Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Developmental Biology

Generatie van Integratie-free geïnduceerde pluripotente stamcellen uit menselijke perifere mononucleaire bloedcellen behulp Episomaal Vectors

doi: 10.3791/55091 Published: January 1, 2017

Abstract

Geïnduceerde pluripotente stamcellen (iPSCs) houdt een grote belofte voor de ziekte van modellering en regeneratieve therapieën. We eerder gemeld het gebruik van Episomaal vectoren (EV) integratie-vrij iPSCs uit perifeer bloed mononucleaire cellen (MNC PB) te genereren. De episomale vectoren gebruikte DNA plasmiden samengebouwd met oriP en EBNA1 elementen van het Epstein-Barr (EB) -virus, die het mogelijk maken replicatie en langdurige retainment plasmiden in zoogdierlijke cellen. Met verdere optimalisatie kan duizenden iPSC kolonies worden verkregen bij 1 ml perifeer bloed. Twee kritische factoren voor het bereiken van hoge rendementen herprogrammering zijn: 1) het gebruik van een 2A "zelf-splitsing" peptide koppelen OCT4 en SOX2, hetgeen moet equimolaire expressie van de twee factoren; 2) het gebruik van twee vectoren om MYC en KLF4 afzonderlijk drukken. Hier beschrijven we een stap-voor-stap protocol voor het genereren van integratie-vrije iPSC's uit perifere bloedmonsters volwassene. De gegenereerde iPSCs zijn integratie-vrij als residuele episomale plasmiden zijn niet op te sporen na vijf passages. Hoewel de herprogrammering efficiëntie is vergelijkbaar met dat van Sendai virus (SV) vectoren, plasmiden EV aanzienlijk voordeliger dan de commercieel beschikbare vectoren SV. Deze betaalbare EV herprogrammering systeem houdt potentieel voor klinische toepassingen in de regeneratieve geneeskunde en biedt een aanpak voor de directe herprogrammering van PB multinationals om de integratie-vrije mesenchymale stamcellen, neurale stamcellen, enz.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Na het gedwongen expressie van een aantal transcriptiefactoren (Dwz OCT4, SOX2, MYC en KLF4), kunnen somatische cellen worden geherprogrammeerd tot geïnduceerde pluripotente stamcellen (iPSCs), die een grote belofte voor toepassingen in regeneratieve geneeskunde en celvervangingstherapie 1-3 te houden. Tot op heden zijn verschillende werkwijzen ontwikkeld om het succes van herprogrammering 4-7 te verhogen. Virale vectoren geïnduceerde herprogrammering wordt veel gebruikt voor efficiënte generatie iPSC omdat virale integratie leidt tot een hoog niveau, stabiele expressie van de herprogrammering factoren. Echter kan permanente integratie van het vector DNA in het genoom insertie mutagenese 5 induceren. Bovendien kan onvoldoende inactivering van herprogrammering factoren iPSC differentiatie 8 verstoren. Als zodanig is het gebruik van iPSCs zonder integratie van herprogrammering factoren is noodzakelijk, met name voor toepassing bij celtherapie toepassingen.

9. De oriP element bevordert plasmide replicatie in zoogdiercellen, terwijl de EBNA1 element aanbinden de oriP-bevattende plasmide-DNA aan het chromosomale DNA dat zorgt voor de verdeling van de episoom bij deling van de gastheercel. In vergelijking met andere integratie-vrij benaderingen, waaronder Sendai virus (SV) en RNA transfectie EV bezitten meerdere voordelen 5,6,10. Zoals plasmide-DNA, kunnen EV's gemakkelijk worden geproduceerd en gewijzigd in huis, waardoor ze zeer betaalbaar. Bovendien herprogrammering met EV is minder arbeidsintensief proces aangezien een enkele transfectie met EV volstaat iPSC productie, terwijl verschillende RNA transfecties nodig voor een succesvolle herprogrammering zijn.

DErmal fibroblasten werden gebruikt in vele studies herprogrammering. Echter, huidbiopsie is niet alleen een invasieve en pijnlijk proces, maar ook tijdrovend voor uitbreiding cellen voldoende hoeveelheden herprogrammering. Van groter belang zijn huidcellen van volwassen donoren vaak blootgesteld aan langdurige UV-straling, hetgeen kan leiden tot mutaties geassocieerd met tumoren, waardoor de verzoeken om iPSCs afgeleid van huidfibroblasten 11,12 beperken. Onlangs is vermeld dat normale menselijke huidcellen ophopen somatische mutaties en meerdere kankergenen, waaronder de meeste van de drijvende krachten cutane plaveiselcelcarcinomen, onder sterke positieve selectie 13.

In tegenstelling tot huidfibroblasten, perifeer bloed (PB) cellen een voorkeur bron van cellen voor herprogrammering omdat 1) bloedcellen gemakkelijk door een minimaal invasieve werkwijze kunnen worden verkregen, 2) perifere bloedcellen zijn het nageslacht van hematopoietische stamcellenwonende in het beenmerg, dus beschermd tegen schadelijke straling. Perifere mononucleaire bloedcellen (PB MNO's) kunnen worden verzameld in een uur van de bufferlaag na een eenvoudige gradiënt centrifugeren met behulp van Ficoll-Hypaque (1,077 g / ml). De verkregen PB MNO's zijn samengesteld uit lymfocyten, monocyten en een paar haemapoietische voorlopercellen (HPC) 14. Hoewel humane T lymfocyten zijn een van de belangrijkste celtypen in PB, volwassen T cellen bevatten herrangschikkingen van het T-celreceptor (TCR) genen en ontberen een intact genoom teneinde hun voor toepassingen 15,16 beperken. Evenwel verjonging van T-cellen via iPSC generatie potentiële toepassingen in chimère antigeen receptor (CAR) T-celtherapie 17-19 hebben. In vergelijking, HPC's hebben een intact genoom en onmiddellijk herprogrammeerbaar. Hoewel slechts 0,01-0,1% cellen in de perifere circulatie zijn HPC's, kunnen deze cellen worden uitgebreid ex vivo in erythroïde medium dat proliferatie van erythr gunstenoid voorlopercellen 14.

In onze eerdere studie, gebruikten we de factor BCL-XL naast de Yamanaka factoren (OCT4, SOX2, MYC en KLF4), wat resulteerde in een toename van 10x PB herprogrammering efficiëntie 20. BCL-XL, ook bekend als BCL2L1, is een krachtige remmer van celdood, door het remmen activatie van caspases 21,22. Maar kan BCL-XL ook een belangrijke rol spelen bij het handhaven pluripotentie 21,22. Onlangs hebben we verder geoptimaliseerd EV herprogrammering systeem afzonderlijk tot expressie MYC en KLF4 met twee vectoren, die leidt tot een ongeveer 100x verhoging herprogrammering efficiëntie 23. Met deze methode, de herprogrammering efficiency, gedefinieerd door kolonieaantal gedeeld door te beginnen celaantal bij transfectie is 0,2-0,5% van gezonde donoren. Als hieronder beschrijven we de gedetailleerde experimentele procedure voor het genereren integratie-vrij iPSCs van PB.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Al het menselijk PB monsters werden verkregen uit anonieme volwassen donoren met geen identificatie-informatie beschikbaar van Tianjin Blood Center met toestemming van de lokale ethische toetsingscommissie.

1. Endo-free plasmidepreparaat

  1. Gebruik commerciële Plasmid Purification Kit Maxi tot episomale vectoren extract van E. coli volgens het protocol van de fabrikant. Voor de laatste stap, vervanging TE buffer endotoxine-vrij steriel water om de DNA pellet lossen.
  2. Meet DNA-concentratie onder toepassing van een commerciële UV / Vis spectrofotometer. De concentratie is gewoonlijk groter dan 1 ug / ul, met A260 / A280 en A260 / A230 verhoudingen groter dan 1,8 en 2,0, respectievelijk.

2. Cultuur Media

  1. Bereid erytroïde medium: expansie van hematopoietische stamcellen medium aangevuld met 100 ng / mL menselijk Stem Cell Factor (SCF), 10 ng / ml interleukine-3 (IL3), 2 U / mL Erytropoëtine (EPO), 20 ng / ml insuline groeifactor 1 (IGF1), 1 uM dexamethason en 0,2 mM 1-thioglycerol. Filter steriliseren met een 0,22 pm spuitfilter. Erytroïde medium kan voor maximaal een maand worden opgeslagen bij 4 ° C.
  2. Bereid iPSC medium: DMEM / F12 medium (Dulbecco's Modified Eagle Medium / Nutrient Mixture F-12) aangevuld met 1 x L-glutamine, 1 x penicilline / streptomycine, 1 x niet-essentiële aminozuren oplossing, 50 ng / ml fibroblast groeifactor 2 (FGF2 ), 1x insuline-transferrine-Seleniet supplement (ITS), en 50 mg / ml ascorbinezuur. Filter steriliseren met een 0,22 pm spuitfilter. iPSC medium kan voor maximaal een maand worden opgeslagen bij 4 ° C.
  3. Bereid MEF medium Dulbecco's Modified Eagle Medium (DMEM, hoge glucose) aangevuld met 1 x penicilline / streptomycine en 10% foetaal runderserum (FBS). Filter steriliseren met een 0,22 pm spuitfilter. MEF medium kunnen worden opgeslagen bij 4 ° C gedurende één maand of vers 1 x L-glutamine toe voor gebruik.
  4. Prepareren iPSC cryopreservatie medium (2x): Los 5 g D-trehalose in 30 ml steriel water in een 37 ° C waterbad. Breng de temperatuur tot 4 ° C en voeg 10 ml FBS en 10 ml dimethylsulfoxide (DMSO). Filter steriliseren met een 0,22 pm spuitfilter. Bewaar bij 4 ° C gedurende maximaal 3 maanden 24.

3. Isolatie van perifere mononucleaire bloedcellen (PB MNC's)

  1. Combineer 10 ml vers PB monster en 10 ml PBS-buffer in een 50 ml buis en meng goed. Breng PBS tot kamertemperatuur of 37 ° C vóór gebruik.
    LET OP: Ongeveer 1-3 x 10 6 MNO's (vers of gecryopreserveerd) zijn verkrijgbaar vanaf 1 ml van PB. Na 6 d van cultuur, verwachten tot 0,5 hebben - 1 x 10 6 totaal cellen als gevolg van de dood van volwassen cellen tijdens de cultuur. Ongeveer 1 x 10 7 cellen kunnen worden verkregen uit 10 ml vers PB.
  2. Voeg 10 ml Ficoll naar de bodem van de buis met behulp van een 10 ml spuit bevestigd aan een lange naald. deze process moet langzaam worden gedaan om de Ficoll laag niet mengen met de PB.
  3. Centrifugeren bij 400 g gedurende 30 minuten bij een lage acceleratie en deceleratie. Na het centrifugeren, de PB MNO's zijn in de witte laag (buffy coat) gelegen tussen de PB plasma en het Ficoll.
  4. Langzaam aspireren ~ 10 ml PB plasma zonder verstoring van de bufferlaag. oogsten voorzichtig de witte laag met behulp van een 1 ml pipet tip om een ​​nieuwe 50 ml buis. Het totale volume van de verzamelde cellen van de witte laag zal tussen 3-6 ml.
  5. Voeg PBS om het totale volume op 30 ml te brengen en meng met een 10 ml pipet. Centrifugeer bij 400 xg gedurende 10 min.
  6. Verwijder het supernatant en resuspendeer celpellet in 20 ml kweekmedium (dwz Iscove's gemodificeerd Dulbecco's medium, IMDM) en meng. Centrifugeer bij 400 xg gedurende 10 min om de meerderheid van de bloedplaatjes te verwijderen.
  7. Verwijder het supernatant en resuspendeer de celpellet in 1-2 ml IMDM. Cellen kunnen worden gebruikt fof onmiddellijke cultuur, of bevroren-down voor later gebruik. Voor cryopreservatie, voeg een gelijke hoeveelheid cryopreservatie medium. Aliquot cellen in cryovials (0,5-1 ml per flacon) en de overdracht cryovials naar een -80 ° C vriezer onmiddellijk. PB MNO's kunnen worden opgeslagen in -80 ° C vriezer gedurende enkele weken of overgebracht naar een vloeibare stikstof tank voor langdurige opslag.
    OPMERKING: Wanneer het ontdooien van de bevroren cellen, hoewel onze cryopreservatie medium levensvatbaarheid van de cellen kunnen ondersteunen, kan de cel te verlagen als gevolg van celdood tijdens het ontdooien proces. Aanbevolen wordt 1-10 x 10 7 cellen worden ingevroren in elk flesje.

4. Uitbreiding van PB multinationals in erytroïde Medium

  1. Bereid 5 ml IMDM medium in een 15 ml buis. Snel ontdooien de bevroren PB multinationals in een 37 ° C waterbad en vervolgens overbrengen naar de buis met de IMDM medium.
    LET OP: De lengte van de tijd in een waterbad is afhankelijk van het volume van de gecryopreserveerde cellen en de cryovial Used. Gewoonlijk zal de bevroren cellen ontdooien binnen 1 min.
  2. Centrifugeren bij 400 g gedurende 5-10 minuten. Verwijder het supernatant en resuspendeer de celpellet in erythroïde medium. Voeg 10 pi trypan Blue oplossing voor 10 pi celsuspensie en meng goed. Trypan blauw kleurt dode cellen in 1-3 min. Tel de cellen onder de microscoop met een hemocytometer.
  3. Cultuur PB MNO's in een niet-weefselkweek (non-TC) behandeld 6-wells plaat met 2 ml medium per putje, bij een celdichtheid van ~ 5 x 10 6 cellen / ml, bij 37 ° C in een 5% CO 2 bevochtigde incubator.
  4. Voeg 1 ml vers medium erytroïde direct aan elk putje zonder dat het medium bij D 3 en 5.
  5. Bij D 6, de oogst van de PB multinationals voor nucleofectie.

5. PB MNC Nucleofectie en herprogrammeren

  1. Een dag voor nucleofectie, voorbekleding TC behandelde 6-well platen met 0,1% gelatine bij 37 ° C gedurende 20 min. Dooi geïnactiveerde muriene embryonale Fibroblast (MEF) feeder-cellen in een 37 ° C waterbad en onmiddellijk overbrengen naar een 15 ml buis met 5 ml MEF medium.
  2. Centrifugeren bij 400 g gedurende 5 minuten en verwijder het supernatant. Verwijder de gelatine van de 6-well plaat, resuspendeer de celpellet in MEF medium, en overbrengen naar de gelatine voorbehandelde 6-wells plaat. In elk putje, zaad 2-4 x 10 5 geïnactiveerde MEF cellen gesuspendeerd in 2 ml MEF medium.
  3. Cultuur de MEF feeder-cellen bij 37 ° C in een 5% CO2 bevochtigde incubator.
  4. Op de dag van nucleofection, zuigen de MEF medium en te vervangen door 1 ml erytroïd medium. Pre-evenwicht de kweekplaat voor 10 - 30 minuten bij 37 ° C in een 5% CO2 bevochtigde incubator.
  5. Voeg 2 ug PEV-OCT4-2A-SOX2, 1 ug PEV-MYC, 1 ug PEV-KLF4, en 0,5 ug PEV-BCL-XL in een 1,5 ml steriele Eppendorf buis. Verwarm de buis bij 50 ° C gedurende 5 minuten om besmetting te voorkomen, en afkoelen tot kamertemperatuur. Toevoegen57 pi nucleofectie buffer en 13 ul supplement.
  6. Harvest 2 x 10 6 gekweekt PB multinationals aan een 5 ml buis door centrifugeren bij 200 xg gedurende 7 min. Verwijder de supernatant en voeg het plasmide en nucleofection buffer mix de celpellet. Meng goed door de knop van de buis met je vinger.
    OPMERKING: vanaf 2 x 10 5 cellen kunnen worden gebruikt voor nucleofectie, maar een lagere herprogrammering efficiëntie moet ook worden verwacht.
  7. Breng de DNA en celsuspensie aan de cuvet in de kit en dop de cuvette. Selecteer het programma U-008 op het nucleofection apparaat. Plaats de cuvette in de houder en druk op OK om het programma U-008 toe te passen.
  8. Neem de cuvet uit de houder, voeg 0,5-1 mL voorverwarmd erythroïde medium in elke cuvette, en overdracht cellen om de pre-evenwicht gebracht MEF plaat onmiddellijk. Vanwege de hoge efficiëntie en herprogrammering donor variatie zaaien verschillende aantallen cellen variërend van 1-10 x 10 5 cellen per goed wordt sterk aangemoedigd.
  9. Breng de plaat een hypoxie kamer, en spoel de kamer met een gasmengsel bestaande uit 92% N2, 5% CO2 en 3% O2, 1 - 2 minuten bij een snelheid van 20 l / min. Na afdichten van de kamer, de cellen te kweken bij 37 ° C.
  10. Bij D 2 post-nucleofectie, voeg 2 ml iPSC medium direct aan elk putje.
  11. Bij D 4 post-nucleofectie, verwijder 3 ml medium en voeg 2 ml vers iPSC medium. Bij D 4 na nucleofectie, zal van levende cellen aan de voedingslaag hebben gehecht.
  12. Na D 6 post-nucleofectie, wijzigt u het medium elke 2 d door het verlaten van 500 pi doorgebracht medium en het toevoegen van 2 ml vers E8 medium, aangevuld met 0,25 mM natriumbutyraat tot D 14-18.
    LET OP: Extra feeder cellen kunnen in de cultuur putten wanneer het waarnemen dat de feeder-cellen zijn losgemaakt worden toegevoegd. Na ontdooien MEF (zie 5,1 en 5,2), resuspendeer de celpellet in een klein volume medium E8 (dwz ~ 0.2 ml voor één putje van een 6-wells plaat) en vervolgens toe te voegen MEF in de cultuur putten. Ongeveer 2% FBS toegevoegd worden om celbinding te verhogen. Alternatief kan MEF-geconditioneerd medium worden gebruikt, maar het is bewerkelijker.

6. Uitbreiding van iPSC

LET OP: In de meeste gevallen grote aantallen iPSC kolonies verschijnen op D 8-10 paal nucleofectie. Na D 14, grote iPSC kolonies zijn meestal klaar voor het plukken.

  1. Alvorens ze kolonies, voeg 500 ul E8 medium aangevuld met ROCK inhibitor, Y27632 (10 uM) in een putje van een feeder of Matrigel gecoate 24-well plaat. Gebruik een 10 of 20 ul pipet te krabben en plukken kolonies onder de microscoop. Breng de stukken van elke kolonie aan de wells die het kweekmedium.
    LET OP: De concentratie van Matrigel verschilt van de ene partij naar de andere. Gewoonlijk gebruiken we 1: 100 verdunning van Matrigel.
    1. Om kruisbesmetting te voorkomen, pickkolonies die grote en goed gescheiden van anderen. IPSCs kweek bij 37 ° C in een 5% CO2 bevochtigde incubator.
      Opmerking: Het moet er rekening mee dat de iPSC polyklonale populatie kan het gevolg celmigratie als er tientallen of honderden kolonies in elk putje van een 6-wells plaat.
  2. Do medium niet wijzigen voor de eerste 2 d. ROCK-remmer kan voortbestaan van kleine kolonies 25 te promoten.
  3. Vanaf D 2 verder, veranderen medium elke dag door het verwijderen van verbruikte medium en het toevoegen van 500 pi vers E8 medium in elk putje.
  4. Ongeveer 1 week later, wanneer de kolonies groot genoeg zijn, verwijdert het medium en behandeling van de cellen met 300 pi cellen loslaten oplossing (0,5 mM EDTA in PBS) bij 37 ° C gedurende 1-3 min. Verwijder de cel detachement oplossing en voeg E8 medium dat ROCK-remmer (10 uM) om iPSCs op te schorten. Mis kolonies niet opgesplitst in enkele cellen, wat kan leiden tot buitensporige celdood. De cel klonten met 5-50 cells zijn geschikt voor iPSC passage.
  5. Breng 50 - 100% van de celsuspensie aan elk putje van een 12- of 6-wells plaat die vooraf bekleed met Matrigel of feeders.
  6. Voor de lange termijn cultuur in Matrigel-beklede platen (zie opmerking in 6.1), wijzigt het medium elke dag. Wanneer de cellen confluentie bereikt 40 - 60%, de behandeling van de cellen met 1 ml cel losraken oplossing (0,5 mM EDTA in PBS) bij 37 ° C gedurende 3 min ~. Wanneer de kolonies beginnen te krullen, verwijder de cel detachement oplossing en voeg E8 medium dat ROCK-remmer (10 uM) aan de iPSCs schorten. Passage cellen met een splitsing factor 4 - 8. ROCK inhibitor worden toegevoegd wanneer cellen passage overleving verhogen en verwijderd 1 d later om differentiatie te voorkomen.
  7. Invriezen-down iPSCs behandelen cellen met cel losraken oplossing bij 37 ° C gedurende 3-5 min volgens het protocol van de fabrikant. Wanneer iPSC kolonies beginnen te krullen, zuigen de buffer en voeg 0,5-1 mL E8 medium.
  8. <li> Voeg een gelijk volume cryopreservatie medium aan de celsuspensie en meng goed. Bevroren iPSC kunnen worden opgeslagen in een -80 ° C vriezer gedurende enkele weken of in vloeibare stikstof voor langdurige opslag.

7. Selectie van iPSCs zonder blijvende Episomaal plasmiden

  1. Na passage 5, oogst iPSCs en pak genomische DNA.
    OPMERKING: Meestal na 5 passages van de cultuur, de resterende episomale plasmiden zijn niet op te sporen. Dus bijna alle iPSC kolonies doorgangen boven 5 (dwz passage 10) ontbreken resterende episomale plasmiden.
  2. Gebruik genoom DNA van ongetransfecteerde PB multinationals als een negatieve controle. Voeg 1,6 pg PEV-OCT4-2A-SOX2 plasmide in 1 ug negatieve controle DNA aan cellen na te bootsen met een exemplaar van PEV plasmide per cel.
  3. Voeg 9 ul PCR-grade water met inbegrip van 100 ng genoom-DNA en 1 pl specifieke primers (10 uM elk van voorwaartse en achterwaartse primers) in 10 pi High-Fidelity PCR Master Mix. Normaliseren van de AMount van DNA door GAPDH. Gebruik de volgende primers voor PCR: EBNA1-F TTTAATACGATTGAGGGCGTCT, EBNA1-R GGTTTTGAAGGATGCGATTAAG, WPRE-F GGTTTAAACGCGTCGACAAT, WPRE-R GTTGCGTCAGCAAACACAGT, GAPDH-F GAGTCCACTGGCGTCTTC, GAPDH-R GACTGTGGTCATGAGTCCTTC.
  4. Incubeer het reactiemengsel bij 98 ° C gedurende 60 s; gevolgd door 98 ° C gedurende 10 s, 60 ° C gedurende 30 s en 72 ° C gedurende 30 s. Na 30 cycli; breiden de reactie bij 72 ° C gedurende 5 minuten.
  5. Belasting 5 pi PCR producten in elk putje van een 1% agarosegel. Voer de gel voor 20 - 30 minuten bij 100 V. Kies de iPSC klonen met ondetecteerbaar banden voor EBNA1 en WPRE voor verdere cultuur en downstream-analyse.

8. flowcytometrie

  1. Oogst iPSCs door ze te behandelen met Accutase bij 37 ° C gedurende 3-5 minuten op een enkele celsuspensie te verkrijgen. Voeg 1 ul PE-geconjugeerd anti-TRA-1-60 of eFluor 570-geconjugeerd anti-SSEA4 of isotypische antilichaam aan 100 ul celsuspensie (1 - 5 x 10 5 cellen) In 5 ml buisjes. Incubeer de buizen in een donkere plaats bij kamertemperatuur gedurende 20 min.
  2. Na kleuren gedurende 20 minuten bij kamertemperatuur, voeg 2 ml PBS en centrifugeer bij 400 xg gedurende 5 minuten. Resuspendeer cellen in 300 ul PBS-Fluorescence Activated Cell Sorting analyse (FACS) met een flow cytometrie cell analyzer. 23,26

9. Confocale Imaging

  1. Zaad iPSCs in Matrigel gecoate kamer dia's.
  2. Na 3-4 d van de cultuur, verwijder het groeimedium en bevestig deze met 4% paraformaldehyde (PFA) bij kamertemperatuur gedurende 30 min. Was de cellen tweemaal met PBS.
    Let op: PFA is giftig en schadelijk.
  3. Behandel de cellen met 0,1% Triton X-100 in PBS (PBS-T) bij kamertemperatuur gedurende 30 min. Was de cellen tweemaal met PBS.
  4. Blokkeer de cellen met blokkerende buffer (5% geit serum in PBS, V: V) bij KT gedurende 1 uur.
  5. Tijdens de blokkerende stap, verdunnen het primaire antilichaam (100x) in het blokkeren van buffer.
    LET OP: De antilichamen informatie staat vermeld in de tabel van Materialen / Equipment.
  6. Incubeer cellen met verdund antilichaam bij 4 ° CO / N.
  7. Was tweemaal met PBS-T gedurende 15 min, gevolgd door tweemaal met PBS gedurende 15 minuten.
  8. Incubeer cellen met een verdunde fluorofoor geconjugeerd secundair antilichaam bij kamertemperatuur gedurende 2 uur.
  9. Was de cellen tweemaal met PBS-T gedurende 15 min, gevolgd door tweemaal met PBS gedurende 15 minuten.
  10. Vlekken op de kern met DAPI (1 ug / ml) in PBS bij kamertemperatuur gedurende 10 min.
  11. Was de cellen tweemaal met PBS gedurende 15 minuten.
  12. Maak foto's met een confocale microscoop. 23,27

10. Teratoma Assay

Oogst 1 x 10 6 cellen iPSCs met onthechting oplossing (0,5 mM EDTA in PBS) en resuspendeer cellen in 200 ul DMEM / F12 verdund (1: 1) Matrigel.

  1. Subcutaan injecteren cellen in de achterste heup van NOD / SCID immunodeficiënte muizen.
  2. Bij 8-12 week na iPSC injectie, ontleden en oplossen teratomas in 10% formaline. 28
  3. Na microsectioning enkleuring met hematoxyline en eosine (H & E), te analyseren monsters. 29

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Met dit protocol, kunnen we honderden kolonies te verkrijgen van 1 x 10 5 nucleofected PB MDL (Figuren 1A en 1B). Herprogrammering efficiëntie bedraagt ongeveer 0,2-0,5% en de kolonies expressie pluripotentie markers (figuren 1C en 1D). iPSCs gegenereerd met de beschreven protocol zijn integratie-vrij en hebben de mogelijkheid om teratoma samenstellen van de 3 kiemlagen (Figuren 1E en 1F) vormen.

Figuur 1
Figuur 1: Vorming van integratie-vrij iPSCs van perifeer bloed mononucleaire cellen. (A): Een schema van het protocol voor het herprogrammeren van perifere bloedcellen. (B): AP kleuring in bulk (links) en een typische ESC-achtige iPSC kolonie (rechts)60; 14 d na PB multinationals nucleofectie. Schaal bar: 100 micrometer. (C): Vertegenwoordiger FACS schema's van iPSCs bij passage 5 tot expressie TRA-1-60 of SSEA4. (D): Vertegenwoordiger confocale beelden van iPSC kolonies uitdrukken NANOG en OCT4. Schaal bar: 100 micrometer. (E): representatief beeld van het totale beeld en H & E kleuring van teratoma bestaande uit alle drie de kiem lagen. Schaal bar: 100 micrometer. (F): Kopieer aantal resterende EV plasmiden in iPSCs na vijf passages. Specifieke primers voor EBNA1 en WPRE gebruikt om episomale vectoren amplificeren. GAPDH werd gebruikt als een DNA ladingscontrole. UD, niet op te sporen. De positieve lane wijst op een one-kopieerbeveiliging. Klik hier om een grotere versie van deze figuur te bekijken.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Het verwerven van bloedmonsters van gezonde donoren en patiënten is handig en niet-invasieve, waardoor het een aantrekkelijk cel bron voor fundamenteel onderzoek en klinische celtherapie. Hier hebben we een protocol voor zeer efficiënte generatie van integratie-vrij iPSCs uit perifere bloedmonsters beschreven. Deze reproduceerbare en betaalbare benadering moet het veld iPSC profiteren.

We hebben gerapporteerd dat er twee kritische factoren die verantwoordelijk zijn voor de zeer efficiënte PB herprogrammering 30. Een equimolair expressie van OCT4 en SOX2 via een linker 31 2A. Om dit te bereiken, is PEV-OCT4-2A-SOX2 gebruikt in dit protocol. De andere is het gebruik van twee plasmiden PEV-MYC en PEV-KLF4 om MYC en KLF4 uiten in plaats van PEV-MYC-2A-KLF4 die we eerder hebben gebruikt 30. De schijnbaar eenvoudige verandering leidt tot een ongeveer 100X toename PB herprogrammering efficiëntie die grotendeels door een geleidelijke en grotere toename van de MYC: KLF4 verhouding tijdens het proces.

Een aantal punten moet worden beschouwd voor het bereiken van een hoog rendement iPSC generatie van PB. PB multinationals worden gekweekt voor ~ 1 week in erythroïde medium, dat proliferatie en uitbreiding van erytroïde voorlopercellen stimuleert en verhoogt daarmee herprogrammering efficiëntie 20. Voor sommige monsters, vooral voor bloedcellen van leukemiepatiënten, cellen overleeft slecht indien gekweekt in erythroïde medium. In dit geval zou het nuttig zijn om het kweken te verkorten. Ook wordt aangemoedigd 1 gebruiken - 2 ug vector pmaxGFP de nucleofection efficiëntie, die meer dan 50% zou moeten controleren. Bovendien, het plasmide kwaliteit belangrijk. Het wordt aanbevolen om plasmiden te gebruiken zonder endotoxine verontreinigingen (dwz het gebruik van Endo-free Plasmid Maxi Kit om plasmiden te halen). Slechte plasmide kwaliteit kan leiden tot aanzienlijke celdood en dus herprogrammering efficiëntie. Wij en anderen hebben aangetoond dat hypoxie promes iPSC generatie 14,32. We spoelen hypoxie kamer met een gasmengsel bestaande uit 92% N2, 5% CO2 en 3% O2. Als normoxia in plaats daarvan wordt gebruikt, kan een tot 80% vermindering van de herprogrammering efficiëntie in acht worden genomen. Zodra de herprogrammering voltooid, kan iPSCs gekweekt in een gewone bevochtigde 5% CO2 incubator zijn. Bij het verwisselen medium, is het handig om een kleine hoeveelheid verbruikte medium (dwz 500 ul per putje in een 6-wells plaat) verlaten en voeg vers medium. Wijzig medium alleen om de andere dag tijdens de herprogrammering, zoals te vaak medium verandering kan iPSCs generatie 33 te verminderen.

De nieuwe techniek die we hebben ontwikkeld is een high-level PB herprogrammering die vergelijkbaar is met de SV herprogrammering systeem bereikt. De EV-systeem heeft een aantal duidelijke voordelen. Voor één, EV is meer betaalbaar dan SV. De EV systeem kan verder worden gemodificeerd door het opnemen van bijkomende factoren of andere combinaties van meerdere factoren, terwijl de SVs vectoren zijn een commercieel product dat niet kan worden gewijzigd door de onderzoekers. Onze huidige protocol omvat het gebruik van MEF voedingscellen en van dieren afkomstige producten, die de klinische toepassingen kunnen beperken, maar kan gemakkelijk worden verwijderd door verdere protocolontwikkeling 34,35.

iPSCs die met dit systeem kan worden gebruikt niet alleen voor ziektemodel en drug discovery, maar ook voor klinisch therapie omdat de GMP-level EV plasmiden gemakkelijk kunnen worden gegenereerd en geen iPSCs met aanzienlijke EV integratie geïdentificeerd. In klinische toepassingen, patiënt cellen meestal haven een ziekte-inducerende gen, dat moet in de iPSCs voordat differentiatie te worden gecorrigeerd in functionele cellen voor de therapie. Een recent rapport toonde dat de EV herprogrammering systeem eenvoudig kan worden geïntegreerd met de CRISPR / Cas9 systeem gelijktijdig herprogrammering en bewerken genoom bereiken na een eenvoudige nucleofection 36. Dit is eennother voordeel van EV over de SV-systeem. De gepubliceerde gegevens blijkt dat tot 20% genoom bewerking efficiëntie kan worden bereikt wanneer meeliften genoom bewerken op EV herprogrammering. Het is onze hoop dat de integratie van PB herprogrammering met CRISP / Cas9R genoom bewerken potentiële toepassingen in de behandeling van verschillende ziekten die anders ongeneeslijke in de komende decennia kan hebben.

Samenvattend, zou onze verbeterde perifere bloedcellen herprogrammering protocol nuttig voor een breed spectrum van de onderzoekers in het fundamenteel onderzoek en klinische toepassingen. Deze efficiënte EV herprogrammering systeem kan ook worden toegepast na wijzigingen, integratie-vrije Mesenchymale stamcellen (MSCs) 37 of neurale stamcellen (NSC's) 38, rechtstreeks uit volwassen perifere bloedcellen genereren zonder door een iPSC fase.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Hematopoietic Stem Cell Expansion Medium Sigma S0192 Store at 4 °C
Human Stem Cell Factor (SCF) Peprotech 300-07 Store at -20 or -80 °C
Interleukin-3 (IL-3) Peprotech AF-200-03 Store at -20 or -80 °C
Erythropoietin (EPO) Peprotech 100-64 Store at -20 or -80 °C
Insulin Growth Factor-1 (IGF-1) Peprotech 100-11 Store at -20 or -80 °C
Dexamethasone Sigma D4902 Store at -20 or -80 °C
1-thioglycerol (MTG) Sigma M6145 Store at -20 or -80 °C
DMEM/F12 medium Gibco 112660-012 Store at 4 °C
L-glutamine (100x) Gibco 25030-081 Store at -20 °C
Penicillin/Streptomycin (100x) Gibco 15140-122 Store at -20 °C
Non-essential Amino Acids solution (100x) Gibco 11140-050 Store at 4 °C
Fibroblast Growth Factor 2 (FGF2) Peprotech 100-18B Store at -20 or -80 °C
Insulin-Transferrin-Selenium (ITS, 100x) Gibco 41400-045 Store at 4 °C
Ascorbic acid Sigma 49752 Store at -20 °C
DMEM (high glucose) medium Thermo SH30243.01B Store at 4 °C
Fetal Bovine Serum (FBS) Hyclone SV30087.01 Store at -20 °C
Ficoll GE Healthcare, SIGMA 17-5442-02 Store at RT
Trehalose Sigma T9531 Store at 4 °C
Dimethylsulfoxide (DMSO) Sigma D2650 Store at RT, protect from light
Endofree Plasmid Maxi Kit (10) Qiagen 12362 Store at RT
IMDM Gibco 21056-023 Store at 4 °C
Human CD34+ Cell Nucleofection Kit Lonza VPA-1003 Store at RT, nucleofection buffer and supplement should be stored at 4 °C
Sodium Butyrate Sigma B5887 Store at -20 or -80 °C
ROCK inhibitor - Y27632 STEMGENT 04-0012-10 Store at -20 °C
Essential 8 basal medium (E8) Gibco A15169-01 Store at 4 °C, the supplement should be stored at -20 or -80 °C
Matrigel BD 354277 Store at -20 or -80 °C
2x EasyTaq PCR SuperMix (+dye) TransGen Biotech AS111 Store at -20 °C
Cell detachment solution STEMGENT 01-0006 Store at -20 °C, Accutase as a cell detachment solution to obtain a single-cell suspension
DAPI Sigma D9542-1MG Store at 4 or -20 °C
Anti-Nanog AF488 BD 560791 Store at 4 °C, primary antibody used for Immunofluorescence, dilute 1/100 when used
Anti-OCT4 abcam ab19857 Store at 4 °C, primary antibody used for Immunofluorescence, dilute 1/100 when used
AF488 donkey anti-mouse IgG Invitrogen A21202 Store at 4 °C, secondary antibody used for Immunofluorescence,  dilute 1/500 when used
PE anti-human TRA-1-60-R antibody Biolegend 330610 Store at 4 °C, antibody used for flow cytometry
eFluor 570-conjugated anti-SSEA4 eBioscience 41-8843 Store at 4 °C, antibody used for flow cytometry
Isotype antibody eBioscience 11-4011 Store at 4 °C, antibody used for flow cytometry
Alkaline Phosphatase Detection Kit SiDanSai 1102-100 Store at 4 °C
Genomic DNA Extraction Kit TIANGEN DP304-02 Store at RT
Trypan Blue solution Sigma T8154 Store at RT
Flow cytometry cell analyzer BD LSRII
Spinning Disk Confocal microscope (SDC) PerkinElmer UltraVIEW VOX for confocal imaging
Nucleofection device Lonza Nucleofector 2b for the nucleofection of PB MNC
ImageQuant LAS-4010 GE to take photos of AP staining in bulk

DOWNLOAD MATERIALS LIST

References

  1. Takahashi, K., Yamanaka, S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell. 126, 663-676 (2006).
  2. Takahashi, K., et al. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell. 131, 861-872 (2007).
  3. Trounson, A., McDonald, C. Stem Cell Therapies in Clinical Trials: Progress and Challenges. Cell Stem Cell. 17, 11-22 (2015).
  4. Hayes, M., Zavazava, N. Strategies to generate induced pluripotent stem cells. Methods Mol Biol. 1029, 77-92 (2013).
  5. Zhang, X. B. Cellular reprogramming of human peripheral blood cells. Genomics Proteomics Bioinformatics. 11, 264-274 (2013).
  6. Schlaeger, T. M., et al. A comparison of non-integrating reprogramming methods. Nat Biotechnol. 33, 58-63 (2015).
  7. Okita, K., et al. An efficient nonviral method to generate integration-free human-induced pluripotent stem cells from cord blood and peripheral blood cells. Stem Cells. 31, 458-466 (2013).
  8. Carey, B. W., et al. Reprogramming factor stoichiometry influences the epigenetic state and biological properties of induced pluripotent stem cells. Cell Stem Cell. 9, 588-598 (2011).
  9. Dorigo, O., et al. Development of a novel helper-dependent adenovirus-Epstein-Barr virus hybrid system for the stable transformation of mammalian cells. J Virol. 78, 6556-6566 (2004).
  10. Dowey, S. N., Huang, X., Chou, B. K., Ye, Z., Cheng, L. Generation of integration-free human induced pluripotent stem cells from postnatal blood mononuclear cells by plasmid vector expression. Nat Protoc. 7, 2013-2021 (2012).
  11. Harms, P. W., et al. Next generation sequencing of Cytokeratin 20-negative Merkel cell carcinoma reveals ultraviolet-signature mutations and recurrent TP53 and RB1 inactivation. Mod Pathol. 29, 240-248 (2016).
  12. Abyzov, A., et al. Somatic copy number mosaicism in human skin revealed by induced pluripotent stem cells. Nature. 492, 438-442 (2012).
  13. Martincorena, I., et al. Tumor evolution. High burden and pervasive positive selection of somatic mutations in normal human skin. Science. 348, 880-886 (2015).
  14. Su, R. J., Neises, A., Zhang, X. B. Generation of iPS Cells from Human Peripheral Blood Mononuclear Cells Using Episomal Vectors. Methods Mol Biol. 1357, 57-69 (2016).
  15. Seki, T., et al. Generation of induced pluripotent stem cells from human terminally differentiated circulating T cells. Cell Stem Cell. 7, 11-14 (2010).
  16. Loh, Y. H., et al. Reprogramming of T cells from human peripheral blood. Cell Stem Cell. 7, 15-19 (2010).
  17. Kishino, Y., Seki, T., Yuasa, S., Fujita, J., Fukuda, K. Generation of Induced Pluripotent Stem Cells from Human Peripheral T Cells Using Sendai Virus in Feeder-free Conditions. J Vis Exp. (2015).
  18. Seki, T., Yuasa, S., Fukuda, K. Generation of induced pluripotent stem cells from a small amount of human peripheral blood using a combination of activated T cells and Sendai virus. Nat Protoc. 7, 718-728 (2012).
  19. Gill, S., June, C. H. Going viral: chimeric antigen receptor T-cell therapy for hematological malignancies. Immunological reviews. 263, 68-89 (2015).
  20. Su, R. J., et al. Efficient generation of integration-free ips cells from human adult peripheral blood using BCL-XL together with Yamanaka factors. PLoS One. 8, e64496 (2013).
  21. Li, Y., et al. The p53-PUMA axis suppresses iPSC generation. Nat Commun. 4, 2174 (2013).
  22. Hardwick, J. M., Youle, R. J. SnapShot: BCL-2 proteins. Cell. 138, 404 (2009).
  23. Wen, W., et al. Enhanced Generation of Integration-free iPSCs from Human Adult Peripheral Blood Mononuclear Cells with an Optimal Combination of Episomal Vectors. Stem Cell Reports. 6, 873-884 (2016).
  24. Zhang, X. B., et al. Trehalose ameliorates the cryopreservation of cord blood in a preclinical system and increases the recovery of CFUs, long-term culture-initiating cells, and nonobese diabetic-SCID repopulating cells. Transfusion. 43, 265-272 (2003).
  25. Watanabe, K., et al. A ROCK inhibitor permits survival of dissociated human embryonic stem cells. Nat Biotechnol. 25, 681-686 (2007).
  26. Basu, S., Campbell, H. M., Dittel, B. N., Ray, A. Purification of specific cell population by fluorescence activated cell sorting (FACS). J Vis Exp. (2010).
  27. Castiel, A., et al. Cell death associated with abnormal mitosis observed by confocal imaging in live cancer cells. J Vis Exp. e50568 (2013).
  28. Peterson, S. E., et al. Teratoma generation in the testis capsule. J Vis Exp. e3177 (2011).
  29. Ritner, C., Bernstein, H. S. Fate mapping of human embryonic stem cells by teratoma formation. J Vis Exp. (2010).
  30. Wen, W., et al. Enhanced Generation of Integration-free iPSCs from Human Adult Peripheral Blood Mononuclear Cells with an Optimal Combination of Episomal Vectors. Stem Cell Reports. (2016).
  31. Lo, C. A., et al. Quantification of Protein Levels in Single Living Cells. Cell Rep. 13, 2634-2644 (2015).
  32. Liu, S. P., et al. An improved method for generating integration-free human induced pluripotent stem cells. Zhongguo Shi Yan Xue Ye Xue Za Zhi. 22, 580-587 (2014).
  33. Luni, C., et al. High-efficiency cellular reprogramming with microfluidics. Nat Methods. 13, 446-452 (2016).
  34. Chou, B. K., et al. A facile method to establish human induced pluripotent stem cells from adult blood cells under feeder-free and xeno-free culture conditions: a clinically compliant approach. Stem Cells Transl Med. 4, 320-332 (2015).
  35. Nakagawa, M., et al. A novel efficient feeder-free culture system for the derivation of human induced pluripotent stem cells. Sci Rep. 4, 3594 (2014).
  36. Howden, S. E., et al. Simultaneous Reprogramming and Gene Correction of Patient Fibroblasts. Stem Cell Reports. 5, 1109-1118 (2015).
  37. Meng, X., et al. Rapid and efficient reprogramming of human fetal and adult blood CD34+ cells into mesenchymal stem cells with a single factor. Cell research. 23, 658-672 (2013).
  38. Liao, W., et al. Direct Conversion of Cord Blood CD34+ Cells Into Neural Stem Cells by OCT4. Stem cells translational medicine. 4, 755-763 (2015).
Generatie van Integratie-free geïnduceerde pluripotente stamcellen uit menselijke perifere mononucleaire bloedcellen behulp Episomaal Vectors
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Wen, W., Zhang, J. P., Chen, W., Arakaki, C., Li, X., Baylink, D., Botimer, G. D., Xu, J., Yuan, W., Cheng, T., Zhang, X. B. Generation of Integration-free Induced Pluripotent Stem Cells from Human Peripheral Blood Mononuclear Cells Using Episomal Vectors. J. Vis. Exp. (119), e55091, doi:10.3791/55091 (2017).More

Wen, W., Zhang, J. P., Chen, W., Arakaki, C., Li, X., Baylink, D., Botimer, G. D., Xu, J., Yuan, W., Cheng, T., Zhang, X. B. Generation of Integration-free Induced Pluripotent Stem Cells from Human Peripheral Blood Mononuclear Cells Using Episomal Vectors. J. Vis. Exp. (119), e55091, doi:10.3791/55091 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter