Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Developmental Biology

Generation Integrations-fria inducerade pluripotenta stamceller från humant perifert blod mononukleära celler med användning av episomala vektorer

doi: 10.3791/55091 Published: January 1, 2017

Abstract

Inducerade pluripotenta stamceller (iPSCs) är mycket lovande för sjukdom modellering och regenerativ behandlingar. Vi har tidigare rapporterat användning av episomala vektorer (EV) för att generera integrationsfria iPSCs från perifera mononukleära blodceller (PB MNC). De episomala vektorer som används är DNA-plasmider införlivas med oriP och EBNA1 element från Epstein-Barr (EB) -virus, som möjliggör replikation och långsiktiga kvarhållande av plasmider i däggdjursceller, respektive. Med ytterligare optimering, kan tusentals IPSC kolonier erhållas från 1 ml perifert blod. Två kritiska faktorer för att uppnå hög omprogrammering effektivitet är: 1) användningen av en 2A "självklyvning" peptid att länka Oct4 och Sox2 på så sätt åstadkomma ekvimolär uttryck av de två faktorerna; 2) användningen av två vektorer för att uttrycka MYC och Klf4 individuellt. Här beskriver vi en steg-för-steg-protokoll för att generera integration fritt iPSC från vuxna perifera blodprover. Den genererade iPSCs är integration fritt som rest episomala plasmider är omätbara efter fem passager. Även om omprogrammering effektivitet är jämförbar med den för Sendai-virus (SV) vektorer, EV plasmider är betydligt mer ekonomiskt än de kommersiellt tillgängliga SV vektorer. Detta prisvärda EV omprogrammering systemet har potential för kliniska tillämpningar inom regenerativ medicin och ger en metod för direkt omprogrammering av PB multinationella till integrationsfria mesenkymala stamceller, neurala stamceller, osv.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Efter tvångs uttrycket av flera transkriptionsfaktorer (Dvs. Oct4, Sox2, MYC och Klf4), somatiska celler kan omprogrammeras till inducerade pluripotenta stamceller (iPSCs), som är mycket lovande för tillämpningar inom regenerativ medicin och cellersättningsterapi 1-3. Hittills har olika metoder utvecklats för att öka andelen framgångsrika omprogrammering 4-7. Virala vektorer-inducerade omprogrammering är allmänt används för effektiv generering av iPSCs, eftersom viral integration leder till en hög nivå och stabil expression av de omprogrammering faktorer. Emellertid kan permanent integrering av vektor-DNA i cellgenomet inducera insertionsmutationer 5. Dessutom kan otillräcklig inaktivering av omprogrammering faktorer störa iPSCs differentiering 8. Som sådan, är användningen av iPSCs utan integration av omprogrammering faktorer viktigt, speciellt för användning i cellterapi applikationer.

9. Den oriP elementet främjar plasmid replikation i däggdjursceller, medan EBNA1 elementet binda den oriP-innehållande plasmid DNA till kromosomalt DNA som möjliggör en uppdelning av episom under uppdelningen av värdcellen. I jämförelse med andra integrationsfria metoder, inklusive Sendai-virus (SV) och RNA-transfektion, elbilar har flera fördelar 5,6,10. Som plasmid-DNA, kan elfordon lätt framställas och modifieras i huset, vilket gör dem extremt prisvärd. Dessutom omprogrammering med EV är en mindre arbetsintensiv process eftersom en enda transfektion med elbilar är tillräcklig för iPSC generation, medan flera RNA-transfektioner är nödvändiga för framgångsrik omprogrammering.

DErmal fibroblaster har använts i många omprogrammering studier. Emellertid är hudbiopsi inte bara en invasiv och smärtsam process, men också tidskrävande för att expandera celler till tillräckliga mängder för omprogrammering. Av större betydelse, har hudceller av vuxna donatorer ofta utsatts för långsiktig UV-strålning, vilket kan leda till mutationer associerade med tumörer, vilket begränsar ansökningarna om iPSCs härrör från hudfibroblaster 11,12. Nyligen har det rapporterats att normala humana hudceller ansamlas somatiska mutationer och flera cancergener, inklusive de flesta av de viktigaste drivkrafterna för kutan skivepitelcancer, är under stark positiv selektion 13.

I motsats till hudfibroblaster, perifert blod (PB) celler är en föredragen källa av celler för omprogrammering eftersom 1) blodkroppar kan lätt erhållas genom en minimalt invasiv process, 2) perifera blodceller är avkomman av hematopoietiska stamcellerbosatt i benmärgen, vilket skyddas från skadlig strålning. Perifera mononukleära blodceller (PB MNC) kan samlas i en timme från koncentratskiktet följa en enkel gradient centrifugering med användning av Ficoll-Hypaque (1,077 g / ml). De erhållna PB multinationella består av lymfocyter, monocyter och några hematopoetiska progenitorceller (HPC) 14. Även om humana T-lymfocyter är en av de huvudsakliga celltyperna i PB, mogna T-celler innehåller omlagringar av T-cellreceptorn (TCR) -gener och saknar en intakt genomet vilket sålunda begränsar deras potential för tillämpningar 15,16. Emellertid kan föryngring av T-celler via iPSC generation har potentiella tillämpningar inom chimär Antigen Receptor (CAR) T-cellterapi 17-19. I jämförelse, HPC har en intakt genom och är lätt omprogrammerbara. Även om endast 0,01-0,1% celler i perifera cirkulationen är HPC, kan dessa celler utökas ex vivo i erytroid medium som gynnar spridningen av erythrOID progenitorceller 14.

I vår tidigare studie använde vi faktor BCL-XL utöver Yamanaka faktorer (Oct4, Sox2, MYC och Klf4), vilket resulterade i en ökning av PB omprogrammering verkningsgrad 20 10x. BCL-XL, även känd som BCL2L1, är en potent hämmare av celldöd, genom att hämma aktivering av caspaser 21,22. Men, kan BCL-XL också spela en viktig roll för att upprätthålla pluripotens 21,22. Nyligen har vi ytterligare optimerat vår EV omprogrammering systemet genom att separat uttrycka MYC och Klf4 med två vektorer, vilket leder till en ungefär 100x ökning av omprogrammering effektivitet 23. Med användning av denna metod, omprogrammeringen effektivitet, definierat av koloniantal dividerat med utgångscellantalet vid transfektion, är från 0,2 till 0,5% från friska donatorer. Enligt följande, beskriver vi den detaljerade experimentella förfarandet för generering av integrationsfria iPSCs från PB.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Alla humana PB samplar erhölls från anonyma vuxna givare utan identifieringsinformation tillgänglig från Tianjin Blood Center med godkännande av den lokala forskningsetiska kommittén.

1. Endo-free Plasmidberedning

  1. Använda ett kommersiellt Plasmid Purification Maxi Kit för att extrahera episomala vektorer från E. coli enligt tillverkarens protokoll. För det sista steget, för att ersätta TE-buffert med endotoxinfritt sterilt vatten upplösa DNA-pelleten.
  2. Mät DNA-koncentrationen med hjälp av en kommersiell UV / Vis-spektrofotometer. Koncentrationen är vanligen större än 1 mikrogram / mikroliter, med A260 / A280 och A260 / A230-förhållanden större än 1,8 och 2,0, respektive.

2. Kultur Media

  1. Förbereda erytroid medium: Hematopoietic Stem Cell Expansion Medium kompletterat med 100 ng / ml humant stamcellfaktor (SCF), 10 ng / ml Interleukin-3 (IL3), 2 U / ml erytropoietin (EPO), 20 ng / ml insulin tillväxtfaktor 1 (IGF1), 1 | iM dexametason och 0,2 mM 1-tioglycerol. Filtrera sterilisera med en 0,22 fim sprutfilter. Erytroid-medium kan förvaras vid 4 ° C i upp till en månad.
  2. Förbereda iPSC medium: DMEM / F12-medium (Dulbeccos Modified Eagle Medium / Nutrient Mixture F-12) kompletterat med 1 x L-glutamin, 1 x penicillin / streptomycin, 1x icke-essentiella aminosyror lösning, 50 ng / ml fibroblasttillväxtfaktor 2 (FGF2 ), 1x Insulin-Transferrin-Selenit tillägg (ITS), och 50 mg / ml askorbinsyra. Filtrera sterilisera med en 0,22 fim sprutfilter. iPSC-medium kan förvaras vid 4 ° C i upp till en månad.
  3. Förbereda MEF-medium: Dulbeccos modifierade Eagles-medium (DMEM, hög glukos) kompletterad med 1x penicillin / streptomycin och 10% fetalt bovint serum (FBS). Filtrera sterilisera med en 0,22 fim sprutfilter. MEF-medium kan förvaras vid 4 ° C i upp till en månad eller färsk lägga 1x L-glutamin före användning.
  4. Prepare iPSC kryokonservering medium (2x): Lös 5 g D-trehalos i 30 ml sterilt vatten i en 37 ° C vattenbad. Bringa temperaturen till 4 ° C och tillsätt sedan 10 ml av FBS och 10 ml dimetylsulfoxid (DMSO). Filtrera sterilisera med en 0,22 fim sprutfilter. Förvara vid 4 ° C i upp till 3 månader 24.

3. Isolering av perifera mononukleära blodceller (PB MNC)

  1. Kombinera 10 ml färskt PB prov och 10 ml PBS-buffert i ett 50 ml rör och blanda väl. Föra PBS till RT eller 37 ° C före användning.
    OBS: Cirka 1 - 3 x 10 6 MNC (färska eller frysförvarade) kan erhållas från en ml PB. Efter 6 d av kultur, räknar med att ha 0,5 - 1 x 10 6 totala celler tack vare död av mogna celler under odling. Ca 1 x 10 7 celler kan erhållas från 10 ml av färskt PB.
  2. Tillsätt 10 ml Ficoll till botten av röret med hjälp av en 10 ml spruta fäst vid en lång nål. denna process bör ske långsamt för att säkerställa att Ficoll skiktet inte blandar sig med PB.
  3. Centrifugera vid 400 xg under 30 minuter vid en låg hastighet acceleration och retardation. Efter centrifugering, de PB MNC är i det vita skiktet (buffy coat) som är belägen mellan PB plasma och Ficoll.
  4. Långsamt aspirera ~ 10 ml PB plasma utan att störa koncentratskiktet. Noggrant skörda vita lagret med hjälp av en 1 ml pipettspets till en ny 50 ml tub. Den totala volymen av uppsamlade cellerna från den vita lagret kommer att vara mellan 3-6 ml.
  5. Lägg PBS för att få den totala volymen till 30 ml och blanda väl med en 10 ml pipett. Centrifugera vid 400 xg under 10 min.
  6. Avlägsna supernatanten och återsuspendera cellpelleten i 20 ml odlingsmedium (dvs Iscoves modifierade Dulbeccos medium, IMDM) och blanda väl. Centrifugera vid 400 xg under 10 min för att avlägsna huvuddelen av blodplättarna.
  7. Avlägsna supernatanten och resuspendera cellpelleten i 1-2 ml IMDM. Celler kan användas feller omedelbar kultur, eller fryst ner för senare användning. För kryokonservering, lägga till en lika stor mängd av frysförvaring medium. Alikvotera celler i cryovials (0,5 - 1 ml per flaska) och överförings kryokärl till en -80 ° C frys omedelbart. PB MNC kan lagras i -80 ° C frys under flera veckor eller överföras till en flytande kväve tank för långtidsförvaring.
    OBS: När upptining av frusna celler, men vår frysförvaring mediet kan upprätthålla cellviabiliteten, kan antalet celler minska på grund av celldöd under upptiningsprocessen. Det rekommenderas att en - 10 x 10 7 celler kommer att frysas i varje flaska.

4. Utbyggnad av PB multinationella i erytroid Medium

  1. Förbereda 5 ml IMDM-medium i ett 15 ml rör. Snabbt tina de frusna PB multinationella i en 37 ° C vattenbad och sedan överföra dem till röret med IMDM-medium.
    OBS: Den tid i vattenbad beror på volymen av de kryokonserverade cellerna och cryovial uSED. Vanligtvis kommer den frusna cellen tinar inom 1 min.
  2. Centrifugera vid 400 xg under 5 till 10 min. Avlägsna supernatanten och resuspendera cellpelleten i erytroid medium. Tillsätt 10 mikroliter Trypan Blue-lösning till 10 mikroliter cellsuspension och blanda väl. Trypan Blue färgar döda celler inom 1-3 min. Räkna cellerna under mikroskop med hjälp av en hemocytometer.
  3. Kultur PB MNC i en icke-vävnadskultur (icke-TC) behandlades 6-brunnars platta med 2 ml medium per brunn, vid en celldensitet av ~ 5 x 10 6 celler / ml, vid 37 ° C i en 5% CO2 fuktad inkubator.
  4. Tillsätt 1 ml färskt erytroid mediet direkt till varje brunn utan ändring av mediet vid D 3 och 5.
  5. Vid D 6, skörda PB multinationella för nucleofection.

5. PB MNC Nucleofection och Omprogrammering

  1. En dag före nucleofection, förbeläggning TC-behandlade sex-brunnars plattor med 0,1% gelatin vid 37 ° C under 20 min. Tö inaktiv Murin Embryonala Fibroblast (MEF) feeder celler i ett 37 ° C vattenbad och omedelbart överföra dem till en 15 ml rör innehållande 5 ml MEF medium.
  2. Centrifugera vid 400 xg under 5 min och avlägsna supernatanten. Ta gelatinet från 6-brunnar, suspendera cellpelleten i MEF medium och överföra dem till gelatin förbehandlas 6-brunnar. I varje brunn, utsädes 2 - 4 x 10 5 inaktiverade MEF celler suspenderades i 2 ml MEF medium.
  3. Kultur MEF matarceller vid 37 ° C i en 5% CO2 fuktad inkubator.
  4. På dagen för nucleofection, aspirera MEF medium och ersätta det med en ml erytroid medium. Pre-jämvikt odlingsplattan för 10-30 min vid 37 ° C i en 5% CO2 fuktad inkubator.
  5. Tillsätt 2 mikrogram pEV-OCT4-2A-Sox2, 1 mikrogram pEV-MYC, 1 mikrogram pEV-Klf4 och 0,5 mikrogram pEV-BCL-XL i en 1,5 ml sterilt Eppendorf-rör. Värm röret vid 50 ° C under 5 min för att förhindra kontaminering, och kyla ner till RT. Lägg till57 mikroliter nucleofection buffert och 13 pl komplement.
  6. Harvest 2 x 10 6 odlade PB multinationella till en 5 ml rör genom centrifugering vid 200 xg under 7 min. Avlägsna supernatanten och tillsätt plasmiden och nucleofection buffertblandning till cellpelleten. Blanda väl genom att ställa röret med fingret.
    OBS: Så lite som 2 x 10 5 celler kan användas för nucleofection, men en lägre omprogrammering effektivitet bör förväntas också.
  7. Överföra DNA och cellsuspension till kyvetten finns i kitet och locket kuvetten. Välj program U-008 på nucleofection enheten. Sätt kyvetten i hållaren och tryck på OK för att tillämpa U-008 program.
  8. Ta kuvetten ur hållaren, tillsätt 0,5-1 ml förvärmda erytroid mediet i varje kyvett, och överföra cellerna till förekvilibrerad MEF plattan omedelbart. Grund av den höga omprogrammering effektivitet och donator variation, sådd olika antal celler som sträcker sig från 1-10 x 10 5 celler per väl mycket uppmuntras.
  9. Överför plattan till en hypoxi kammare och spola kammaren med en blandad gas sammansatt av 92% N 2, 5% CO2 och 3% O2, 1 - 2 min vid en hastighet av 20 l / min. Efter försegling av kammaren, odla cellerna vid 37 ° C.
  10. Vid D 2 post-nucleofection, tillsätt 2 ml iPSC mediet direkt till varje brunn.
  11. Vid D 4 efter nucleofection, ta bort 3 ml medium och tillsätt 2 ml färskt iPSC medium. Vid D 4 post-nucleofection, de flesta av de levande cellerna kommer att ha fäst till matarskikt.
  12. Efter D 6 efter nucleofection ändra mediet var 2 d genom att lämna 500 mikroliter använt medium och tillsätta 2 ml färskt E8 medium kompletterat med 0,25 mM natriumbutyrat tills D 14-18.
    OBS: Ytterligare matarceller kan tillsättas i odlingsbrunnarna när observera att matar cellerna har lossnat. Efter upptining MEF (se 5.1 och 5.2), resuspendera cellpelleten i en liten volym E8 medium (dvs ~ 0.2 ml för en brunn i en 6-brunnsplatta) och tillsätt sedan MEFs in i odlingsbrunnar. Ca 2% FBS kan tillsättas för att öka cellvidhäftning. Alternativt kan MEF-konditionerat medium också användas, men det är mer arbetskrävande.

6. Expansion av iPSCs

OBS: I de flesta fall, ett stort antal IPSC kolonier visas på D 8-10 post nucleofection. Efter D 14, stora IPSC kolonier är vanligtvis redo för plockning.

  1. Innan plocka kolonier, tillsätt 500 mikroliter E8-medium kompletterat med ROCK-inhibitor, Y27632 (10 ^ M), i en brunn i en matare eller Matrigel belagda 24-brunnsplatta. Använd en 10 eller 20 mikroliter pipett för att skrapa och plocka kolonier under mikroskop. Överföra bitarna av varje koloni till brunnarna innehållande odlingsmediet.
    OBS: Koncentrationen av Matrigel skiljer sig från ett parti till ett annat. Vanligtvis använder vi 1: 100 utspädning av Matrigel.
    1. För att undvika korskontaminering, plockakolonier som är stora och väl åtskilda från andra. Odlings iPSCs vid 37 ° C i en 5% CO2 fuktad inkubator.
      OBS: Det bör vara notera att iPSC populationen kan vara polyklonala på grund av cellmigration när det finns dussintals eller hundratals kolonier i varje brunn i en 6-brunnsplatta.
  2. Ändrar inte medium för första 2 d. ROCK-inhibitor kan främja överlevnaden av små kolonier 25.
  3. Från D 2 och framåt, ändra medel varje dag genom att avlägsna förbrukat medium och tillsats av 500 mikroliter färskt E8 medium i varje brunn.
  4. Ungefär en vecka senare, när kolonierna är tillräckligt stora, avlägsna mediet och behandla cellerna med 300 mikroliter celllösgörlösning (0,5 mM EDTA i PBS) vid 37 ° C under 1 - 3 min. Ta bort cell lossnar lösning och tillsätt E8 medium innehållande ROCK-hämmare (10 ^ M) för att avbryta iPSCs. Inte bryta ner kolonier i enskilda celler, vilket kan leda till överdriven celldöd. De cellklumpar med 5-50 cells är lämpliga för iPSC passagen.
  5. Överför 50 - 100% av cellsuspensionen till varje brunn av en 12- eller 6-brunnar som har förbelagts med matare eller Matrigel.
  6. För långtidsodling i Matrigel-belagda plattor (se not i 6.1), ändra mediet varje dag. När cellsammanflytning når 40-60%, behandla cellerna med en ml celllösgörlösning (0,5 mM EDTA i PBS) vid 37 ° C under ~ 3 min. När kolonierna börjar krypa upp, ta bort cellen lossnar lösning och tillsätt E8 medium innehållande ROCK-hämmare (10 ^ M) för att suspendera iPSCs. Passage celler med en delning faktor 4 - 8. ROCK-hämmare bör läggas vid passage celler för att öka överlevnaden och bort en d senare för att förhindra differentiering.
  7. Att frysa ner iPSCs, behandla celler med cell lossnar lösning vid 37 ° C under 3-5 minuter enligt tillverkarens protokoll. När IPSC kolonier börjar krypa upp, aspirera buffert och tillsätt 0,5-1 ml E8 medium.
  8. <li> Lägg till en lika stor volym kryokonservering mediet till cellsuspensionen och blanda väl. Fryst iPSCs kan lagras i en -80 ° C frys under flera veckor eller i flytande kväve för långtidslagring.

7. Val av iPSCs utan Rest Episomalt plasmider

  1. Efter passage 5, skörd iPSCs och extrahera genomiskt DNA.
    OBS: Vanligtvis efter 5 passager av kultur, rest episomala plasmider är omöjlig att upptäcka. Således, nästan alla IPSC kolonier vid passager över 5 (dvs passage 10) saknas rest episomala plasmider.
  2. Använda genomiskt DNA från otransfekterade PB MNC som en negativ kontroll. Lägg 1,6 pg pEV-OCT4-2A-Sox2 plasmid i ett mikrogram negativ kontroll DNA för att efterlikna celler med en kopia av pEV plasmid per cell.
  3. Lägg 9 mikroliter PCR-kvalitet vatten med 100 ng genomiskt DNA och 1 mikroliter specifika primers (10 ^ M vardera av framåt och bakåt primers) i 10 mikroliter hifi-PCR Master Mix. Normalisera amount av DNA genom GAPDH. Använd följande primers för PCR: EBNA1-F TTTAATACGATTGAGGGCGTCT, EBNA1-R GGTTTTGAAGGATGCGATTAAG, WPRE-F GGTTTAAACGCGTCGACAAT, WPRE-R GTTGCGTCAGCAAACACAGT, GAPDH-F GAGTCCACTGGCGTCTTC, GAPDH-R GACTGTGGTCATGAGTCCTTC.
  4. Inkubera reaktionsblandningen vid 98 ° C under 60 s; följt av 98 ° C under 10 s, 60 ° C under 30 s och 72 ° C under 30 s. Efter 30 cykler; förlänga reaktionen vid 72 ° C under 5 min.
  5. Last 5 mikroliter PCR-produkter i varje brunn i en 1% agarosgel. Kör gelen för 20-30 minuter vid 100 V. Välj IPSC kloner med odetekterbara band för EBNA1 och WPRE för ytterligare kultur och nedströms analys.

8. Flödescytometri

  1. Harvest iPSCs genom att behandla dem med Accutase vid 37 ° C under 3-5 minuter för att erhålla en enkelcellsuspension. Tillsätt 1 mikroliter PE-konjugerat anti-TRA-1-60 eller eFluor 570-konjugerad anti-SSEA4 eller Isotypisk antikropp till 100 mikroliter av cellsuspensionen (1 - 5 x 10 5 celler) I 5 ml rör. Inkubera rören i en mörk plats vid rumstemperatur under 20 minuter.
  2. Efter färgning under 20 minuter vid RT, tillsätt 2 ml PBS och centrifugera vid 400 xg under 5 min. Resuspendera cellerna i 300 mikroliter PBS för fluorescensaktiverad cellsortering (FACS) analys med användning av en flödescytometri cell analysator. 23,26

9. Confocal avbildning

  1. Seed iPSCs i Matrigel belagda kammare diabilder.
  2. Efter 3-4 d av kultur, avlägsna tillväxtmediet och fäst med 4% paraformaldehyd (PFA) vid RT under 30 min. Tvätta cellerna två gånger med PBS.
    Obs: PFA är giftiga och skadliga.
  3. Behandla cellerna med 0,1% Triton X-100 i PBS (PBS-T) vid RT under 30 min. Tvätta cellerna två gånger med PBS.
  4. Blockera cellerna med blockeringsbuffert (5% getserum i PBS, V: V) vid RT under 1 h.
  5. Under blockeringssteget, späd den primära antikroppen (100x) i blockerande buffert.
    OBS! Antikroppar listas i tabellen of Materials / Utrustning.
  6. Inkubera cellerna med utspädd antikropp vid 4 ° CO / N.
  7. Tvätta två gånger med PBS-T under 15 min, följt av två gånger med PBS under 15 min.
  8. Inkubera celler med en utspädd fluorofor-konjugerad sekundär antikropp vid RT under 2 h.
  9. Tvätta cellerna två gånger med PBS-T under 15 min, följt av två gånger med PBS under 15 min.
  10. Färga kärnan med DAPI (1 ^ g / ml) i PBS vid RT under 10 min.
  11. Tvätta cellerna två gånger med PBS under 15 min.
  12. Ta bilder med en konfokalmikroskop. 23,27

10. Teratom Assay

Skörd 1 x 10 6 iPSCs med celllösgörlösning (0,5 mM EDTA i PBS) och återsuspendera cellerna i 200 mikroliter DMEM / F12 utspäddes (1: 1) Matrigel.

  1. Subkutant injicera celler i den bakre höft av NOD / SCID möss med immunbrist.
  2. Vid 8 - 12 veckor efter iPSC injektion, dissekera och fixa teratom i 10% formalin. 28
  3. Efter microsectioning ochfärgning med hematoxylin och eosin (H & E), analysera prov. 29

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Med hjälp av detta protokoll, kan vi få hundratals kolonier från 1 x 10 5 nucleofected PB MNC (figurerna 1A och 1B). Omprogrammering effektivitet är cirka 0,2 till 0,5% och kolonierna uttrycker pluripotens markörer (figurerna 1C och 1D). iPSCs fram med hjälp av den beskrivna protokollet är integration fria och har förmågan att bilda teratom komponera 3 germinallager (figurerna 1E och 1F).

Figur 1
Figur 1: Generering av Integration fria iPSCs från perifera mononukleära blodceller. (A): En schematisk av protokollet för omprogrammering perifera blodceller. (B): AP färgning i bulk (till vänster) och en typisk ESC-liknande iPSC koloni (höger)60; 14 d efter PB MNC nucleofection. Skala bar: 100 nm. (C): Representativa FACS diagram av iPSCs vid passage 5 uttrycker TRA-1-60 eller SSEA4. (D): Representant konfokala bilder av IPSC kolonier uttrycker NANOG och Oct4. Skala bar: 100 nm. (E): representativ bild av helheten och H & E färgning av teratom som omfattar alla tre bakterieskikten. Skala bar: 100 nm. (F): Kopiera antal rest EV plasmider i iPSCs efter fem passager. Specifika primrar för EBNA1 och WPRE användes för att amplifiera episomala vektorer. GAPDH användes som en DNA-laddningskontroll. UD, omöjlig att upptäcka. Den positiva körfält indikerar en enda kopia kontroll. Klicka här för att se en större version av denna siffra.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Förvärva blodprov från friska donatorer eller patienter är bekvämt och icke-invasivt, vilket gör det till en attraktiv cellkälla för grundforskning och klinisk cellterapi. Här har vi beskrivit ett protokoll för effektiv generering av integrationsfria iPSCs från perifera blodprover. Detta reproducerbar och prisvärd strategi bör gynna iPSC fältet.

Vi har rapporterat att det finns två viktiga faktorer som ansvarar för effektiv PB omprogrammering 30. En är ekvimolär uttryck av Oct4 och Sox2 med hjälp av en 2A länk 31. För att uppnå detta är pEV-OCT4-2A-Sox2 används i detta protokoll. Den andra är användningen av två plasmider pEV-Myc och pEV-Klf4 att uttrycka MYC och Klf4 istället för pEV-MYC-2A-Klf4 som vi tidigare har använt 30. Den till synes enkel förändring leder till en cirka 100X ökning av PB omprogrammering effektivitet, vilket till stor del beror på en gradvis och större ökning i MYC: KLF4 förhållande under processen.

Flera punkter bör övervägas för att uppnå hög effektivitet iPSC generation från PB. PB multinationella odlas för ~ 1 vecka i erytroid-medium, som främjar spridning och expansion av erytroida progenitorceller och därmed ökar omprogrammering effektivitet 20. Men för vissa prover, särskilt för blodceller från leukemipatienter, celler överlever dåligt när de odlas i erytroid medium. I detta fall skulle det vara bra att minska odling tid. Det är också uppmuntras att använda 1 - 2 | j, g pmaxGFP vektor för att verifiera nucleofection effektivitet, vilket bör vara större än 50%. Dessutom är det viktigt plasmiden kvalitet. Det rekommenderas att använda plasmider utan förorening endotoxin (dvs. med hjälp av Endo-fri plasmid Maxi Kit för att extrahera plasmider). Dålig plasmid kvalitet kan leda till betydande celldöd och därmed minska omprogrammering effektivitet. Vi och andra har visat att hypoxi Promotes iPSC generation 14,32. Vi spola hypoxi kammaren med en blandad gas sammansatt av 92% N 2, 5% CO2 och 3% O2. Om normoxi används istället, kan ett upp till 80% minskning av omprogrammering effektivitet följas. När väl omprogrammering är klar kan iPSCs odlas i en regelbunden humidifierad 5% CO2 inkubator. Vid byte medium är det praktiskt att lämna en liten mängd förbrukat medium (dvs 500 mikroliter per brunn i en 6-brunnar), och sedan lägga till färskt medium. Ändra medel bara varannan dag under omprogrammering, som alltför ofta medel förändring kan minska iPSCs generation 33.

Det nya protokollet har vi utvecklat har uppnått en hög nivå PB omprogrammering som är jämförbar med den SV omprogrammering systemet. EV-systemet har flera uppenbara fördelar. För en, är EV billigare än SV. EV-systemet kan också modifieras ytterligare genom att ta med ytterligare faktorer eller olika combinaningar av flera faktorer, medan SVS vektorer är en kommersiell produkt som inte kan ändras av utredare. Vår nuvarande protokollet innefattar användning av MEF matarceller och animaliska produkter, vilket kan begränsa de kliniska tillämpningar, men kan lätt avlägsnas genom tilläggsprotokoll utveckling 34,35.

iPSCs genereras med detta system kan användas inte bara för sjukdom modellering och läkemedelsscreening, men också för klinisk behandling, eftersom GMP-nivå EV plasmider kan lätt genereras och har identifierats inga iPSCs med betydande integration EV. I kliniska tillämpningar, patientceller hyser vanligtvis en sjukdom framkallande genen, som måste korrigeras i iPSCs innan differentiering till funktionella celler för terapi. En färsk rapport visar att EV omprogrammering Systemet kan enkelt integreras med crispr / Cas9 system för att uppnå samtidig omprogrammering och genom redigering efter en enkel nucleofection 36. Det här är ennother fördel med EV över SV systemet. Våra opublicerade data har visat att upp till 20% genom redigering effektivitet kan uppnås när piggybacking genomet redigering på EV omprogrammering. Det är vår förhoppning att integrationen av PB omprogrammering med skarpa / Cas9R genomet redigering kan ha potentiella tillämpningar vid behandling av flera sjukdomar som annars obotliga under de kommande decennierna.

Sammanfattningsvis bör vår förbättrade perifera blodkroppar omprogrammering protokollet vara användbar för ett brett spektrum av utredare inom grundforskning och kliniska tillämpningar. Denna effektiva EV omprogrammering systemet kan också användas, efter modifieringar, för att generera integrationsfria mesenkymala stamceller (MSC) 37, eller neurala stamceller (NSCs) 38, direkt från vuxna perifera blodceller utan att passera en iPSC skede.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Hematopoietic Stem Cell Expansion Medium Sigma S0192 Store at 4 °C
Human Stem Cell Factor (SCF) Peprotech 300-07 Store at -20 or -80 °C
Interleukin-3 (IL-3) Peprotech AF-200-03 Store at -20 or -80 °C
Erythropoietin (EPO) Peprotech 100-64 Store at -20 or -80 °C
Insulin Growth Factor-1 (IGF-1) Peprotech 100-11 Store at -20 or -80 °C
Dexamethasone Sigma D4902 Store at -20 or -80 °C
1-thioglycerol (MTG) Sigma M6145 Store at -20 or -80 °C
DMEM/F12 medium Gibco 112660-012 Store at 4 °C
L-glutamine (100x) Gibco 25030-081 Store at -20 °C
Penicillin/Streptomycin (100x) Gibco 15140-122 Store at -20 °C
Non-essential Amino Acids solution (100x) Gibco 11140-050 Store at 4 °C
Fibroblast Growth Factor 2 (FGF2) Peprotech 100-18B Store at -20 or -80 °C
Insulin-Transferrin-Selenium (ITS, 100x) Gibco 41400-045 Store at 4 °C
Ascorbic acid Sigma 49752 Store at -20 °C
DMEM (high glucose) medium Thermo SH30243.01B Store at 4 °C
Fetal Bovine Serum (FBS) Hyclone SV30087.01 Store at -20 °C
Ficoll GE Healthcare, SIGMA 17-5442-02 Store at RT
Trehalose Sigma T9531 Store at 4 °C
Dimethylsulfoxide (DMSO) Sigma D2650 Store at RT, protect from light
Endofree Plasmid Maxi Kit (10) Qiagen 12362 Store at RT
IMDM Gibco 21056-023 Store at 4 °C
Human CD34+ Cell Nucleofection Kit Lonza VPA-1003 Store at RT, nucleofection buffer and supplement should be stored at 4 °C
Sodium Butyrate Sigma B5887 Store at -20 or -80 °C
ROCK inhibitor - Y27632 STEMGENT 04-0012-10 Store at -20 °C
Essential 8 basal medium (E8) Gibco A15169-01 Store at 4 °C, the supplement should be stored at -20 or -80 °C
Matrigel BD 354277 Store at -20 or -80 °C
2x EasyTaq PCR SuperMix (+dye) TransGen Biotech AS111 Store at -20 °C
Cell detachment solution STEMGENT 01-0006 Store at -20 °C, Accutase as a cell detachment solution to obtain a single-cell suspension
DAPI Sigma D9542-1MG Store at 4 or -20 °C
Anti-Nanog AF488 BD 560791 Store at 4 °C, primary antibody used for Immunofluorescence, dilute 1/100 when used
Anti-OCT4 abcam ab19857 Store at 4 °C, primary antibody used for Immunofluorescence, dilute 1/100 when used
AF488 donkey anti-mouse IgG Invitrogen A21202 Store at 4 °C, secondary antibody used for Immunofluorescence,  dilute 1/500 when used
PE anti-human TRA-1-60-R antibody Biolegend 330610 Store at 4 °C, antibody used for flow cytometry
eFluor 570-conjugated anti-SSEA4 eBioscience 41-8843 Store at 4 °C, antibody used for flow cytometry
Isotype antibody eBioscience 11-4011 Store at 4 °C, antibody used for flow cytometry
Alkaline Phosphatase Detection Kit SiDanSai 1102-100 Store at 4 °C
Genomic DNA Extraction Kit TIANGEN DP304-02 Store at RT
Trypan Blue solution Sigma T8154 Store at RT
Flow cytometry cell analyzer BD LSRII
Spinning Disk Confocal microscope (SDC) PerkinElmer UltraVIEW VOX for confocal imaging
Nucleofection device Lonza Nucleofector 2b for the nucleofection of PB MNC
ImageQuant LAS-4010 GE to take photos of AP staining in bulk

DOWNLOAD MATERIALS LIST

References

  1. Takahashi, K., Yamanaka, S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell. 126, 663-676 (2006).
  2. Takahashi, K., et al. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell. 131, 861-872 (2007).
  3. Trounson, A., McDonald, C. Stem Cell Therapies in Clinical Trials: Progress and Challenges. Cell Stem Cell. 17, 11-22 (2015).
  4. Hayes, M., Zavazava, N. Strategies to generate induced pluripotent stem cells. Methods Mol Biol. 1029, 77-92 (2013).
  5. Zhang, X. B. Cellular reprogramming of human peripheral blood cells. Genomics Proteomics Bioinformatics. 11, 264-274 (2013).
  6. Schlaeger, T. M., et al. A comparison of non-integrating reprogramming methods. Nat Biotechnol. 33, 58-63 (2015).
  7. Okita, K., et al. An efficient nonviral method to generate integration-free human-induced pluripotent stem cells from cord blood and peripheral blood cells. Stem Cells. 31, 458-466 (2013).
  8. Carey, B. W., et al. Reprogramming factor stoichiometry influences the epigenetic state and biological properties of induced pluripotent stem cells. Cell Stem Cell. 9, 588-598 (2011).
  9. Dorigo, O., et al. Development of a novel helper-dependent adenovirus-Epstein-Barr virus hybrid system for the stable transformation of mammalian cells. J Virol. 78, 6556-6566 (2004).
  10. Dowey, S. N., Huang, X., Chou, B. K., Ye, Z., Cheng, L. Generation of integration-free human induced pluripotent stem cells from postnatal blood mononuclear cells by plasmid vector expression. Nat Protoc. 7, 2013-2021 (2012).
  11. Harms, P. W., et al. Next generation sequencing of Cytokeratin 20-negative Merkel cell carcinoma reveals ultraviolet-signature mutations and recurrent TP53 and RB1 inactivation. Mod Pathol. 29, 240-248 (2016).
  12. Abyzov, A., et al. Somatic copy number mosaicism in human skin revealed by induced pluripotent stem cells. Nature. 492, 438-442 (2012).
  13. Martincorena, I., et al. Tumor evolution. High burden and pervasive positive selection of somatic mutations in normal human skin. Science. 348, 880-886 (2015).
  14. Su, R. J., Neises, A., Zhang, X. B. Generation of iPS Cells from Human Peripheral Blood Mononuclear Cells Using Episomal Vectors. Methods Mol Biol. 1357, 57-69 (2016).
  15. Seki, T., et al. Generation of induced pluripotent stem cells from human terminally differentiated circulating T cells. Cell Stem Cell. 7, 11-14 (2010).
  16. Loh, Y. H., et al. Reprogramming of T cells from human peripheral blood. Cell Stem Cell. 7, 15-19 (2010).
  17. Kishino, Y., Seki, T., Yuasa, S., Fujita, J., Fukuda, K. Generation of Induced Pluripotent Stem Cells from Human Peripheral T Cells Using Sendai Virus in Feeder-free Conditions. J Vis Exp. (2015).
  18. Seki, T., Yuasa, S., Fukuda, K. Generation of induced pluripotent stem cells from a small amount of human peripheral blood using a combination of activated T cells and Sendai virus. Nat Protoc. 7, 718-728 (2012).
  19. Gill, S., June, C. H. Going viral: chimeric antigen receptor T-cell therapy for hematological malignancies. Immunological reviews. 263, 68-89 (2015).
  20. Su, R. J., et al. Efficient generation of integration-free ips cells from human adult peripheral blood using BCL-XL together with Yamanaka factors. PLoS One. 8, e64496 (2013).
  21. Li, Y., et al. The p53-PUMA axis suppresses iPSC generation. Nat Commun. 4, 2174 (2013).
  22. Hardwick, J. M., Youle, R. J. SnapShot: BCL-2 proteins. Cell. 138, 404 (2009).
  23. Wen, W., et al. Enhanced Generation of Integration-free iPSCs from Human Adult Peripheral Blood Mononuclear Cells with an Optimal Combination of Episomal Vectors. Stem Cell Reports. 6, 873-884 (2016).
  24. Zhang, X. B., et al. Trehalose ameliorates the cryopreservation of cord blood in a preclinical system and increases the recovery of CFUs, long-term culture-initiating cells, and nonobese diabetic-SCID repopulating cells. Transfusion. 43, 265-272 (2003).
  25. Watanabe, K., et al. A ROCK inhibitor permits survival of dissociated human embryonic stem cells. Nat Biotechnol. 25, 681-686 (2007).
  26. Basu, S., Campbell, H. M., Dittel, B. N., Ray, A. Purification of specific cell population by fluorescence activated cell sorting (FACS). J Vis Exp. (2010).
  27. Castiel, A., et al. Cell death associated with abnormal mitosis observed by confocal imaging in live cancer cells. J Vis Exp. e50568 (2013).
  28. Peterson, S. E., et al. Teratoma generation in the testis capsule. J Vis Exp. e3177 (2011).
  29. Ritner, C., Bernstein, H. S. Fate mapping of human embryonic stem cells by teratoma formation. J Vis Exp. (2010).
  30. Wen, W., et al. Enhanced Generation of Integration-free iPSCs from Human Adult Peripheral Blood Mononuclear Cells with an Optimal Combination of Episomal Vectors. Stem Cell Reports. (2016).
  31. Lo, C. A., et al. Quantification of Protein Levels in Single Living Cells. Cell Rep. 13, 2634-2644 (2015).
  32. Liu, S. P., et al. An improved method for generating integration-free human induced pluripotent stem cells. Zhongguo Shi Yan Xue Ye Xue Za Zhi. 22, 580-587 (2014).
  33. Luni, C., et al. High-efficiency cellular reprogramming with microfluidics. Nat Methods. 13, 446-452 (2016).
  34. Chou, B. K., et al. A facile method to establish human induced pluripotent stem cells from adult blood cells under feeder-free and xeno-free culture conditions: a clinically compliant approach. Stem Cells Transl Med. 4, 320-332 (2015).
  35. Nakagawa, M., et al. A novel efficient feeder-free culture system for the derivation of human induced pluripotent stem cells. Sci Rep. 4, 3594 (2014).
  36. Howden, S. E., et al. Simultaneous Reprogramming and Gene Correction of Patient Fibroblasts. Stem Cell Reports. 5, 1109-1118 (2015).
  37. Meng, X., et al. Rapid and efficient reprogramming of human fetal and adult blood CD34+ cells into mesenchymal stem cells with a single factor. Cell research. 23, 658-672 (2013).
  38. Liao, W., et al. Direct Conversion of Cord Blood CD34+ Cells Into Neural Stem Cells by OCT4. Stem cells translational medicine. 4, 755-763 (2015).
Generation Integrations-fria inducerade pluripotenta stamceller från humant perifert blod mononukleära celler med användning av episomala vektorer
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Wen, W., Zhang, J. P., Chen, W., Arakaki, C., Li, X., Baylink, D., Botimer, G. D., Xu, J., Yuan, W., Cheng, T., Zhang, X. B. Generation of Integration-free Induced Pluripotent Stem Cells from Human Peripheral Blood Mononuclear Cells Using Episomal Vectors. J. Vis. Exp. (119), e55091, doi:10.3791/55091 (2017).More

Wen, W., Zhang, J. P., Chen, W., Arakaki, C., Li, X., Baylink, D., Botimer, G. D., Xu, J., Yuan, W., Cheng, T., Zhang, X. B. Generation of Integration-free Induced Pluripotent Stem Cells from Human Peripheral Blood Mononuclear Cells Using Episomal Vectors. J. Vis. Exp. (119), e55091, doi:10.3791/55091 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter