Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Developmental Biology

에피 솜 벡터를 이용하여 인간 말초 혈액 단핵 세포로부터의 통합없이 유도 다 능성 줄기 세포의 생성

doi: 10.3791/55091 Published: January 1, 2017

Abstract

유도 만능 줄기 세포 (iPSCs)는 질병 모델링 및 재생 치료를위한 위대한 약속을 개최합니다. 우리는 이전에 말초 혈액 단핵 세포 (PB 다국적)에서 통합없는 iPSCs를 생성하는 에피 솜 벡터 (EV)의 사용을보고 하였다. 사용되는 에피 솜 벡터들은 각각 포유 동물 세포에서 플라스미드의 복제 및 장기 retainment 허용 엡스타인 - 바르 (EB) 바이러스로부터 oriP 및 EBNA1 요소 혼입 DNA 플라스미드이다. 상기 최적화, IPSC 콜로니 수천 말초 혈액 1 ㎖로부터 얻을 수있다. 높은 프로그래밍 효율성을 달성하기위한 두 가지 중요한 요인은 : 1) (2A)의 사용은 "자가 절단은"펩티드 따라서 두 요인 등몰 발현을 달성 OCT4 및 SOX2을 연결하는 단계; 2) 두 벡터의 사용은 MYC 및 KLF4에게 개별적으로 표현합니다. 여기 통합없는 IP를 생성하는 단계별 프로토콜을 설명성인 말초 혈액 샘플에서 희주. 잔류 에피 솜 플라스미드 다섯 구절 후 발견 할 수없는만큼 생성 된 iPSCs 통합-무료입니다. 리 프로그래밍 효율이 센다이 바이러스 (SV) 벡터에 필적하지만, EV 플라스미드 상당히 경제적 시판 SV 벡터 이상이다. 이 저렴한 EV의 재 프로그래밍 시스템은 재생 의학의 임상 적용 가능성 보유 통합이없는 중간 엽 줄기 세포, 신경 줄기 세포에 PB의 다국적 기업의 직접 리 프로그래밍에 대한 접근 방식을 제공합니다.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

여러 전사 인자의 발현 후 강제 (즉, OCT4, SOX2, MYC 및 KLF4)는, 체세포는 재생 의학 및 세포 대체 요법 1-3에서 응용 프로그램에 대한 큰 약속을 보유 유도 다 능성 줄기 세포 (iPSCs)로 재 프로그램 할 수있다. 지금까지 다양한 방법이 4-7 재 프로그래밍의 성공율을 높이기 위해 개발되었다. 바이러스 통합 재 프로그래밍 요소에 대한 높은 수준의 안정적인 발현을 유도하기 때문에 바이러스 벡터 - 유도 리 프로그래밍 널리 iPSCs의 효율적인 생성을 위해 사용된다. 그러나, 세포 게놈 내로 벡터 DNA 영구 통합 삽입 성 돌연변이 5를 유도 할 수있다. 또한, 프로그래밍 요소의 부족 불 활성화는 iPSCs 차별화 8을 방해 할 수있다. 이와 같이, 프로그래밍 요소의 통합없이 iPSCs의 사용은 특히 세포 치료 응용에 사용하기 위해 필수적이다.

(9)로부터 두 개의 요소, 바이러스 복제 (oriP) 및 EB 핵 항원 1 (EBNA1)의 기원을 함유하는 플라스미드이다. EBNA1 요소가 숙주 세포의 분열 동안 에피 솜의 분할 가능 염색체 DNA에 함유 oriP 플라스미드 DNA를 테더 동안 oriP 요소는 포유 동물 세포에서 플라스미드의 복제를 촉진한다. 센다이 바이러스 (SV) 및 RNA 형질 감염을 포함하는 다른 통합 프리 방식에 비교하여, 전기 자동차에는 여러 장점 5,6,10-을 갖는다. 이들을 매우 저렴하게 플라스미드 DNA로서, 전기차가 용이하게 제조 될 수 있고 변형 된 집. 또한, EV으로 재 프로그래밍하는 여러 RNA 형질 감염을 성공적 프로그래밍에 필요한 반면 전기차 단일 형질, IPSC 생성 충분하므로 덜 노동 집약적 인 공정이다.

디ermal 섬유 아세포는 많은 프로그래밍 연구에서 사용되어왔다. 그러나, 피부 생검 침입 통증 프로세스뿐만 아니라, 프로그래밍을위한 충분한 양의 세포를 확대 배양 시간 소모적 일뿐만 아니라. 큰 우려 성인 공여자의 피부 세포는 종종 따라서 피부 섬유 아세포 (11, 12)로부터 유도 iPSCs 대한 응용을 제한 종양과 관련된 돌연변이를 초래할 수있다 장기간 UV 광 방사선에 노출되어있다. 최근에는 정상적인 인간의 피부 세포가 체세포 돌연변이 및 피부 편평 세포 암종의 주요 드라이버의 대부분을 포함한 여러 암 유전자를 축적하는 것이보고되어있다, 강한 긍정적 인 선택 (13)을 받고있다.

1) 혈액 세포 쉽게 최소 침습 과정을 통해 얻어 질 수 있기 때문에, 피부 섬유 아세포는 대조적으로, 말초 혈액 (PB) 세포 리 프로그래밍에 대한 세포의 바람직한 원천 2) 말초 혈액 세포는 조혈 줄기 세포의 자손이다골수에 존재하는, 따라서 유해한 방사선으로부터 보호. 말초 혈액 단핵 세포 (PB 다국적)는 피콜-Hypaque (1.077 g / ㎖)를 사용하여 간단한 구배 원심 다음 버피 코트 층에서 시간에 수집 될 수있다. 얻어진 PB의 다국적 기업은 림프구, 단핵구 몇 조혈 전구 세포 (HPC의) (14)로 구성된다. 인간 T 림프구가 PB의 주요 세포 종류 중 하나는 성숙이지만 T 세포는 T 세포 수용체 (TCR) 유전자의 재 배열을 포함하며, 따라서 어플리케이션 (15, 16)에 대한 잠재적 인 제한 온전한 게놈 부족하다. 그러나, IPSC 생성을 통해 T 세포의 회춘은 키메라 항원 수용체 (CAR) T 세포 치료 17-19에서 응용 가능성을 가질 수있다. 비교에서의 HPC는 그대로 게놈을 용이하게 재 프로그래밍한다. 비록 단지 0.01 - 말초 순환에 0.1 %의 HPC 세포는 이들 세포가 확대 될 수있는 생체 적혈구 매체 erythr 증식 호의 해당OID 전구 세포 (14).

이전 연구에서는 PB의 재 프로그래밍의 효율성 고체 (20)의 10 배 증가 귀착 야마나카 인자 (OCT4, SOX2, MYC 및 KLF4)에 더하여 요인 BCL-XL을 사용했다. 또한 BCL2L1라고도 BCL-XL은 카스파 제 (21, 22)의 활성화를 억제함으로써 세포 사멸의 강력한 억제제이다. 그러나, BCL-XL은 능성 (21, 22)을 유지하는 중요한 역할을 할 수있다. 최근에, 우리는 또한 개별적으로 프로그래밍 효율 (23)의 약 100 배 증가로 연결 두 벡터와 MYC 및 KLF4를 표현함으로써 우리의 EV의 재 프로그래밍 시스템을 최적화했다. 건강한 공여자로부터 0.5 % -이 방법을 사용하여, 형질 감염에서 세포 수를 시작으로 나눈 콜로니 번호에 의해 정의 된 리 프로그래밍 효율은 0.2이다. 다음으로, 우리는 PB에서 통합 무료 iPSCs를 생성에 대한 자세한 실험 절차를 설명합니다.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

인간의 PB 샘플의 모든 지역 연구 윤리위원회의 승인을 천진 혈액 센터에서 사용할 수없는 식별 정보와 익명 성인 기증자로부터 얻었다.

1. 엔도가없는 플라스미드 준비

  1. 제조 업체의 프로토콜에 따라 대장균에서 에피 솜 벡터를 추출하는 상업 플라스미드 정제 맥시 키트를 사용합니다. 최종 단계에서, 독소가없는 멸균 수로 대체 TE 버퍼는 DNA 펠렛을 용해.
  2. 시판 UV / 비스 분광 광도계를 이용하여 DNA 농도를 측정한다. 농도는 일반적으로 A260 / A280은 각각 1.8 및 2.0 초과, A260 / A230의 비율이 1보다 큰 μg의 / μL이다.

2. 문화 미디어

  1. 적혈구 매체 준비 : 조혈 줄기 세포 확장 매체 100 NG / ㎖의 인간 줄기 세포 인자 (SCF), 10 ng의 / ㎖ 인터루킨 -3 (IL3), 2 U / ㎖로 보충 된 에리트로 포이 에틴 (예를 들어PO), 20 NG / ML의 인슐린 성장 인자 1 (IGF1), 1 μM 덱사메타손 0.2 mM의 1 티오 글리세롤. 0.22 μm의 주사기 필터로 멸균 필터. 적혈구 매체는 1 개월까지 4 ℃에서 저장 될 수있다.
  2. IPSC 매체를 준비 : DMEM / F12 배지 1 배의 L 글루타민, 1X 페니실린 / 스트렙토 마이신, 1X 비 필수 아미노산 용액, 50 NG / mL의 섬유 아세포 성장 인자 2 (FGF2와 보충 (둘 베코의 변형 이글 중간 / 영양 혼합물 F-12) ) 1X 인슐린 - 트랜스페린 - 셀렌 보충 (ITS), 50 ㎎ / ㎖의 아스코르브 산. 0.22 μm의 주사기 필터로 멸균 필터. IPSC 매체는 1 개월까지 4 ℃에서 저장 될 수있다.
  3. , 1X 페니실린 / 스트렙토 마이신 및 10 % 소 태아 혈청 (FBS)으로 보충 된 둘 베코 변형 이글 중간 (고 글루코스 DMEM) MEF 매체를 준비한다. 0.22 μm의 주사기 필터로 멸균 필터. MEF 매체까지 한 달 동안 4 ℃에서 보관하거나 사용 전에 1X 갓 L 글루타민을 추가 할 수있다.
  4. 피repare IPSC의 냉동 보존 매체 (배) : 37 ° C의 물을 욕조에 멸균 물 30 mL에 D-트레 할로 오스의 5g을 녹여. 4 ° C로 온도를 지참하고 FBS 10 mL의 디메틸 설폭 시드 10 mL의 (DMSO)를 추가합니다. 0.22 μm의 주사기 필터로 멸균 필터. 최대 3 달 (24)에 대해 4 ° C에서 보관하십시오.

말초 혈액 단핵 세포의 3. 분리 (PB 다국적 기업)

  1. 50 mL의 튜브에 10 mL의 신선한 PB 샘플 10 mL의 PBS 버퍼를 결합하고 잘 섞는다. RT에 PBS를 가져 오기 또는 37 ° C 사용하기 전에.
    주 : 약 1 - 2 × 106 다국적 (신선하거나 동결 보존)은 PB 1 ㎖로부터 얻을 수있다. 문화 동안 성숙 된 세포의 죽음으로 인해 1 × 총 6 셀 - 문화의 6 D 후, 0.5이 예상된다. 약 1 × 10 7 세포를 신선한 PB 10 mL를 얻을 수있다.
  2. 긴 바늘이 부착 된 10 ㎖ 주사기를 사용하여 튜브의 바닥에 10 ㎖의 피콜 추가. 이 프로운이 피콜 층이 PB 혼합하지 않도록 천천히 수행한다.
  3. 낮은 가속 및 감속 속도로 30 분 동안 400 XG에 원심 분리기. 원심 분리 후, PB의 다국적 기업은 PB 플라즈마 및 피콜 사이에있는 흰색 층 (버피 코트)에 있습니다.
  4. 천천히 흡인 ~ 버피 코트 층을 방해하지 않고 10 mL의 PB 플라즈마. 조심스럽게 새로운 50 ㎖ 튜브에 1 ㎖의 피펫 팁을 사용하여 백색 층을 수확. 용액 6 - 백색 층으로부터 수집 된 세포의 총 부피는 (3) 사이 일 것이다.
  5. 30 ㎖에 총 볼륨을 가져오고 10 mL를 피펫으로 잘 혼합 PBS를 추가합니다. 10 분 동안 400 XG에 원심 분리기.
  6. 20 mL의 배양 배지 (즉, Iscove의 수정 된 둘 베코의 중간, IMDM)의 상층 액과에 resuspend 세포 펠렛을 제거하고 잘 섞는다. 10 분 동안 400 XG에 원심 분리기는 혈소판의 대부분을 제거합니다.
  7. 상층 액을 제거하고 1 세포 펠렛을 재현 탁 - 2 ML의 IMDM. 셀에서 F 사용될 수있다또는 즉시 문화, 또는 나중에 사용하기 위해 냉동 다운. 냉동 보존를 들어, 냉동 보존 매체의 동일한 금액을 추가합니다. 바로 ° C의 냉동고에 -80 - (유리 병 당 1 mL를 0.5) 및 전송 크리오 바이알 (cryovial) 크리오 바이알 (cryovial)에서 나누어지는 세포. PB의 다국적 몇 주 동안 -80 ° C에 냉동 저장 또는 장기간 저장을 위해 액체 질소 탱크로 이송 될 수있다.
    주 : 냉동 세포를 해동 할 때 우리의 동결 배지는 세포 생존을 유지할 수 있지만, 셀 수가 해동 과정에서 세포 사멸로 인해 감소 할 수있다. 10 × 10 7 세포 각각의 유리 병에 고정됩니다 - (1)하는 것이 좋습니다.

적혈구 중간에 PB의 다국적 기업 4. 확장

  1. 15 ML의 튜브에 5 ㎖ IMDM 매체를 준비합니다. 빠르게 37 ° C의 물을 욕조에 고정 된 PB의 다국적 기업을 해동 한 다음 IMDM 매체 튜브로 전송.
    주 : 수조에서 시간의 길이는 냉동 보존 세포의 부피와 cryovial U에 따라SED. 일반적으로 냉동 셀은 1 분 이내에 해동한다.
  2. 10 분 - 5 400 XG에 원심 분리기. 상층 액을 제거하고 적혈구 배지에서 세포 펠렛을 resuspend. 10 μL 세포 현탁액 10 μL 트리 판 블루 용액을 넣고 잘 섞는다. 3 분 - 트리 판 블루 1에서 죽은 세포를 얼룩. 혈구를 사용하여 현미경으로 세포를 카운트.
  3. 비 - 조직 배양에서 배양 PB의 다국적 (비 TC)은의 셀 밀도, 웰당 2ml의 배지로 6- 웰 플레이트를 처리 ~ 5 × 106 세포 / ㎖, 37 ℃에서 5 % CO 2에서 가습 인큐베이터.
  4. D 3, 5의 매체를 변경하지 않고 각 웰에 직접 1 mL의 신선한 적혈구 매체를 추가합니다.
  5. D 6에서, nucleofection에 대한 PB의 다국적 기업을 수확.

5. PB MNC Nucleofection 및 재 프로그래밍

  1. nucleofection 전에 어느 날 프리 코트를 20 분 동안 37 ℃에서 0.1 % 젤라틴 6 웰 TC 플레이트를 처리. 해동 불 활성화 된 쥐 배아 석면고로 (MEF) 피더 37 ° C 수조 세포는 즉시 MEF 배지 5 ㎖를 함유하는 15 ㎖의 튜브에 옮긴다.
  2. 5 분 400 XG에 원심 분리기와 뜨는을 제거합니다. , 6- 웰 플레이트에서 제거 MEF 젤라틴 배지에서 세포 펠렛을 재현 탁하고, 젤라틴 전처리 6 웰 플레이트로 옮긴다. 각 웰, 시드 2 - 4 × 10 5 불 활성화 MEF 세포는 2 ㎖의 MEF 매체에 현탁.
  3. 배양을 5 % CO 2 가습 인큐베이터에서 37 ° C에서 MEF 피더 세포.
  4. nucleofection의 날, MEF 매체를 대기음 1 ML의 적혈구 매체로 교체합니다. 5 % CO 2 가습 배양기에서 37 ° C에서 30 분 - 10 배양 플레이트를 미리 평형화.
  5. 2 μg의 PEV-OCT4-2A-SOX2를 추가, 1 μg의 PEV-MYC, 1 μg의 PEV-KLF4, 및 1.5 mL의 멸균 에펜 도르프 튜브에 0.5 μg의 PEV-BCL-XL. 5 분의 오염을 방지하고, RT로 냉각하여 50 ° C에서 튜브를 가열한다. 더하다57 μL은 버퍼 13 μL 보충 nucleofection.
  6. 수확 7 분 동안 200 XG에 원심 분리하여 5 ㎖ 튜브에 2 × 10 6 배양 PB의 다국적 기업. 상층 액을 제거하고 세포 펠렛에 플라스미드 및 nucleofection 버퍼 믹스를 추가합니다. 손가락으로 튜브를 쓸어 넘겨 잘 섞는다.
    주 : 2 × 105 세포만큼 낮은 nucleofection 위해 사용될 수 있지만, 낮은 프로그래밍 효율도 예상한다.
  7. 키트에 제공된 큐벳에 DNA 및 세포 현탁액을 전송하고 큐벳 캡. nucleofection 장치의 프로그램 U-008을 선택합니다. 홀더에 큐벳을 삽입하고 U-008 프로그램을 적용하려면 확인을 누릅니다.
  8. 바로 전 평형 MEF 판에 1 ML의 미리 예열 적혈구 각각의 큐벳에 매체 및 전송 세포 - 홀더 중 큐벳을 가지고, 0.5를 추가합니다. 인해까지 세포의 수가 다른 시드 높은 프로그래밍 효율 도너 변동에 1-10 × 105 세포로부터 P어 잘 매우 권장합니다.
  9. 저산소증 챔버 플레이트 이동 및 1, 92 % N 2, 5 % CO 2 및 3 % O 2의 혼합 가스로 상기 챔버를 플러시 - 20 L / min의 속도로 2 분. 37 ° C로 챔버, 배양 세포를 밀봉 후.
  10. D 2 사후 nucleofection에서, 각 웰에 직접 2 mL의 IPSC 매체를 추가 할 수 있습니다.
  11. D 사 후 nucleofection에서, 매체의 3 용액을 제거하고 2 mL의에게 신선한 IPSC 매체를 추가 할 수 있습니다. D-4 포스트 nucleofection에서, 생균의 대부분은 세포층에 부착 한 것이다.
  12. 18 - D 6 후 nucleofection 후 μL 매체 소비 (500)를 떠나 D (14)까지 0.25 mM의 나트륨 낙산 보충 2 mL의 신선한 E8 매체를 추가하여 매체마다 2 일을 변경합니다.
    주 : 추가 피더 세포를 피더 세포가 분리되었음을 관찰마다 배양 웰에 첨가 할 수있다. MEFs에가 (5.1 및 5.2 참조) 해동 후, (E8 매체의 소량의 세포 펠렛을 재현 탁 0 ~.다음 한 6 웰 플레이트의 웰)과 2 mL의 문화 우물에 MEFs에 추가합니다. 약 2 % FBS 세포 부착을 증가시키기 위해 첨가 될 수있다. 대안 적으로, MEF 컨디셔닝 배지를 사용할 수 있지만 더 힘든하다 할 수있다.

iPSCs 6. 확장

참고 : - 10 게시물 nucleofection 대부분의 경우, IPSC 식민지의 많은 수는 D 8에 나타납니다. D (14) 후, 큰 IPSC 식민지는 보통 따기위한 준비가되어 있습니다.

  1. 식민지를 따기 전에 급 지대 또는 마트 리겔 코팅 된 24 웰 플레이트 잘 하나에, ROCK 억제제, Y27632 (10 μM)로 보충 500 μL E8 매체를 추가 할 수 있습니다. 스크래치와 현미경으로 식민지를 선택하는 10 또는 20 μL 피펫을 사용합니다. 배지를 포함하는 웰에 각각의 콜로니의 피스를 옮긴다.
    참고 : 마트 리겔의 농도는 하나의 배치에서 다른 다릅니다. 마트 리겔의 100 희석 : 일반적으로, 우리는 1을 사용합니다.
    1. 교차 오염을 방지하기 위해, 픽업크고 잘 다른 사람들로부터 분리되어 식민지. 5 % CO 2 가습 인큐베이터에서 37 ° C에서 문화 iPSCs.
      주 : 6 웰 플레이트의 각 웰에 수십 식민지의 수백이 때 IPSC 인구 인해 세포 이동에 폴리 클로 날 수 있으므로주의해야한다.
  2. 처음 2 일 동안 매체를 변경하지 마십시오. ROCK 저해제는 작은 식민지 (25)의 생존을 홍보 할 수 있습니다.
  3. 이후 D 2에서 보냈다 매체를 제거하고 각 웰에 500 μL 신선한 E8 매체를 추가하여 매일 매체를 변경합니다.
  4. 콜로니가 충분히 큰 경우에 약 1 주일 후, 배지를 제거하고 1, 37 ° C에서 300 μL 세포 분리 용액 (PBS 0.5 mM의 EDTA)로 세포를 처리 - 3 분. 세포 분리 솔루션을 제거하고 iPSCs를 일시 중단 ROCK 저해제 (10 μM)를 포함 E8 매체를 추가 할 수 있습니다. 과도한 세포 죽음으로 이어질 수 하나의 세포에 식민지를 분해하지 마십시오. 50 셀 - 5 세포 덩어리들 IPSC 통로에 적합하다.
  5. 급전선 또는 마트 리겔로 예비 코팅 된 12- 또는 6- 웰 플레이트의 각 웰에 세포 현탁액을 100 % - 전사 50.
  6. 마트 리겔 코팅 된 플레이트에서 장기 문화 (6.1 참고 참조), 매일 매체를 변경합니다. 세포 생장이 40에 도달 할 때 - 60 %, 2 ~ 3 분간, 37 ℃에서 1 mL의 세포 분리 용액 (PBS 0.5 mM의 EDTA)로 세포를 처리한다. 식민지가 곱슬 곱슬하기 시작하면, 세포 분리 솔루션을 제거하고 iPSCs를 일시 중단 E8 매체 포함 ROCK 저해제 (10 μM)를 추가합니다. 유로 (4)의 분할 인자 세포 - 8의 생존을 증가시키는 세포를 계대시 ROCK 억제제가 첨가되어야하고 분화를 방지하는 하나 D 나중에 제거.
  7. 제조 업체의 프로토콜에 따라 5 분 - 동결 다운하기 iPSCs를, 3, 37 ° C에서 세포 분리 솔루션 세포를 치료. IPSC 식민지가 곱슬 곱슬하기 시작하면, 버퍼를 대기음 0.5 추가 - 1 mL를 E8 매체를.
  8. <리>는 세포 현탁액에 냉동 보존 매체의 동일한 볼륨을 넣고 잘 섞는다. 냉동 iPSCs 몇 주 또는 장기 보관 용 액체 질소에서 -80 ° C에 냉동 저장 될 수있다.

잔류 에피 솜 플라스미드없이 iPSCs 7. 선택

  1. 유로 5, 수확 iPSCs 후와 게놈 DNA를 추출합니다.
    참고 : 일반적으로 문화의 5 구절 후, 잔류 에피 솜 플라스미드는 발견 할 수 있습니다. 따라서, 거의 모든 5 (즉, 통로 10) 위의 구절에서 IPSC 식민지의 잔류 에피 솜 플라스미드를 부족하다.
  2. 음성 대조군으로 형질 감염되지 않은 PB의 다국적 기업에서 게놈 DNA를 사용합니다. 셀 당 PEV 플라스미드의 사본과 함께 세포를 모방하기 위해 1 μg의 음성 대조군 DNA로 1.6 페이지 PEV-OCT4-2A-SOX2 플라스미드를 추가합니다.
  3. (앞으로의 10 μm의 각 프라이머 역) 100 ng의 게놈 DNA 1 μL 특정 프라이머를 포함하여 9 μL PCR 등급 물을 추가 10 μL 하이 피델리티 PCR 마스터 믹스로. 에 AM을 정상화GAPDH에 의한 DNA의 ount. EBNA1-F TTTAATACGATTGAGGGCGTCT, EBNA1-R GGTTTTGAAGGATGCGATTAAG, WPRE-F GGTTTAAACGCGTCGACAAT, WPRE-R GTTGCGTCAGCAAACACAGT, GAPDH-F GAGTCCACTGGCGTCTTC, GAPDH-R GACTGTGGTCATGAGTCCTTC : PCR에 대해 다음 프라이머를 사용합니다.
  4. 60 초 동안 98 ° C에서 반응 혼합물이 인큐베이션; 10 초, 30 초, 60 ° C, 30 초 동안 72 ° C 98 ° C로 하였다. 30 사이클 후, 5 분 동안 72 ℃에서 반응을 연장한다.
  5. 부하 1 % 아가로 스겔의 각 웰에 5 μL PCR 제품. V. 더 문화 및 다운 스트림 분석을위한 EBNA1 및 WPRE에 대한 탐지 밴드와 IPSC 클론을 선택 (100)에서 30 분 - 20 젤을 실행합니다.

8. 유동 세포 계측법

  1. 단일 세포 현탁액을 수득 5 분 - 3 37 ℃에서 Accutase로 처리하여 수확 iPSCs. 추가 1 μL PE - 복합 항 TRA-1-60 또는 항 SSEA4 또는 이소 타입 항체 세포 현탁액 100 μL (1 eFluor 570 - 복합 - 5 × 10 5 세포) 5 ㎖ 튜브한다. 20 분 동안 실온에서 어두운 장소에서 튜브를 부화.
  2. 실온에서 20 분 동안 염색 한 후, 5 분 동안 400 XG에 mL의 PBS와 원심 분리기 (2)를 추가합니다. 세포 분석기 세포 계측법 흐름을 사용하여 형광 활성화 셀 정렬 (FACS) 분석을 위해 300 μL PBS에 재현 탁 세포. 23,26

9. 공 촛점 이미징

  1. 마트 리겔 코팅 챔버 슬라이드에서 종자 iPSCs.
  2. (3) 후 - 배양 4 D, 성장 배지를 제거하고 실온에서 30 분 동안 4 % 파라 포름 알데히드 (PFA)로 고정한다. PBS로 두 번 세포를 씻으십시오.
    참고 : PFA는 독성 및 유해이다.
  3. 실온에서 30 분 동안 PBS에서 0.1 % 트리톤 X-100 (PBS-T)로 세포를 처리한다. PBS로 두 번 세포를 씻으십시오.
  4. 1 시간 동안 실온에서 : 블로킹 완충액 (V PBS 중 5 % 염소 혈청, V)와 함께 세포를 차단.
  5. 차단 단계에서, 버퍼를 차단에 차 항체 (100 배)를 희석.
    참고 : 항체 정보가 재료의 표에 나열되어 / 장비.
  6. 4 ° CO / N에 희석 항체와 세포를 품어.
  7. 15 분 동안 PBS로 두 번,이어서 15 분 동안 PBS-T로 두 번 세척 하였다.
  8. 2 시간 동안 실온에서 희석 된 형광 접합 된 이차 항체와 세포를 품어.
  9. 15 분 동안 PBS로 두 번,이어서 15 분 동안 PBS-T로 두 번 세포를 씻어.
  10. 실온에서 10 분 동안 PBS에서 DAPI (1 μg의 / mL)로 핵 염색.
  11. 15 분 동안 PBS로 두 번 세포를 씻으십시오.
  12. 공 초점 현미경으로 이미지를 캡처합니다. (23,27)

(10) 기형 종 분석

희석 200 μL DMEM / F12의 세포 분리 솔루션 (PBS 0.5 mM의 EDTA)과에 resuspend 세포와 수확 1 × 10 6 iPSCs (1 : 1) 마트 리겔.

  1. 피하 NOD / SCID를 면역 결핍 생쥐의 후방 엉덩이로 세포를 주입.
  2. 8시 - IPSC 분사가 12 주 해부 및 10 % 포르말린에 기형을 수정합니다. (28)
  3. microsectioning 후와헤 마톡 실린 및 에오신 (H & E) 염색, 샘플을 분석 할 수 있습니다. (29)

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

이 프로토콜을 이용하여, 1 × 105 nucleofected PB 다국적 콜로니에서 수백를 얻을 수있다 (도 1a 및도 1b). 0.5 %와 식민지가 능성 마커 (도 1C1D)를 표현 - 재 프로그래밍 효율은 약 0.2이다. 전술 한 프로토콜을 사용하여 생성 iPSCs 통합 무료이며 기형은 세 배엽 (도 1E1F)을 형성하는 구성하는 능력을 가지고있다.

그림 1
그림 1 : 말초 혈액 단핵 세포에서 통합 무료 iPSCs의 생성. (A) : 말초 혈액 세포를 재 프로그래밍하기위한 프로토콜의 개략도. (B) : (왼쪽) 대량 AP 염색 및 일반 ESC와 같은 IPSC 식민지 (오른쪽)60, PB의 다국적 기업의 nucleofection 후 14 일. 스케일 바 : 100 μm의. (C) : 유로 5에서 iPSCs의 대표 FACS 다이어그램 TRA-1-60 또는 SSEA4 표현. (D) : NANOG와 OCT4을 표현 IPSC 식민지의 대표 공 촛점 이미지. 스케일 바 : 100 μm의. (E) : 전체 영상과 세 개의 세균 층을 포함 기형 종의 H & E 염색의 대표 이미지입니다. 스케일 바 : 100 μm의. (F)는 다섯 구절 후 iPSCs에 잔류 EV 플라스미드의 번호를 복사합니다. EBNA1 및 WPRE 대한 특이 적 프라이머는 에피 솜 벡터를 증폭하기 위해 사용 하였다. GAPDH는 DNA 로딩 대조군으로 사용 하였다. UD, 탐지. 포지티브 레인은 하나의 카피 제어를 나타낸다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

건강한 기증자 또는 환자의 혈액 샘플을 취득하면 기초 연구 및 임상 세포 치료를위한 매력적인 셀 소스 만들기, 편리하고 비 침습적이다. 여기에서 우리는 말초 혈액 샘플에서 통합 무료 iPSCs의 효율적인 생성을위한 프로토콜을 설명했다. 이 재현하고 저렴한 방법은 IPSC 필드를 수혜가 예상된다.

우리는 고도로 효율적인 PB의 리 프로그래밍 (30)에 대한 책임이 중요한 요소가 있음을보고했다. 하나는 2A 링커 (31)를 사용하여 몰 OCT4의 표현과 SOX2입니다. 이를 달성하기 위해, PEV-OCT4-2A-SOX2이 프로토콜에서 사용된다. 다른 하나는 우리가 이전에 (30)를 사용한 것을 대신 PEV-MYC-2A-KLF4의 MYC 및 KLF4을 표현하는 두 개의 플라스미드 PEV-MYC 및 PEV-KLF4의 사용이다. 겉으로는 간단한 변화는 MYC에서 점진적으로 더 큰 증가에 주로 기인한다 PB의 재 프로그래밍 효율의 약 100 배 증가, 리드 : KL을프로세스의 도중에 F4 비율.

몇몇 지점에서 PB 고효율 IPSC 생성을 달성하기 위해 고려되어야한다. PB의 다국적 기업은 증식과 적혈구 전구 세포의 확장을 촉진 적혈구 매체에 1 ~ 주 동안 배양함으로써 프로그래밍 효율 (20)을 증가시킨다. 그러나, 특히 백혈병 환자의 혈구 일부 샘플에 대해, 세포는 적혈구 때 배지에서 배양 저조한 생존. 이 경우, 배양 시간을 단축하는 것이 도움이 될 것이다. 50 % 이상이어야한다 nucleofection 효율성을 확인하기 위해 2 μg의의 pmaxGFP 벡터 - 또한 1을 사용하는 것이 권장된다. 또한, 플라스미드 품질이 중요하다. (즉, 플라스미드를 추출하는 엔도없는 플라스미드 맥시 키트를 사용하여) 독소 오염없이 플라스미드를 사용하는 것이 좋습니다. 불량 플라스미드 품질은 중요한 세포 사멸을 유도함으로써 리 프로그래밍의 효율을 감소시킬 수도있다. 우리와 다른 사람들은 저산소증의 PROMOT을 보여 주었다IPSC 생성 14,32을 말이지. 우리는 92 % N 2, 5 % CO 2 및 3 % O 2의 혼합 가스로 저산소증 챔버를 세척. normoxia 대신 사용되는 경우, 리 프로그래밍 효율이 80 %까지 감소로 관찰 될 수있다. 리 프로그래밍이 완료되면, iPSCs 정규 가습 5 % CO2 인큐베이터에서 배양 할 수있다. 매체를 변경하는 경우, 보냈다 매체의 소량 (6 웰 플레이트에 웰 당, 즉 500 μL)를 그대로두고 새로운 배지를 추가하는 편리합니다. iPSCs 생성 (33)을 감소시킬 수있다 너무 자주 매체 변화로, 프로그래밍 동안 매체 만 매일을 변경합니다.

우리가 개발 한 새로운 프로토콜은 SV의 재 프로그래밍 시스템에 필적하는 높은 수준의 PB의 재 프로그래밍을 달성했다. 이 EV 시스템은 여러 명백한 이점이있다. 하나를 들어, EV는 SV보다 더 저렴합니다. 이 EV 시스템은 또한 추가적인 요소 또는 상이한 combina을 포함함으로써 변형 될 수있다SV들 벡터 반면 여러 요인 TIONS는, 연구자 수정할 수 없습니다 상용 제품이다. 현재 프로토콜은 임상 적 적용을 제한 할 수 있지만, 더욱 용이 프로토콜 개발 (34,35)에 의해 제거 될 수 MEF 피더 세포 및 동물성 제품의 사용을 포함한다.

GMP 수준 EV 플라스미드가 쉽게 생성 될 수 있기 때문에,이 시스템에 의해 생성 iPSCs는 질병 모델링 및 약물 스크리닝뿐만 아니라 임상 치료에 단지 사용될 수 있고 상당한 EV 통합 아무런 iPSCs는 확인되지 않았다. 임상 적용에있어서, 환자의 세포는 일반적으로 치료를위한 기능성 세포로 분화 iPSCs 전에 수정되어야하는 질환 유도 유전자 항구. 최근보고는 EV 시스템의 프로그래밍을 용이하게하는 간단한 36 nucleofection 후 동시 프로그래밍 게놈 편집을 달성하기 CRISPR / Cas9 시스템과 통합 될 수 있음을 보여 주었다. 이것은SV에 시스템을 통해 EV의 사람 같아 장점. 우리 미발표 데이터는 EV 리 프로그래밍에 게놈 편집 편승 할 때 달성 될 수있는 20 % 게놈 편집 효율이를 보여 주었다. CRISP / Cas9R 게놈 편집과 PB의 재 프로그래밍의 통합이 다가오는 수십 년 동안, 그렇지 않으면 불치있는 여러 질병 치료에 응용 가능성을 가질 수 있다는 우리의 희망입니다.

요약하면, 우리의 개선 된 말초 혈액 세포 리 프로그래밍 프로토콜은 기초 연구 및 임상 분야에서 연구자의 넓은 스펙트럼에 유용합니다. 이것은 효율적인 EV 리 프로그래밍 시스템은 또한 IPSC 단계를 거치지 않고 직접 성인 말초 혈액 세포의 통합없이 중간 엽 줄기 세포 (MSC들) (37) 또는 신경줄 기세포 (NSCs의) (38)을 생성하도록, 수정 후 사용할 수있다.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Hematopoietic Stem Cell Expansion Medium Sigma S0192 Store at 4 °C
Human Stem Cell Factor (SCF) Peprotech 300-07 Store at -20 or -80 °C
Interleukin-3 (IL-3) Peprotech AF-200-03 Store at -20 or -80 °C
Erythropoietin (EPO) Peprotech 100-64 Store at -20 or -80 °C
Insulin Growth Factor-1 (IGF-1) Peprotech 100-11 Store at -20 or -80 °C
Dexamethasone Sigma D4902 Store at -20 or -80 °C
1-thioglycerol (MTG) Sigma M6145 Store at -20 or -80 °C
DMEM/F12 medium Gibco 112660-012 Store at 4 °C
L-glutamine (100x) Gibco 25030-081 Store at -20 °C
Penicillin/Streptomycin (100x) Gibco 15140-122 Store at -20 °C
Non-essential Amino Acids solution (100x) Gibco 11140-050 Store at 4 °C
Fibroblast Growth Factor 2 (FGF2) Peprotech 100-18B Store at -20 or -80 °C
Insulin-Transferrin-Selenium (ITS, 100x) Gibco 41400-045 Store at 4 °C
Ascorbic acid Sigma 49752 Store at -20 °C
DMEM (high glucose) medium Thermo SH30243.01B Store at 4 °C
Fetal Bovine Serum (FBS) Hyclone SV30087.01 Store at -20 °C
Ficoll GE Healthcare, SIGMA 17-5442-02 Store at RT
Trehalose Sigma T9531 Store at 4 °C
Dimethylsulfoxide (DMSO) Sigma D2650 Store at RT, protect from light
Endofree Plasmid Maxi Kit (10) Qiagen 12362 Store at RT
IMDM Gibco 21056-023 Store at 4 °C
Human CD34+ Cell Nucleofection Kit Lonza VPA-1003 Store at RT, nucleofection buffer and supplement should be stored at 4 °C
Sodium Butyrate Sigma B5887 Store at -20 or -80 °C
ROCK inhibitor - Y27632 STEMGENT 04-0012-10 Store at -20 °C
Essential 8 basal medium (E8) Gibco A15169-01 Store at 4 °C, the supplement should be stored at -20 or -80 °C
Matrigel BD 354277 Store at -20 or -80 °C
2x EasyTaq PCR SuperMix (+dye) TransGen Biotech AS111 Store at -20 °C
Cell detachment solution STEMGENT 01-0006 Store at -20 °C, Accutase as a cell detachment solution to obtain a single-cell suspension
DAPI Sigma D9542-1MG Store at 4 or -20 °C
Anti-Nanog AF488 BD 560791 Store at 4 °C, primary antibody used for Immunofluorescence, dilute 1/100 when used
Anti-OCT4 abcam ab19857 Store at 4 °C, primary antibody used for Immunofluorescence, dilute 1/100 when used
AF488 donkey anti-mouse IgG Invitrogen A21202 Store at 4 °C, secondary antibody used for Immunofluorescence,  dilute 1/500 when used
PE anti-human TRA-1-60-R antibody Biolegend 330610 Store at 4 °C, antibody used for flow cytometry
eFluor 570-conjugated anti-SSEA4 eBioscience 41-8843 Store at 4 °C, antibody used for flow cytometry
Isotype antibody eBioscience 11-4011 Store at 4 °C, antibody used for flow cytometry
Alkaline Phosphatase Detection Kit SiDanSai 1102-100 Store at 4 °C
Genomic DNA Extraction Kit TIANGEN DP304-02 Store at RT
Trypan Blue solution Sigma T8154 Store at RT
Flow cytometry cell analyzer BD LSRII
Spinning Disk Confocal microscope (SDC) PerkinElmer UltraVIEW VOX for confocal imaging
Nucleofection device Lonza Nucleofector 2b for the nucleofection of PB MNC
ImageQuant LAS-4010 GE to take photos of AP staining in bulk

DOWNLOAD MATERIALS LIST

References

  1. Takahashi, K., Yamanaka, S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell. 126, 663-676 (2006).
  2. Takahashi, K., et al. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell. 131, 861-872 (2007).
  3. Trounson, A., McDonald, C. Stem Cell Therapies in Clinical Trials: Progress and Challenges. Cell Stem Cell. 17, 11-22 (2015).
  4. Hayes, M., Zavazava, N. Strategies to generate induced pluripotent stem cells. Methods Mol Biol. 1029, 77-92 (2013).
  5. Zhang, X. B. Cellular reprogramming of human peripheral blood cells. Genomics Proteomics Bioinformatics. 11, 264-274 (2013).
  6. Schlaeger, T. M., et al. A comparison of non-integrating reprogramming methods. Nat Biotechnol. 33, 58-63 (2015).
  7. Okita, K., et al. An efficient nonviral method to generate integration-free human-induced pluripotent stem cells from cord blood and peripheral blood cells. Stem Cells. 31, 458-466 (2013).
  8. Carey, B. W., et al. Reprogramming factor stoichiometry influences the epigenetic state and biological properties of induced pluripotent stem cells. Cell Stem Cell. 9, 588-598 (2011).
  9. Dorigo, O., et al. Development of a novel helper-dependent adenovirus-Epstein-Barr virus hybrid system for the stable transformation of mammalian cells. J Virol. 78, 6556-6566 (2004).
  10. Dowey, S. N., Huang, X., Chou, B. K., Ye, Z., Cheng, L. Generation of integration-free human induced pluripotent stem cells from postnatal blood mononuclear cells by plasmid vector expression. Nat Protoc. 7, 2013-2021 (2012).
  11. Harms, P. W., et al. Next generation sequencing of Cytokeratin 20-negative Merkel cell carcinoma reveals ultraviolet-signature mutations and recurrent TP53 and RB1 inactivation. Mod Pathol. 29, 240-248 (2016).
  12. Abyzov, A., et al. Somatic copy number mosaicism in human skin revealed by induced pluripotent stem cells. Nature. 492, 438-442 (2012).
  13. Martincorena, I., et al. Tumor evolution. High burden and pervasive positive selection of somatic mutations in normal human skin. Science. 348, 880-886 (2015).
  14. Su, R. J., Neises, A., Zhang, X. B. Generation of iPS Cells from Human Peripheral Blood Mononuclear Cells Using Episomal Vectors. Methods Mol Biol. 1357, 57-69 (2016).
  15. Seki, T., et al. Generation of induced pluripotent stem cells from human terminally differentiated circulating T cells. Cell Stem Cell. 7, 11-14 (2010).
  16. Loh, Y. H., et al. Reprogramming of T cells from human peripheral blood. Cell Stem Cell. 7, 15-19 (2010).
  17. Kishino, Y., Seki, T., Yuasa, S., Fujita, J., Fukuda, K. Generation of Induced Pluripotent Stem Cells from Human Peripheral T Cells Using Sendai Virus in Feeder-free Conditions. J Vis Exp. (2015).
  18. Seki, T., Yuasa, S., Fukuda, K. Generation of induced pluripotent stem cells from a small amount of human peripheral blood using a combination of activated T cells and Sendai virus. Nat Protoc. 7, 718-728 (2012).
  19. Gill, S., June, C. H. Going viral: chimeric antigen receptor T-cell therapy for hematological malignancies. Immunological reviews. 263, 68-89 (2015).
  20. Su, R. J., et al. Efficient generation of integration-free ips cells from human adult peripheral blood using BCL-XL together with Yamanaka factors. PLoS One. 8, e64496 (2013).
  21. Li, Y., et al. The p53-PUMA axis suppresses iPSC generation. Nat Commun. 4, 2174 (2013).
  22. Hardwick, J. M., Youle, R. J. SnapShot: BCL-2 proteins. Cell. 138, 404 (2009).
  23. Wen, W., et al. Enhanced Generation of Integration-free iPSCs from Human Adult Peripheral Blood Mononuclear Cells with an Optimal Combination of Episomal Vectors. Stem Cell Reports. 6, 873-884 (2016).
  24. Zhang, X. B., et al. Trehalose ameliorates the cryopreservation of cord blood in a preclinical system and increases the recovery of CFUs, long-term culture-initiating cells, and nonobese diabetic-SCID repopulating cells. Transfusion. 43, 265-272 (2003).
  25. Watanabe, K., et al. A ROCK inhibitor permits survival of dissociated human embryonic stem cells. Nat Biotechnol. 25, 681-686 (2007).
  26. Basu, S., Campbell, H. M., Dittel, B. N., Ray, A. Purification of specific cell population by fluorescence activated cell sorting (FACS). J Vis Exp. (2010).
  27. Castiel, A., et al. Cell death associated with abnormal mitosis observed by confocal imaging in live cancer cells. J Vis Exp. e50568 (2013).
  28. Peterson, S. E., et al. Teratoma generation in the testis capsule. J Vis Exp. e3177 (2011).
  29. Ritner, C., Bernstein, H. S. Fate mapping of human embryonic stem cells by teratoma formation. J Vis Exp. (2010).
  30. Wen, W., et al. Enhanced Generation of Integration-free iPSCs from Human Adult Peripheral Blood Mononuclear Cells with an Optimal Combination of Episomal Vectors. Stem Cell Reports. (2016).
  31. Lo, C. A., et al. Quantification of Protein Levels in Single Living Cells. Cell Rep. 13, 2634-2644 (2015).
  32. Liu, S. P., et al. An improved method for generating integration-free human induced pluripotent stem cells. Zhongguo Shi Yan Xue Ye Xue Za Zhi. 22, 580-587 (2014).
  33. Luni, C., et al. High-efficiency cellular reprogramming with microfluidics. Nat Methods. 13, 446-452 (2016).
  34. Chou, B. K., et al. A facile method to establish human induced pluripotent stem cells from adult blood cells under feeder-free and xeno-free culture conditions: a clinically compliant approach. Stem Cells Transl Med. 4, 320-332 (2015).
  35. Nakagawa, M., et al. A novel efficient feeder-free culture system for the derivation of human induced pluripotent stem cells. Sci Rep. 4, 3594 (2014).
  36. Howden, S. E., et al. Simultaneous Reprogramming and Gene Correction of Patient Fibroblasts. Stem Cell Reports. 5, 1109-1118 (2015).
  37. Meng, X., et al. Rapid and efficient reprogramming of human fetal and adult blood CD34+ cells into mesenchymal stem cells with a single factor. Cell research. 23, 658-672 (2013).
  38. Liao, W., et al. Direct Conversion of Cord Blood CD34+ Cells Into Neural Stem Cells by OCT4. Stem cells translational medicine. 4, 755-763 (2015).
에피 솜 벡터를 이용하여 인간 말초 혈액 단핵 세포로부터의 통합없이 유도 다 능성 줄기 세포의 생성
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Wen, W., Zhang, J. P., Chen, W., Arakaki, C., Li, X., Baylink, D., Botimer, G. D., Xu, J., Yuan, W., Cheng, T., Zhang, X. B. Generation of Integration-free Induced Pluripotent Stem Cells from Human Peripheral Blood Mononuclear Cells Using Episomal Vectors. J. Vis. Exp. (119), e55091, doi:10.3791/55091 (2017).More

Wen, W., Zhang, J. P., Chen, W., Arakaki, C., Li, X., Baylink, D., Botimer, G. D., Xu, J., Yuan, W., Cheng, T., Zhang, X. B. Generation of Integration-free Induced Pluripotent Stem Cells from Human Peripheral Blood Mononuclear Cells Using Episomal Vectors. J. Vis. Exp. (119), e55091, doi:10.3791/55091 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter