P. K. Advances in wound-healing assays for probing collective cell migration. J. Lab. Autom. 17, (1), 59-65 (2012).
  10. Juncker, D., Schmid, H., Delamarche, E. Multipurpose microfluidic probe. Nat. Mater. 4, (8), 622-628 (2005).
  11. Kaigala, G. V., Lovchik, R. D., Delamarche, E. Microfluidics in the "open space" for performing localized chemistry on biological interfaces. Angew. Chem. Int. Ed. Engl. 51, (45), 11224-11240 (2012).
  12. Qasaimeh, M. A., Gervais, T., Juncker, D. Microfluidic quadrupole and floating concentration gradient. Nat. Commun. 2, (May), 464 (2011).
  13. Christ, K. V., Turner, K. T. Design of hydrodynamically confined microfluidics: controlling flow envelope and pressure. Lab Chip. 11, (8), 1491-1501 (2011).
  14. Autebert, J., Kashyap, A., Lovchik, R. D., Delamarche, E., Kaigala, G. V. Hierarchical hydrodynamic flow confinement: efficient use and retrieval of chemicals for microscale chemistry on surfaces. Langmuir. 30, (12), 3640-3645 (2014).
  15. Kaigala, G. V., Lovchik, R. D., Drechsler, U., Delamarche, E. A Vertical Microfluidic Probe. Langmuir. 27, (9), 5686-5693 (2011).
  16. Cors, J. F., Lovchik, R. D., Delamarche, E., Kaigala, G. V. A compact and versatile microfluidic probe for local processing of tissue sections and biological specimens. Rev. Sci. Instrum. 85, (3), 034301 (2014).
  17. Pollard, J. W., Walker, J. M. Basic Cell Culture Protocols. Humana Press. (1997).
  18. Mitry, R. R., Hughes, D. R. Human cell culture protocols. Methods Mol. Biol. Springer. 531, (1), (2012).
  19. Sakai, K., Ushida, T., Nagase, T., Nakamigawa, H. Quantitative analysis of cell detachment by shear stress. Mater. Sci. Eng. C. 17, (1-2), 55-58 (2001).
  20. Rodriguez, N. M., Desai, R. A., Trappmann, B., Baker, B. M., Chen, C. S. Micropatterned multicolor dynamically adhesive substrates to control cell adhesion and multicellular organization. Langmuir. 30, (5), 1327-1335 (2014).
  21. Tasoglu, S., Demirci, U. Bioprinting for stem cell research. Trends Biotechnol. 31, (1), 10-19 (2013).
Rapid Patterning sottrattiva di strati cellulare dal vivo con una sonda Microfluidic
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Kashyap, A., Cors, J. F., Lovchik, R. D., Kaigala, G. V. Rapid Subtractive Patterning of Live Cell Layers with a Microfluidic Probe. J. Vis. Exp. (115), e54447, doi:10.3791/54447 (2016).More

Kashyap, A., Cors, J. F., Lovchik, R. D., Kaigala, G. V. Rapid Subtractive Patterning of Live Cell Layers with a Microfluidic Probe. J. Vis. Exp. (115), e54447, doi:10.3791/54447 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter