Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Developmental Biology

Генерация интеграции свободных индуцированные плюрипотентные стволовые клетки из человеческих мононуклеарных клеток периферической крови с помощью эписомальные векторы

doi: 10.3791/55091 Published: January 1, 2017

Abstract

Индуцированные плюрипотентные стволовые клетки (ИПСК) весьма перспективны для моделирования заболеваний и регенеративной терапии. Ранее мы сообщали об использовании эписомальные векторы (EV), чтобы генерировать интеграции свободных ИПСК из мононуклеарных клеток периферической крови (PB МНК). В эписомальные векторы используются ДНК - плазмиды с включенным oriP и EBNA1 элементов из вируса Эпштейна-Барр (EB), которые позволяют репликации и долгосрочной retainment плазмид в клетках млекопитающих, соответственно. При дальнейшей оптимизации тысячи Ipsc колоний могут быть получены из 1 мл периферической крови. Два критических факторов для достижения высокой эффективности перепрограммирования являются: 1) использование 2А "саморасщепления" пептид связать OCT4 и SOX2, таким образом достигая эквимолярную экспрессию двух факторов; 2) использование двух векторов для выражения Myc и Klf4 в индивидуальном порядке. Здесь мы опишем протокол шаг за шагом для формирования интеграции свободных IpСтволовые из взрослых образцов периферической крови. Сформированные иПСК являются интеграция свободной как остаточные эписомные плазмиды незаметного после пяти проходов. Хотя эффективность перепрограммирование сравнима с таковой вируса Сендай (SV) векторов, Е. В. Плазмиды значительно более экономичным, чем коммерчески доступные векторы Sv. Эта доступная система EV перепрограммирование имеет потенциал для клинического применения в регенеративной медицине и обеспечивает подход для прямого перепрограммирования PB МНК к интеграции свободных мезенхимальных стволовых клеток, нервных стволовых клеток и др.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

После принудительного экспрессии некоторых факторов транскрипции (Т.е. Oct4, Sox2, MYC и KLF4), соматические клетки могут быть перепрограммированы в индуцированные плюрипотентные стволовые клетки (ИПСК), которые держат большие перспективы для применения в регенеративной медицине и клеточной заместительной терапии 1-3. На сегодняшний день различные методы были разработаны , чтобы увеличить вероятность успеха перепрограммирования 4-7. Вирусные векторы-индуцированные перепрограммирование широко используется для эффективной генерации ИПСК, так как вирусная интеграция приводит к высокого уровня, стабильной экспрессии факторов перепрограммирования. Тем не менее, постоянная интеграции вектора ДНК в геном клетки может индуцировать инсерционного мутагенеза 5. Кроме того, недостаточная инактивация факторов перепрограммирования может нарушить ИПСК дифференциации 8. Таким образом, использование ИПСК без интеграции факторов перепрограммирования крайне важно, особенно для использования в приложениях клеточной терапии.

9 Эпштейна-Барр (EB). Элемент oriP способствует репликации плазмиды в клетках млекопитающих, в то время как элемент EBNA1 в oriP тросов, содержащих ДНК плазмиды к хромосомной ДНК, что позволяет для разбиения эписома во время деления клетки-хозяина. По сравнению с другими интеграционными свободные подходы, в том числе вирус Сендай (SV) и РНК - трансфекции, электромобили обладают множеством преимуществ 5,6,10. Как ДНК плазмиды, электромобили могут быть легко получены и модифицированы в доме, что делает их чрезвычайно доступным. Кроме того, перепрограммирование с EV является менее трудоемким процессом, так как одна трансфекция электромобили достаточна для генерации иПСК, в то время как несколько РНК трансфекцию необходимы для успешного перепрограммирования.

DErmal фибробласты были использованы во многих исследованиях перепрограммирования. Тем не менее, биопсия кожи является не только инвазивные и болезненный процесс, но и отнимает много времени для расширения клеток в количествах, достаточных для перепрограммирования. Еще большее беспокойство, клетки кожи взрослых доноров часто подвергаются длительному УФ светового излучения, что может привести к мутациям , связанных с опухолями, ограничивая таким образом приложения для ИПСК , полученных из фибробластов кожи 11,12. В последнее время , было сообщено , что нормальные клетки кожи человека накапливаются соматические мутации и множественные гены рака, в том числе большинство из ключевых факторов кожными плоскоклеточного рака, находятся под сильным положительным 13 выбора.

В отличие от фибробластов кожи, периферической крови (PB) клетки являются предпочтительным источником клеток для перепрограммирования, так как 1) клетки крови могут быть легко получены с помощью минимально инвазивного процесса, 2) клеток периферической крови являются потомством гемопоэтических стволовых клетокпроживающих в костном мозге, таким образом, защищен от вредного излучения. Мононуклеарные клетки периферической крови (PB МНК) могут быть собраны в часе езды от охристо слоя покрытия следующим простым градиентного центрифугирования с использованием Ficoll-Hypaque (1,077 г / мл). Полученные МНК PB состоят из лимфоцитов, моноцитов и нескольких гемопоэтических клеток - предшественников (HPCS) 14. Хотя человеческие Т - лимфоциты являются одним из основных типов клеток в ПБ, зрелые Т - клетки содержат перегруппировок клеточного рецептора Т (TCR) генов и не имеют неповрежденный геном , таким образом ограничивая их потенциал для применения 15,16. Тем не менее, омоложение Т - клеток с помощью генерации иПСК может иметь потенциальное применение в химерный антиген рецептор (CAR) Т-клеточной терапии 17-19. Для сравнения, HPCS имеют неповрежденный геном и легко перепрограммируемой. Хотя только 0,01 - 0,1% клеток в периферическом кровотоке являются HPCS, эти клетки можно размножить в естественных условиях ех эритроидного среде , что способствует пролиферации erythrOID клетки - предшественники 14.

В нашем предыдущем исследовании мы использовали фактор Bcl-XL в дополнение к факторам Яманака (Oct4, Sox2, MYC и Klf4), что привело к 10 - кратным увеличением PB перепрограммирования Efficency 20. BCL-XL, также известный как BCL2L1, является мощным ингибитором гибели клеток, путем ингибирования активации каспазы 21,22. Но, BCL-XL также может играть важную роль в поддержании плюрипотентности 21,22. В последнее время мы дополнительно оптимизировать нашу систему EV перепрограммирования путем раздельного выражения MYC и Klf4 с двумя векторами, что приводит к приблизительно 100x повышению эффективности перепрограммирования 23. С помощью этого метода, эффективность перепрограммирования, определяется числом колоний, деленной на число клеток, начиная при трансфекции, составляет 0,2 - 0,5% от здоровых доноров. Как следует, мы опишем подробную экспериментальную процедуру для генерации интеграции свободных ИПСК из PB.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Все человеческие образцы PB были получены от анонимных взрослых доноров без опознавательных информации, доступной из Тяньцзиня Центра крови с согласия местного комитета по этике.

1. Эндо свободной Плазмида Подготовка

  1. Используйте коммерческий набор Плазмида очистки Maxi для извлечения эписомальные векторов из E.coli в соответствии с протоколом производителя. Для получения конечной стадии, заменой буфера ТЕ с эндотоксинов стерильной водой для растворения осадка ДНК.
  2. Измерение концентрации ДНК с использованием коммерческого UV / VIS спектрофотометр. Концентрация, как правило, больше, чем 1 мкг / мкл, с А260 / А280 и А260 / А230 соотношениях более 1,8 и 2,0, соответственно.

2. Культура СМИ

  1. Подготовка эритроидного среды: гемопоэтических стволовых клеток Расширение среды с добавлением 100 нг / мл человеческого фактора стволовых клеток (SCF), 10 нг / мл интерлейкина-3 (IL3), 2 Ед / мл эритропоэтина (EФактор-1 РО), 20 нг / мл инсулина роста (IGF1), 1 мкМ дексаметазон и 0,2 мМ 1-тиоглицерин. Фильтр стерилизовать с шприцевой фильтр 0,22 мкм. Эритроидных среда может храниться при температуре 4 ° С в течение до одного месяца.
  2. Подготовка IPSC среды: DMEM / F12 (Дульбекко Modified Eagle Medium / питательной смеси F-12), дополненную 1x L-глутамина, 1x пенициллина / стрептомицина, 1x несущественные аминокислот раствором, 50 нг / мл фактор роста фибробластов 2 (FGF2 ), 1x Инсулин-трансферрина-селенит добавка (ИТС), и 50 мг / мл аскорбиновой кислоты. Фильтр стерилизовать с шприцевой фильтр 0,22 мкм. IPSC среда может храниться при температуре 4 ° С в течение до одного месяца.
  3. Подготовка MEF среды: Дульбекко в модификации Дульбекко (DMEM; с высоким содержанием глюкозы), дополненную 1x пенициллина / стрептомицина и 10% фетальной бычьей сыворотки (ФБС). Фильтр стерилизовать с шприцевой фильтр 0,22 мкм. MEF среда может храниться при температуре 4 ° С в течение до одного месяца или только добавить 1x L-глютамина перед использованием.
  4. пIPSC криоконсервации его восстановить среду (2x): Растворить 5 г D-трегалозу в 30 мл стерильной воды в C водяной бане при 37 °. Довести температуру до 4 ° С и затем добавляют 10 мл FBS и 10 мл диметилсульфоксида (ДМСО). Фильтр стерилизовать с шприцевой фильтр 0,22 мкм. Хранить при температуре 4 ° С в течение до 3 месяцев 24.

3. Выделение мононуклеарных клеток периферической крови (PB МНК)

  1. Объединить 10 мл свежего образца PB и 10 мл PBS буфера в 50 мл пробирку и хорошо перемешать. Доведите PBS до комнатной температуры или 37 ° С перед использованием.
    Примечание: Примерно 1 - 3 × 10 6 МНК (свежие или криоконсервированных) могут быть получены из 1 мл PB. После 6 дней культуры, рассчитывать на 0,5 - 1 × 10 6 клеток всего из - за гибели зрелых клеток в процессе культивирования. Приблизительно 1 х 10 7 клеток можно получить из 10 мл свежего PB.
  2. Добавьте 10 мл Ficoll в нижней части трубки, используя шприц объемом 10 мл, прикрепленный к длинной иглой. Это пропроцесс должен быть сделано медленно, чтобы гарантировать, что слой Ficoll не смешивается с PB.
  3. Центрифуга при 400 мкг в течение 30 мин при низкой скорости разгона и торможения. После центрифугирования МНК PB находятся в белый слой (светлого сгустка крови), расположенный между PB плазмой и Ficoll.
  4. Медленно аспирата ~ 10 мл PB плазмы, не нарушая слоя светлого сгустка крови. Осторожно собрать белый слой с помощью пипетки 1 мл на новую 50 мл трубки. Общий объем собранных клеток из белого слоя будет составлять от 3 - 6 мл.
  5. Добавить PBS, чтобы довести общий объем до 30 мл и хорошо перемешать с помощью пипетки на 10 мл. Центрифуга при 400 х г в течение 10 мин.
  6. Удалите осадок клеток супернатант и ресуспендируют в 20 мл культуральной среды (т.е. Исков Модифицированная Дульбекко Medium, IMDM) и хорошо перемешать. Центрифуга при 400 х г в течение 10 мин, чтобы удалить большую часть тромбоцитов.
  7. Удалить супернатант и ресуспендируют осадок клеток в 1 - 2 мл IMDM. Клетки могут быть использованы Fили непосредственная культура, или замороженные вниз для последующего использования. Для криоконсервации, добавьте равное количество криоконсервации среды. Алиготе клетки в криопробирок (0,5 - 1 мл на флакон) и передачи криопробирок до -80 ° C морозильнике немедленно. PB МНК могут храниться в -80 ° C морозильнике в течение нескольких недель или переносят в баке жидкого азота для длительного хранения.
    ПРИМЕЧАНИЕ: При оттаивании замороженных клеток, хотя наша криоконсервации среда может поддерживать жизнеспособность клеток, число клеток может уменьшаться из-за гибели клеток в процессе оттаивания. Рекомендуется 1 - 10 х 10 7 клеток будут заморожены в каждом флаконе.

4. Расширение PB МНК в эритроидных среде

  1. Подготовка 5 мл среды IMDM в трубке 15 мл. Быстро разморозить замороженные МНК PB в C водяной бане 37 °, а затем передать их в пробирку с IMDM среде.
    Примечание: Продолжительность времени в водяной бане зависит от объема криоконсервированных клеток и криопробирку USED. Как правило, замороженная клетка будет таять в течение 1 мин.
  2. Центрифуга при 400 мкг в течение 5 - 10 мин. Удалить супернатант и ресуспендируют осадок клеток в среде эритроидных. Добавить 10 мкл трипанового синего раствора к суспензии клеток 10 мкл и хорошо перемешать. Трипановый синевы мертвые клетки в течение 1 - 3 мин. Граф клеток под микроскопом с использованием гемоцитометра.
  3. Культура PB МНК в культуре без ткани (не-TC) обрабатывают 6-луночный планшет с 2 мл среды на лунку, при плотности клеток ~ 5 × 10 6 клеток / мл, при 37 ° С в 5% CO 2 увлажненном инкубаторе.
  4. Добавляют 1 мл свежей среды эритроидного непосредственно в каждую лунку без изменения среды при D 3 и 5.
  5. При D 6, урожай МНК PB для nucleofection.

5. PB MNC Nucleofection и перепрограммирования

  1. За один день до nucleofection, предварительное покрытие ТС обработанных 6-луночные планшеты с 0,1% желатином при 37 ° С в течение 20 мин. Оттепель инактивированной Мышиные эмбриональных фибровзрыв (MEF) фидерных клеток в C водяной бане при 37 ° и немедленно передать их в пробирку, содержащую 15 мл 5 мл MEF среды.
  2. Центрифуга при 400 мкг в течение 5 мин и удалить супернатант. Удалить желатин из 6-луночного планшета, ресуспендируют осадок клеток в MEF среде, и передавать их в желатин, предварительно обработанные 6-луночного планшета. В каждую лунку, семенной 2 - 4 × 10 5 инактивированные MEF клетки суспендировали в 2 мл среды MEF.
  3. Культура MEF фидерных клеток при 37 ° С в 5% CO 2 увлажненном инкубаторе.
  4. В день nucleofection, аспирация MEF среды и заменить его на 1 мл эритроидного среды. Предварительно уравновешивания культуральный планшет в течение 10 - 30 мин при 37 ° С в атмосфере 5% СО 2 увлажненном инкубаторе.
  5. Добавить 2 мкг пэВ-OCT4-2A-SOX2, 1 мкг пэВ-Myc, 1 мкг пэВ-Klf4 и 0,5 мкг пэВ-BCL-XL в 1,5 мл стерильной пробирке Эппендорфа. Нагреть пробирку при 50 ° С в течение 5 мин, чтобы предотвратить загрязнение, и остыть до комнатной температуры. Добавить57 мкл nucleofection буфера и 13 мкл дополнения.
  6. Урожай 2 х 10 6 культивируемых PB МНК в 5 мл пробирку путем центрифугирования при 200g в течение 7 мин. Удалить супернатант и добавить плазмиду и nucleofection буферной смеси к осадку клеток. Хорошо перемешать, щелкая трубки пальцем.
    Примечание: уменьшен до 2 × 10 5 клеток , могут быть использованы для nucleofection, но более низкую эффективность перепрограммирования следует ожидать , а также.
  7. Передача ДНК и клеточной суспензии в кювете, представленной в наборе и колпачок кювету. Выберите программу U-008 на nucleofection устройстве. Вставьте кювету в держатель и нажмите кнопку OK, чтобы применить программу U-008.
  8. Возьмите кювету из держателя, добавьте 0,5 - 1 мл подогретого эритроидного среды в каждую кювету и клетки переноса на предварительно уравновешенную MEF пластины немедленно. Из - за высокой эффективности перепрограммирования и вариации доноров, высева различное число клеток в пределах от 1-10 × 10 5 клеток рэр также настоятельно рекомендуется.
  9. Перенести пластину к гипоксией камере, и промойте камеру с газовой смесью , состоящей из 92% N 2, 5% СО 2 и 3% O 2, в течение 1 - 2 мин со скоростью 20 л / мин. После герметизации камеры, культуры клеток при 37 ° С.
  10. На D 2 после nucleofection, добавляют 2 мл IPSC среды непосредственно в каждую лунку.
  11. В D 4 после nucleofection, удалить 3 мл среды и добавляют 2 мл свежей среды IPSC. В D 4 пост-nucleofection, большинство живых клеток будут прикреплены к фидерного слоя.
  12. После того, как D 6 пост-nucleofection, менять среду каждые 2 D, оставляя 500 мкл потратили средний и добавлением 2 мл свежей среды E8 не дополненную 0,25 мМ бутират натрия до D 14 - 18.
    Примечание: Дополнительный фидерные клетки могут быть добавлены в лунки с культурой, когда заметив, что питающие клетки были отделены. После оттаивания MEFs (см 5.1 и 5.2), ресуспендируют осадок клеток в небольшом объеме E8 среды (то есть ~ 0.2 мл на одну лунку 6-луночного планшета), а затем добавить MEFs в культуру лунки. Приблизительно 2% FBS, могут быть добавлены к увеличению прикрепление клеток. В качестве альтернативы, MEF-кондиционированной среде также могут быть использованы, но это более трудоемкий.

6. Расширение ИПСК

Примечание: В большинстве случаев большое количество IPSC колоний появляются D 8 - 10 пост nucleofection. После того, как D 14, большие IPSC колонии, как правило, готовы к собирание.

  1. Перед тем как собирание колонии, добавьте 500 мкл E8 среду, дополненную ингибитором ROCK, Y27632 (10 мкМ), в одну лунку фидера или Матригель с покрытием 24-луночный планшет. Используйте 10 или 20 мкл пипетку поцарапать и забрать колонии под микроскопом. Передача части каждой колонии в лунки, содержащие культуральную среду.
    ПРИМЕЧАНИЕ: Концентрация Матригель отличается от одной партии к другой. Как правило, мы используем 1: 100 разведение Матригель.
    1. Для того, чтобы избежать перекрестного загрязнения, выбратьколонии, которые являются большими и хорошо отделены от других. ИПСК культуры при 37 ° С в 5% CO 2 увлажненном инкубаторе.
      Примечание: Следует отметить, что популяция Ipsc может быть поликлональными из-за миграции клеток, когда существуют десятки или сотни колоний в каждую лунку 6-луночного планшета.
  2. Не меняйте среду для первого 2 дней. Ингибитор ROCK может способствовать выживанию небольших колоний 25.
  3. С D 2 и далее, изменение средней ежедневно путем удаления использованной среды и добавлением 500 мкл свежей среды E8 в каждую лунку.
  4. Примерно 1 неделю позже, когда колонии достаточно велики, удалите среду и обработать клетки с 300 мкл раствора открепления клеток (0,5 мМ ЭДТА в PBS) при 37 ° С в течение 1 - 3 мин. Удалите раствор открепления клеток и добавляют среду, содержащую E8 ингибитор ROCK (10 мкМ), чтобы приостановить ИПСК. Не сломаться колонии на отдельные клетки, что может привести к чрезмерной гибели клеток. Клеточные сгустки с 5 - 50 ячейкиs подходят для иПСК прохода.
  5. Передача 50 - 100% от клеточной суспензии в каждую лунку 12- или 6-луночный планшет, который был предварительно покрытый питателей или Матригель.
  6. Для длительной культуры в пластинах матригелем (смотри примечание в 6.1), изменить среду каждый день. Когда клетка конфлуэнтности достигает 40 - 60%, лечить клетки с 1 мл раствора открепления клеток (0,5 мМ ЭДТА в PBS) при 37 ° С в течение ~ 3 мин. Когда колонии начинают скручиваться, удаления раствора открепления клеток и добавить E8 среду, содержащую ингибитор ROCK (10 мкМ), чтобы приостановить ИПСК. Пассаж клетки с фактором расщепления 4 - 8. ингибитор ROCK должен быть добавлен, когда пересева клеток повышает выживаемость, а также удалены 1 d позже, чтобы предотвратить дифференцировку.
  7. Для того, чтобы заморозить вниз ИПСК, лечить клетки с открепления клеток раствором при 37 ° С в течение 3 - 5 мин в соответствии с протоколом производителя. Когда IPSC колонии начинают скручиваться, аспирация буфер и добавьте 0,5 - 1 мл E8 среды.
  8. <li> Добавьте равный объем криоконсервации среды к суспензии клеток и хорошо перемешать. Замороженные иПСК можно хранить в морозильной камере C -80 ° в течение нескольких недель или в жидком азоте в течение длительного хранения.

7. Выбор ИПСК без остаточного эписомальные плазмид

  1. После прохождения 5, урожай ИПСК и извлекать геномную ДНК.
    Примечание: Как правило, после того, как 5 пассажей культуры, остаточные эписомные плазмиды незаметного. Таким образом, почти все колонии IPSC в проходах выше 5 (т.е. канал 10) отсутствуют остаточные эписомальные плазмид.
  2. Использование геномной ДНК из нетрансфецированной МНК PB в качестве отрицательного контроля. Добавить 1,6 пг пэВ-OCT4-2A-Sox2 плазмиды в 1 мкг отрицательной контрольной ДНК, чтобы имитировать клетки с одной копией пэВ плазмиды на клетку.
  3. Добавить 9 мкл ПЦР-класса воды в том числе 100 нг геномной ДНК и 1 мкл специфических праймеров (10 мкМ каждого из прямого и обратного праймеров) в 10 мкл High-Fidelity PCR Master Mix. Нормализация утрар а ф ДНК по GAPDH. С помощью следующих праймеров для ПЦР: EBNA1-F TTTAATACGATTGAGGGCGTCT, EBNA1-R GGTTTTGAAGGATGCGATTAAG, WPRE-F GGTTTAAACGCGTCGACAAT, WPRE-R GTTGCGTCAGCAAACACAGT, GAPDH-F GAGTCCACTGGCGTCTTC, GAPDH-R GACTGTGGTCATGAGTCCTTC.
  4. Инкубируют реакционную смесь при 98 ° С в течение 60 с; затем 98 ° С в течение 10 с, 60 ° С в течение 30 с и 72 ° С в течение 30 с. После 30 циклов; продлить реакцию при 72 ° С в течение 5 мин.
  5. Нагрузка 5 мкл продуктов ПЦР в каждую лунку геля 1% -ном агарозном. Выполнить гель в течение 20 - 30 мин при 100 В. Выберите клоны IPSC с неопределяемых полос для EBNA1 и WPRE для дальнейшей культуры и вниз по течению анализа.

8. Проточная цитометрия

  1. Урожай иПСК путем обработки их с Accutase при 37 ° С в течение 3 - 5 мин для получения одноклеточной суспензии. Добавить 1 мкл РЕ-конъюгированными анти-TRA-1-60 или eFluor 570-конъюгированные анти-SSEA4 или Изотипический антител к 100 мкл клеточной суспензии (1 - 5 × 10 5 клеток) В 5 мл пробирки. Инкубировать пробирки в темном месте при комнатной температуре в течение 20 мин.
  2. После окрашивания в течение 20 мин при комнатной температуре, добавляют 2 мл PBS и центрифуге при 400 мкг в течение 5 мин. Ресуспендируют клеток в 300 мкл PBS для анализа флуоресценции активированных сортировки клеток (FACS) с использованием проточной цитометрии анализатора клеток. 23,26

9. конфокальной микроскопии

  1. Семенной иПСК в Матригель покрытием камеры горками.
  2. После 3 - 4 г культуры, удалить среду для роста и зафиксировать с помощью 4% параформальдегида (PFA) при комнатной температуре в течение 30 мин. Промыть клетки дважды PBS.
    Примечание: PFA является токсичным и вредным.
  3. Treat клеток с 0,1% Тритон Х-100 в PBS (PBS-Т) при комнатной температуре в течение 30 мин. Вымойте клетки дважды с PBS.
  4. Блок клетки с блокирующим буфером (5% сыворотки козьего в PBS, V: V), при комнатной температуре в течение 1 ч.
  5. Во время стадии блокирования разбавить первичное антитело (100x) в блокирующем буфере.
    Примечание: Информация антитела приведена в таблице материалов / оборудования,
  6. Инкубируйте клетки с разбавленным антителом при 4 ° CO / N.
  7. Промыть два раза с PBS-T в течение 15 мин, а затем два раза с PBS в течение 15 мин.
  8. Инкубируйте клетки с разбавленным флуорофора конъюгированных с вторичным антителом, при КТ в течение 2 ч.
  9. Вымойте клетки дважды с PBS-T в течение 15 мин, а затем два раза с PBS в течение 15 мин.
  10. Пятно ядро ​​с использованием DAPI (1 мкг / мл) в PBS при комнатной температуре в течение 10 мин.
  11. Промыть клетки дважды с PBS в течение 15 мин.
  12. Захват изображений с помощью конфокальной микроскопии. 23,27

10. Анализ тератомы

Урожай 1 х 10 6 иПСК раствором открепления клеток (0,5 мМ ЭДТА в PBS) и ресуспендируют клеток в 200 мкл DMEM / F12 разбавленным (1: 1) Матригель.

  1. Подкожно вводят клетки в задней вуты мышей иммунодефицитных NOD / SCID.
  2. В 8 - 12 недели после инъекции иПСК, рассекают и зафиксировать тератомы в 10% формалине. 28
  3. После того, как microsectioning иокрашивание гематоксилином и эозином (H & E), анализ проб. 29

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Используя этот протокол, можно получить сотни колоний от 1 х 10 5 nucleofected РВ МНК (фигуры 1А и 1В). Эффективность перепрограммирования составляет приблизительно 0,2 - 0,5% и колонии выражают маркеры плюрипотентности (рис 1C и 1D). иПСК , сгенерированные с использованием описанного протокола являются интеграция свободных и имеют способность образовывать тератомы составлении 3 зародышевых листков (рис 1E и 1F).

Рисунок 1
Рисунок 1: Генерация интеграции свободных ИПСК из мононуклеарных клеток периферической крови. (А): Схема протокола для перепрограммирования клеток периферической крови. (B): AP окрашивание наливом (слева) и типичный ESC-как IPSC колонии (справа)60; 14 d после PB МНК nucleofection. Шкала бар: 100 мкм. (C): Типичные FACS диаграммы ИПСК при прохождении 5 экспрессии TRA-1-60 или SSEA4. (D): Представитель конфокальной образы IPSC колоний , экспрессирующих NANOG и OCT4. Шкала бар: 100 мкм. (Е): представитель изображения общей картины и H & E окрашивания тератомы , включающий все три зародышевых листка. Шкала бар: 100 мкм. (F): Скопировать количество остаточных EV плазмид в ИПСК после пяти проходов. Конкретные праймеры для EBNA1 и WPRE были использованы для амплификации эписомальные векторов. GAPDH, был использован в качестве нагрузочного контроля ДНК. UD, невозможно обнаружить. Положительная полоса указывает на управление одной копии. Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Получение образцов крови у здоровых доноров или пациентов, удобна и неинвазивный, что делает его привлекательным источником клеток для проведения фундаментальных исследований и клинической клеточной терапии. Здесь мы описали протокол для высокоэффективной генерации интеграции свободных ИПСК из образцов периферической крови. Этот воспроизводимый и доступный подход должен принести пользу поле IPSC.

Мы сообщали , что существует два критических факторов , ответственных за высокоэффективному PB перепрограммирования 30. Одним из них является эквимолярную выражение OCT4 и SOX2 с использованием 2A линкер 31. Для достижения этой цели, пэВ-OCT4-2A-SOX2 используется в данном протоколе. Другой является использование двух плазмид пэВ-Myc и пэВ-Klf4 выразить MYC и Klf4 вместо пэВ-Myc-2A-KLF4 , что мы ранее использовали 30. Казалось бы, простое изменение приводит к приблизительно 100X увеличению эффективности перепрограммирования PB, что во многом связано с постепенным и большему увеличению MYC: KLОтношение F4, в ходе процесса.

Несколько точек следует учитывать для достижения высокой эффективности производства IPSC из PB. PB МНК культивируют в течение ~ 1 недели в эритроидных среде, что способствует пролиферации и расширение эритроидных клеток и , таким образом , увеличивает эффективность перепрограммирования 20. Тем не менее, для некоторых образцов, особенно для клеток крови у больных лейкемией, клетки выживают плохо при культивировании в среде эритроидных. В этом случае, было бы полезно, чтобы уменьшить время культивирования. Также рекомендуется использовать 1 - 2 мкг pmaxGFP вектор для проверки эффективности nucleofection, которая должна быть больше, чем 50%. Кроме того, качество плазмида имеет важное значение. Рекомендуется использовать плазмид без загрязнения эндотоксина (т.е. с помощью Endo-бесплатно Plasmid Maxi Kit для извлечения плазмид). Низкое качество плазмида может привести к значительной гибели клеток и тем самым снижают эффективность перепрограммирования. Мы и другие показали, что гипоксия PROMOTэс IPSC поколения 14,32. Мы промывать гипоксия камеру с газовой смесью , состоящей из 92% N 2, 5% CO 2 и 3% O 2. Если нормоксии используется вместо этого, может быть замечен до снижения 80% эффективности перепрограммирования. После того , как перепрограммирование завершено, иПСК можно культивировать в обычной увлажненной 5% CO 2 инкубаторе. При изменении среды, то удобно , чтобы оставить небольшое количество использованной среды (т.е. 500 мкл на лунку в 6-луночный планшет), а затем добавить свежую среду. Изменение среднего только через день во время перепрограммирования, так как слишком частое изменение среды может привести к снижению ИПСК поколение 33.

Новый протокол мы разработали достиг PB перепрограммирование высокого уровня, которая сравнима с системой SV перепрограммирования. Система EV имеет ряд очевидных преимуществ. С одной стороны, EV является более доступным, чем SV. Система EV также может быть дополнительно модифицирован путем включения дополнительных факторов или различными COMBINAний нескольких факторов, в то время как векторы SVS являются коммерческим продуктом, который не может быть изменен исследователями. Наш текущий протокол включает в себя использование MEF фидерных клеток и животного происхождения , продукты, которые могут ограничивать клиническое применение, но могут быть легко удалены путем разработки дальнейшего протокола 34,35.

иПСК, полученные с помощью этой системы можно использовать не только для моделирования заболеваний и скрининга лекарственных средств, но и для клинической терапии, так как GMP уровня EV Плазмиды могут быть легко сгенерирована и не иПСК со значительной интеграции EV выявлено не было. В клинической практике, как правило, клетки пациента питают болезнь, индуцирующего ген, который должен быть исправлен в ИПСК, прежде чем дифференцировке в функциональные клетки для терапии. Недавний отчет показал , что система EV перепрограммирование может быть легко интегрирована с системой CRISPR / cas9 для достижения одновременного перепрограммирование и редактирования генома после простого nucleofection 36. Эторугой преимущество EV над системой SV. Наши неопубликованные данные показали, что до эффективности редактирования генома 20% может быть достигнуто при кооперационных редактирования генома при Е.В. перепрограммирования. Мы надеемся на то, что интеграция PB перепрограммирования с хрустящей / Cas9R генома редактирования может иметь потенциальное применение при лечении множества заболеваний, которые в противном случае неизлечимой в ближайшие десятилетия.

Таким образом, наш улучшенный протокол перепрограммирование периферической клетки крови должна быть полезной для широкого спектра исследователей в области фундаментальных исследований и клинических применений. Эта эффективная система Е.В. перепрограммирования также могут быть использованы, после модификации, чтобы генерировать интеграции свободных мезенхимальных стволовых клеток (МСК) 37, или нейронные стволовые клетки (NSC , ) 38, непосредственно из взрослых клеток периферической крови , не проходя через стадию иПСК.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Hematopoietic Stem Cell Expansion Medium Sigma S0192 Store at 4 °C
Human Stem Cell Factor (SCF) Peprotech 300-07 Store at -20 or -80 °C
Interleukin-3 (IL-3) Peprotech AF-200-03 Store at -20 or -80 °C
Erythropoietin (EPO) Peprotech 100-64 Store at -20 or -80 °C
Insulin Growth Factor-1 (IGF-1) Peprotech 100-11 Store at -20 or -80 °C
Dexamethasone Sigma D4902 Store at -20 or -80 °C
1-thioglycerol (MTG) Sigma M6145 Store at -20 or -80 °C
DMEM/F12 medium Gibco 112660-012 Store at 4 °C
L-glutamine (100x) Gibco 25030-081 Store at -20 °C
Penicillin/Streptomycin (100x) Gibco 15140-122 Store at -20 °C
Non-essential Amino Acids solution (100x) Gibco 11140-050 Store at 4 °C
Fibroblast Growth Factor 2 (FGF2) Peprotech 100-18B Store at -20 or -80 °C
Insulin-Transferrin-Selenium (ITS, 100x) Gibco 41400-045 Store at 4 °C
Ascorbic acid Sigma 49752 Store at -20 °C
DMEM (high glucose) medium Thermo SH30243.01B Store at 4 °C
Fetal Bovine Serum (FBS) Hyclone SV30087.01 Store at -20 °C
Ficoll GE Healthcare, SIGMA 17-5442-02 Store at RT
Trehalose Sigma T9531 Store at 4 °C
Dimethylsulfoxide (DMSO) Sigma D2650 Store at RT, protect from light
Endofree Plasmid Maxi Kit (10) Qiagen 12362 Store at RT
IMDM Gibco 21056-023 Store at 4 °C
Human CD34+ Cell Nucleofection Kit Lonza VPA-1003 Store at RT, nucleofection buffer and supplement should be stored at 4 °C
Sodium Butyrate Sigma B5887 Store at -20 or -80 °C
ROCK inhibitor - Y27632 STEMGENT 04-0012-10 Store at -20 °C
Essential 8 basal medium (E8) Gibco A15169-01 Store at 4 °C, the supplement should be stored at -20 or -80 °C
Matrigel BD 354277 Store at -20 or -80 °C
2x EasyTaq PCR SuperMix (+dye) TransGen Biotech AS111 Store at -20 °C
Cell detachment solution STEMGENT 01-0006 Store at -20 °C, Accutase as a cell detachment solution to obtain a single-cell suspension
DAPI Sigma D9542-1MG Store at 4 or -20 °C
Anti-Nanog AF488 BD 560791 Store at 4 °C, primary antibody used for Immunofluorescence, dilute 1/100 when used
Anti-OCT4 abcam ab19857 Store at 4 °C, primary antibody used for Immunofluorescence, dilute 1/100 when used
AF488 donkey anti-mouse IgG Invitrogen A21202 Store at 4 °C, secondary antibody used for Immunofluorescence,  dilute 1/500 when used
PE anti-human TRA-1-60-R antibody Biolegend 330610 Store at 4 °C, antibody used for flow cytometry
eFluor 570-conjugated anti-SSEA4 eBioscience 41-8843 Store at 4 °C, antibody used for flow cytometry
Isotype antibody eBioscience 11-4011 Store at 4 °C, antibody used for flow cytometry
Alkaline Phosphatase Detection Kit SiDanSai 1102-100 Store at 4 °C
Genomic DNA Extraction Kit TIANGEN DP304-02 Store at RT
Trypan Blue solution Sigma T8154 Store at RT
Flow cytometry cell analyzer BD LSRII
Spinning Disk Confocal microscope (SDC) PerkinElmer UltraVIEW VOX for confocal imaging
Nucleofection device Lonza Nucleofector 2b for the nucleofection of PB MNC
ImageQuant LAS-4010 GE to take photos of AP staining in bulk

DOWNLOAD MATERIALS LIST

References

  1. Takahashi, K., Yamanaka, S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell. 126, 663-676 (2006).
  2. Takahashi, K., et al. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell. 131, 861-872 (2007).
  3. Trounson, A., McDonald, C. Stem Cell Therapies in Clinical Trials: Progress and Challenges. Cell Stem Cell. 17, 11-22 (2015).
  4. Hayes, M., Zavazava, N. Strategies to generate induced pluripotent stem cells. Methods Mol Biol. 1029, 77-92 (2013).
  5. Zhang, X. B. Cellular reprogramming of human peripheral blood cells. Genomics Proteomics Bioinformatics. 11, 264-274 (2013).
  6. Schlaeger, T. M., et al. A comparison of non-integrating reprogramming methods. Nat Biotechnol. 33, 58-63 (2015).
  7. Okita, K., et al. An efficient nonviral method to generate integration-free human-induced pluripotent stem cells from cord blood and peripheral blood cells. Stem Cells. 31, 458-466 (2013).
  8. Carey, B. W., et al. Reprogramming factor stoichiometry influences the epigenetic state and biological properties of induced pluripotent stem cells. Cell Stem Cell. 9, 588-598 (2011).
  9. Dorigo, O., et al. Development of a novel helper-dependent adenovirus-Epstein-Barr virus hybrid system for the stable transformation of mammalian cells. J Virol. 78, 6556-6566 (2004).
  10. Dowey, S. N., Huang, X., Chou, B. K., Ye, Z., Cheng, L. Generation of integration-free human induced pluripotent stem cells from postnatal blood mononuclear cells by plasmid vector expression. Nat Protoc. 7, 2013-2021 (2012).
  11. Harms, P. W., et al. Next generation sequencing of Cytokeratin 20-negative Merkel cell carcinoma reveals ultraviolet-signature mutations and recurrent TP53 and RB1 inactivation. Mod Pathol. 29, 240-248 (2016).
  12. Abyzov, A., et al. Somatic copy number mosaicism in human skin revealed by induced pluripotent stem cells. Nature. 492, 438-442 (2012).
  13. Martincorena, I., et al. Tumor evolution. High burden and pervasive positive selection of somatic mutations in normal human skin. Science. 348, 880-886 (2015).
  14. Su, R. J., Neises, A., Zhang, X. B. Generation of iPS Cells from Human Peripheral Blood Mononuclear Cells Using Episomal Vectors. Methods Mol Biol. 1357, 57-69 (2016).
  15. Seki, T., et al. Generation of induced pluripotent stem cells from human terminally differentiated circulating T cells. Cell Stem Cell. 7, 11-14 (2010).
  16. Loh, Y. H., et al. Reprogramming of T cells from human peripheral blood. Cell Stem Cell. 7, 15-19 (2010).
  17. Kishino, Y., Seki, T., Yuasa, S., Fujita, J., Fukuda, K. Generation of Induced Pluripotent Stem Cells from Human Peripheral T Cells Using Sendai Virus in Feeder-free Conditions. J Vis Exp. (2015).
  18. Seki, T., Yuasa, S., Fukuda, K. Generation of induced pluripotent stem cells from a small amount of human peripheral blood using a combination of activated T cells and Sendai virus. Nat Protoc. 7, 718-728 (2012).
  19. Gill, S., June, C. H. Going viral: chimeric antigen receptor T-cell therapy for hematological malignancies. Immunological reviews. 263, 68-89 (2015).
  20. Su, R. J., et al. Efficient generation of integration-free ips cells from human adult peripheral blood using BCL-XL together with Yamanaka factors. PLoS One. 8, e64496 (2013).
  21. Li, Y., et al. The p53-PUMA axis suppresses iPSC generation. Nat Commun. 4, 2174 (2013).
  22. Hardwick, J. M., Youle, R. J. SnapShot: BCL-2 proteins. Cell. 138, 404 (2009).
  23. Wen, W., et al. Enhanced Generation of Integration-free iPSCs from Human Adult Peripheral Blood Mononuclear Cells with an Optimal Combination of Episomal Vectors. Stem Cell Reports. 6, 873-884 (2016).
  24. Zhang, X. B., et al. Trehalose ameliorates the cryopreservation of cord blood in a preclinical system and increases the recovery of CFUs, long-term culture-initiating cells, and nonobese diabetic-SCID repopulating cells. Transfusion. 43, 265-272 (2003).
  25. Watanabe, K., et al. A ROCK inhibitor permits survival of dissociated human embryonic stem cells. Nat Biotechnol. 25, 681-686 (2007).
  26. Basu, S., Campbell, H. M., Dittel, B. N., Ray, A. Purification of specific cell population by fluorescence activated cell sorting (FACS). J Vis Exp. (2010).
  27. Castiel, A., et al. Cell death associated with abnormal mitosis observed by confocal imaging in live cancer cells. J Vis Exp. e50568 (2013).
  28. Peterson, S. E., et al. Teratoma generation in the testis capsule. J Vis Exp. e3177 (2011).
  29. Ritner, C., Bernstein, H. S. Fate mapping of human embryonic stem cells by teratoma formation. J Vis Exp. (2010).
  30. Wen, W., et al. Enhanced Generation of Integration-free iPSCs from Human Adult Peripheral Blood Mononuclear Cells with an Optimal Combination of Episomal Vectors. Stem Cell Reports. (2016).
  31. Lo, C. A., et al. Quantification of Protein Levels in Single Living Cells. Cell Rep. 13, 2634-2644 (2015).
  32. Liu, S. P., et al. An improved method for generating integration-free human induced pluripotent stem cells. Zhongguo Shi Yan Xue Ye Xue Za Zhi. 22, 580-587 (2014).
  33. Luni, C., et al. High-efficiency cellular reprogramming with microfluidics. Nat Methods. 13, 446-452 (2016).
  34. Chou, B. K., et al. A facile method to establish human induced pluripotent stem cells from adult blood cells under feeder-free and xeno-free culture conditions: a clinically compliant approach. Stem Cells Transl Med. 4, 320-332 (2015).
  35. Nakagawa, M., et al. A novel efficient feeder-free culture system for the derivation of human induced pluripotent stem cells. Sci Rep. 4, 3594 (2014).
  36. Howden, S. E., et al. Simultaneous Reprogramming and Gene Correction of Patient Fibroblasts. Stem Cell Reports. 5, 1109-1118 (2015).
  37. Meng, X., et al. Rapid and efficient reprogramming of human fetal and adult blood CD34+ cells into mesenchymal stem cells with a single factor. Cell research. 23, 658-672 (2013).
  38. Liao, W., et al. Direct Conversion of Cord Blood CD34+ Cells Into Neural Stem Cells by OCT4. Stem cells translational medicine. 4, 755-763 (2015).
Генерация интеграции свободных индуцированные плюрипотентные стволовые клетки из человеческих мононуклеарных клеток периферической крови с помощью эписомальные векторы
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Wen, W., Zhang, J. P., Chen, W., Arakaki, C., Li, X., Baylink, D., Botimer, G. D., Xu, J., Yuan, W., Cheng, T., Zhang, X. B. Generation of Integration-free Induced Pluripotent Stem Cells from Human Peripheral Blood Mononuclear Cells Using Episomal Vectors. J. Vis. Exp. (119), e55091, doi:10.3791/55091 (2017).More

Wen, W., Zhang, J. P., Chen, W., Arakaki, C., Li, X., Baylink, D., Botimer, G. D., Xu, J., Yuan, W., Cheng, T., Zhang, X. B. Generation of Integration-free Induced Pluripotent Stem Cells from Human Peripheral Blood Mononuclear Cells Using Episomal Vectors. J. Vis. Exp. (119), e55091, doi:10.3791/55091 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter