Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Developmental Biology

ניתוח של הפרדת כרומוזום, אצטון היסטון, ומורפולוגיה ציר ב סוס ביציות

doi: 10.3791/55242 Published: May 11, 2017

Summary

כתב יד זה מתאר גישה ניסיונית מורפולוגית וביוכימית לאפיין ביציות סוסים. באופן ספציפי, העבודה הנוכחית מדגימה כיצד לאסוף ביציות של בוגר בוגרת ובוגרת על ידי אולטראסאונד מונחה איסוף ביצית (OPU) וכיצד לחקור הפרדה כרומוזום, מורפולוגיה ציר, acetylation היסטון גלובלי, ביטוי mRNA.

Abstract

השדה של רבייה בסיוע פותחה לטיפול בבעיות פוריות אצל נשים, חיות נלוות וסוגים הנמצאים בסכנת הכחדה. בסוס, רבייה מסייעת גם מאפשר ייצור של עוברי מן ביצועים גבוהים בלי להפריע את הקריירה הספורטית שלהם תורמת לעלייה במספר הסייחים ממאדים של ערך גנטי גבוה. כתב היד הנוכחי מתאר את הנהלים המשמשים לאיסוף ביציות בוגר ו בוגר מן השחלות באמצעות ביצית איסוף (OPU). ביציות אלה שימשו אז כדי לחקור את השכיחות של aneuploidy על ידי התאמת פרוטוקול שפותח בעבר בעכברים. באופן ספציפי, הכרומוזומים ואת centromeres של הביציות metaphase II (MII) היו תווית fluorescently ונספר על תוכניות מוקד רציף לאחר מיקרוסקופ לייזר confocal סריקה. ניתוח זה גילה שכיחות גבוהה יותר בשיעור aneuploidy כאשר ביציות בוגרים נאספו הזקיקים והתבגר במבחנה לעומתIn vivo. Immunostaining עבור tubulin ואת הצורה acetylated של היסטון ארבע בשאריות lysine ספציפיים חשף גם הבדלים במורפולוגיה של ציר מיוטי ובתבנית הגלובלית של אצטילציה היסטון. לבסוף, הביטוי של mRNAs קידוד עבור היסטון deacetylases (HDACs) ו acetyl- העברות (HATs) נחקר על ידי שעתוק לאחור quantitative-PCR (q-PCR). לא נמצאו הבדלים בביטוי היחסי של התמלילים שנצפו בין המבחנה לבין הביציות המתבגרות של vivo . בהסכמה עם השתקה כללית של פעילות תמליל במהלך התבגרות הביציות, הניתוח של כמות התמליל הכולל יכול רק לחשוף יציבות mRNA או השפלה. לכן, ממצאים אלה מצביעים על כך שתקנות טרנסלציוניות ופוסט-טרנסלציוניות נוספות עשויות להיות מושפעות.

בסך הכל, המחקר הנוכחי מתאר גישה ניסיונית מורפולוגית וביוכימית לאפיין את הביצית סוס, ceLl סוג זה מאתגר מאוד ללמוד בשל זמינות מדגם נמוך. עם זאת, הוא יכול להרחיב את הידע שלנו על ביולוגיה הרבייה ועקרות מינים monovulatory.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

מגוון רחב של טכניקות רבייה בסיוע פותח לטיפול בבעיות פוריות אצל נשים, חיות נלוות וסוגים הנמצאים בסכנת הכחדה. אחד ההליכים הנפוצים ביותר במסגרות קליניות הוא אחזור של ביציות הבמה metaphase II (MII) של זקיקי השחלות על ידי שאיפה transvaginal מונחה אולטרסאונד, איסוף ביצית (OPU) 1 . ביציות אלה מופרות אז במבחנה (IVF), עם העובר שנוצר (ים) מושתל ברחם הנמען. בשלב MII (בוגרת) ביציות מאוחזרים בעקבות ניהול של גונדוטרופינים אקסוגניים. עם זאת, טיפול זה קשור, בחלק מהחולים, עם התפתחות של תסמונת hyperstimulation השחלות (OHSS) 2 .

ניצול של היכולת המהותית של בוגרות, בוגרות בוגרת (שלב GV) כדי לחדש את המיוזה מיד לאחר מבודדים מן הזקיקים שלהם, ניתן להשיג ביציות בוגרות ללא adminisגונדוטרופין 3 . הליך זה נקרא ביצית במבחנה חוץ גופית (IVM) ומייצג גישה פחות סמים, פחות יקר, יותר ידידותי לסבלנות לסיוע טכנולוגיה הרבייה. עם זאת, ההצלחה של התפתחות העובר עם ביציות במבחנה מעובד הוא בדרך כלל נמוך יותר מאשר עם vivo התבגר vivo 4 , 5 . הסבר אפשרי הוא כי ביציות בוגרת מבחנה מושפעים יותר על ידי טעויות הפרדה כרומוזום, וכתוצאה מכך aneuploidy פוגעת התפתחות עובריים נורמלי 6 .

הבנת הבסיס המולקולרי של הפרעה מוטעית כרומוזומלית במהלך IVM תגלה בסופו של דבר את הפוטנציאל המלא של טכניקה זו. ברוח זו, הגישה הניסויית המשמשת לבדיקת התכונות המורפולוגיות והביוכימיות של ביציות במבחנה , בהשוואה ל vivo maturביציות אד כאן מתואר 7 , 8 . באופן ספציפי, את ההליכים עבור OPU של ביציות בשלים בוגרת IVM של ביציות בשלים מודגמים באמצעות סוסים בוגרים טבעי רכיבה כמודל ניסיוני. לאחר מכן, immunofluorescence וניתוח התמונה משמשים לחקור הפרדה כרומוזום, מורפולוגיה ציר, ואת דפוס העולמי של אצטילון היסטון על gametes אלה. לבסוף, פרוטוקול של שעתוק לאחור PCR כמותי מתואר לניתוח ביטוי mRNA.

בהשוואה למודלים של בעלי חיים מכרסמים, סוסים אינם מאפשרים מניפולציה גנטית, הם פחות קל לתמרן, ודורשים תחזוקה יקר. עם זאת, מודל זה הוא צובר עניין רב עבור המחקר של התבגרות הביצית 9 , 10 בשל הדמיון הפיזיולוגיה השחלות האדם 11 , 12 </ Sup>. יתר על כן, פיתוח של פרוטוקולים אמינים של IVM-IVF בסוס יש אינטרס כלכלי משמעותי, שכן זה יאפשר עלייה במספר הסוסים ממאדים של ערך גנטי גבוה.

אחת המגבלות של ביצוע ניסויים על ביציות, במיוחד במינים monovulatory, הוא זמינות מדגם מוגבל. מגבלה זו כבר התגבר כאן על ידי התאמת גישה, שפותחה בעבר בעכברים, כדי ביציות סוס 13 , 14 כדי לבצע ספירת כרומוזום כי ממזער את ההפסד המדגם (ראה דיון להשוואה עם טכניקות אחרות זמין). יתר על כן, פרוטוקול מכתים הקרינה משולשת כבר אופטימיזציה לבצע ניתוחים מרובים על המדגם אותו, וניתוח ה- Q-PCR בוצעו על בריכות של 2 ביציות בלבד.

בסך הכל, המחקר הנוכחי מתאר גישה ניסיונית שמטרתה מורפולוגית ביוכימית צ'הRacterize את הביצית סוס, סוג התא כי הוא מאתגר מאוד ללמוד בשל זמינות מדגם נמוך. עם זאת, הוא יכול להרחיב את הידע שלנו על ביולוגיה הרבייה ועקרות של מינים monovulatory.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

כל ההליכים אושרו על ידי טיפול בבעלי חיים ושימוש הוועדה CEEA Val de Loire מספר 19 ו בוצעו על פי העקרונות המנחים לטיפול ושימוש של חיות מעבדה.

1. ביצית אוסף ב התבגרות חוץ גופית

  1. ביצית איסוף
    1. מדי יום להעריך על ידי אולטרסאונד את קוטר זקיקי השחלות בתוך קבוצה של סוסות בוגרים. בהופעתו של זקיק ≥33 מ"מ (זקיק דומיננטי), להזריק את הסוסה עם 1,500 IU של גונדוטרופין כוריוני האדם (hCG) בחלק העליון של הווריד הצוואר (iv).
      1. לפני ביצוע ההזרקה, ספוגית את האזור עם אלכוהול, לאתר את התלם הצוואר, ומניחים את האגודל 2-3 ס"מ מתחת לאתר ההזרקה כדי לעורר את הווריד לעלות. הכנס את המחט כמעט מקביל הצוואר לשאוף לוודא כי המחט נמצאת בווריד (הדם ייכנס מזרק). בשלב זה, להזריק; HCG יגרמו למטראטרקציה של הביצית בזקיק הדומיננטי.
    2. 35 שעות לאחר הזרקת hCG, להרגיע את הסוסה עם detomidine (15 מיקרוגרם / ק"ג, IV), butoranol טרטרט (10 מיקרוגרם / ק"ג, IV) ו butylescopolamine ברומור (0.2-0.3 מ"ג / ק"ג, 15 מ"ל / סוסה, IV).
    3. חבר את המחט בדיקה אולטראסאונד. הכנס את בדיקת אולטרסאונד בנרתיק והחזק את השחלה באופן שגוי כדי להתמודד עם בדיקה אולטראסאונד. הנחה מפעיל אחד לתמרן את המחט והשני להחזיק את השחלה במקום, עם זקיק מול בדיקה אולטראסאונד . התחל מן השחלה עם זקיק דומיננטי.
    4. לנקב את הקיר הנרתיק ואת הקיר של זקיק דומיננטי עם המחט (בדיקות אולטרסאונד עבור OPU מצוידים ערוץ עבור המחט מחובר למערכת יניקה); Theneedle יהיה גלוי בתמונה echographic.
    5. לשאוב את נוזל follicular בצינור 50 מ"ל חרוטי מחובר למערכת היניקה. יוצקים את התוכן של חרוטיצינור לתוך צלחת פטרי גדול ולחפש את קומולוס, ביצית מורכבת (COC) באמצעות stereomicroscope.
    6. מאז COC הוא לא תמיד לאחזר עם נוזל זקיק, לשטוף את זקיק עם Dulbecco שונה של פוספט שנאגרו מלוחים (DPBS) המכיל 5 IU / מ"ל ​​הפרינאט 37 ° C. בדוק DPBS עבור נוכחות COC, כפי שתואר לעיל עבור נוזל זקיק בשלב 1.1.5. שטוף מספר פעמים עד שה - COC מאוחזר.
    7. לאחר COC מן הזקיק הדומיננטי הוא לאחזר, לנקב ולרוקן את הזקיקים ≥5 ו ≤ 25 מ"מ, כמתואר עבור זקיק דומיננטי במדרגות 1.1.3-1.1.4; זקיקי ≥5 ו ≤25 אינם מבטאים luteinizing הורמון / choriogonadotropin קולטן (LHCGR), ולכן, הביציות שלהם לא יבשיל בתגובה hCG ו ייאספו בשלב GV (לא בוגר). רק לשמור על COCs עם כמה שכבות שלמות של תאים קומולוס ואופלאזמה חומה, מגורענת דק. מחק את האחרים.
    8. בסוף ה- OPU, בJect הסוסה עם benzyl-penicillin 15,000 IU / בעל חיים כדי למנוע הידבקות.
    9. בית סוסה באורווה שקטה, נקי לפחות 2 שעות. בדוק סימנים של מודעות על ידי קביעת המיקום של האוזניים, תגובה לגירויים ( למשל, רעש), ואת ההליכה לפני החזרת הסוסה לחברה של בעלי חיים אחרים.
  2. התבגרות חוץ גופית
    1. HEPES חם שנאגרו TCM199 (20 מ"מ hepes) בתוספת 1,790 IU / L הפרין, 0.4% אלבומין בסרום שור (BSA), פניצילין, סטרפטומיצין ו 37 מעלות צלזיוס. הכן מראש את המדיום. סנן לעקר ולשמור אותו על 4 מעלות צלזיוס למשך עד 6 חודשים.
    2. הכן את המדיום IVM על ידי הוספת NaHCO 3- BCMered TCM199 (25 מ"מ NaHCO 3 ) עם 50 ng / מ"ל ​​אפידרמיס גורם הגידול (EGF) ו 20% עגל בסרום 7 . השתמש NaHCO 3- ניפח TCM199 תוך 3 שבועות של פתיחת בקבוק חדש. הכן את EGF מראש כמו מניות 100x, להקפיא אותו ב -20 מעלות צלזיוס, ולהשתמש בו בתוך 6 חודשים. לוותר על 500 μL בבארות של צלחת 4-היטב ו דגירה באוויר humidified עם 5% CO 2 ב 38.5 מעלות צלזיוס לפחות 2 שעות.
    3. לאחר אחזור של COCs מן ≥ 5 ו ≤ 25 מ"מ זקיקי, לשים אותם בצלחת פטרי (3.5 ס"מ קוטר) מלא 2 מ"ל של HEPES-TCM199. להעביר את COCs לאזורים שונים של המנה כדי לשטוף את פסולת הסלולר.
    4. מעבירים את COCs למדיום IVM ו דגירה במשך 28 שעות באוויר humidified עם 5% CO 2 ב 38.5 מעלות צלזיוס.

2. Immunofluorescence וניתוח תמונה

  1. כרומוזום לספור
    1. לאחר איסוף מן זקיק דומיננטי או בסוף IVM, דגירה COCs עם monastrol 100 מיקרומטר עבור 1 שעות באוויר humidified עם 5% CO 2 ב 38.5 מעלות צלזיוס. הכן monastrol מראש כמו מניות 100x ולאחסן אותו ב -20 מעלות צלזיוס למשך עד 1 שנה.
    2. הסר את התאים cumulusעל ידי טיפול בהם עם 0.5% hyaluronidase או על ידי pipetting בעדינות; להסיר את zona pellucida על ידי טיפול בו 0.2% pronase. הכן hyaluronidase ו pronase מראש כמו מניות 10x ולאחסן אותם ב -20 מעלות צלזיוס למשך עד 1 שנה.
    3. תקן את הביציות ב paraformaldehyde 4% DPBS במשך 15 דקות ב 38.5 מעלות צלזיוס ואחריו 45 דקות נוספות ב 4 מעלות צלזיוס.
      זְהִירוּת! ללבוש ציוד מגן אישי בעת טיפול paraformaldehyde, ולהשליך חומרים מזוהמים בהתאם להנחיות פסולת מסוכנים.
    4. לשטוף את הביציות על ידי העברת ברצף ב 3 בארות מלאים 500 μL של DPBS בתוספת 0.1% אלכוהול פוליוויניל (PVA). Permeabilize ב 0.3% Triton X-100 למשך 10 דקות בטמפרטורת החדר (RT).
    5. בלוק שאינם ספציפיים incby הדגירה ב DPBS בתוספת 1% אלבומין בסרום שור (DPBS-1% BSA) ו 10% בסרום חמור רגיל לפחות 30 דקות ב RT. דוגמאות ניתן לשמור על חסימת פתרון ב 4 מעלות צלזיוס במשך 3-4 ימים.
    6. עבור מכתים העיקרי, דגירה ביציות ארנב נגד אורורה B-phospho-Thr232 ב DPBS בתוספת 1% BSA (דילול 1:50) ב 4 מעלות צלזיוס למשך הלילה.
    7. שטפו את הביציות כמתואר בשלב 2.1.4. דגירה ביציות בפתרון של tetra-methylrhodamine isothiocyanate (TRITC) - חמור conjugated נגד ארנבת IgG (1: 100 ב DPBS-1% BSA) במשך שעה 1 ב RT בחושך.
    8. שטפו את הביציות כמתואר בשלב 2.1.4, ולאחר מכן מקום 3-4 ביציות בטיפה של לא התקשות, נגד דהייה הרכבה בינונית בתוספת 20 מיקרומטר YOPRO1 על שקופיות זכוכית. חזור על התהליך עד כל הביציות מותקנים (3-4 ביציות לכל שקופית).
    9. אפשר ביציות להתיישב על 10 דקות במדיום הרכבה, ולאחר מכן לכסות אותם עם coverslip. כדי למנוע מוחץ ביציות, להחיל שתי רצועות של קלטת דו צדדית לפני הנחת coverslip על השקופית זכוכית.
      הערה: אמצעי זהירות זה גם יבטיח כי כל הדגימות דחוסים באותה מידה בין sli זכוכיתדה ואת coverslip. זכוכית שקופיות ניתן קפוא ב -20 מעלות צלזיוס ו צילמו במהלך 2-3 ימים הבאים.
    10. תמונה דגימות על מיקרוסקופ לייזר confocal סריקה עם מטרה 60X באמצעות אדום (centromeres) וירוקים (כרומוזומים) ערוצים 7 , 13 , 14 , 20 , 21 . סרוק את דגימות פורש את הצלחת metaphasic על ציר ה- Z, עם צעדים כל 0.35 מיקרומטר. שמור את התמונות הדיגיטליות של כל תוכנית אחת.
    11. ספירת centromeres בסעיפים confocal סדרתי באמצעות פונקציה לספור תאים של NIH ImageJ תוכנה (זמין ב: https://imagej.nih.gov/ij/plugins/cell-counter.html).
      הערה: הימנע מספירה חוזרת של centromeres המופיעים על חלקים סמוכים על ידי זיהוי centromeres להופיע, להישאר ונעלמים מקטעים רציף עם קוד מספרי.
    12. חזור על שיתוף הכרומוזומיםללא שינוי בשלב 2.1.11 עם מפעיל עצמאי.
      הערה: לסווג את הביציות כמו euploid (32 כרומוזומים), היפרפלואיד (32), או היפופלויד (<32).
  2. מורפולוגיה ציר ואצטילציה היסטון
    1. לאחר איסוף מן הזקיק הדומיננטי או בסוף IVM, להסיר את התאים קומולוס על ידי טיפול ב 0.5% hyaluronidase או על ידי pipetting עדין, כמתואר בשלב 2.1.2.
    2. לשטוף את הביציות DPBS-PVA, כמו בשלב 2.1.4, ולתקן אותם paraformaldehyde 2.5% במשך 20 דקות ב 38 ° C. לשטוף באופן נרחב, כמתואר בשלב 2.1.4, ו permeabilize ב 0.1% Triton X-100 עבור 5 דקות ב RT.
      הערה: ללבוש ציוד מגן אישי בעת טיפול paraformaldehyde ו להשליך חומרים מזוהמים בהתאם להנחיות פסולת מסוכנים.
    3. לחסום שאינם ספציפיים incby הדגירה ב DPBS השלימו עם 2% אלבומין בסרום שור (DPBS - 2% BSA), 0.05% saponin, ו 10% סרום חמור רגילh r 2 ב RT.
      הערה: דוגמאות ניתן לשמור על חסימת פתרון ב 4 מעלות צלזיוס במשך 3-4 ימים.
    4. עבור מכתים העיקרי, דגירה ביציות העכבר נגד אלפא טובולין (1: 150) ו ארנב נגד acH4K16 (1: 250) ב BBS DPBS-2% עם 0.05% saponin ב 4 ° C במשך הלילה.
    5. שטפו את הביציות כמו בשלב 2.1.4. דגירה ביציות בפתרון של ירוק צבע ניאון חמור מצומדות חמור אנטי עכבר IgG (1: 500) ו TRITC- מצומדות חמור נגד ארנבת IgG (1: 100) ב BBS DPBS-2% עם 0.05% saponin במשך שעה 1 ב RT בחושך.
    6. לשטוף את הביציות כמו בשלב 2.1.4, ולאחר מכן מקום 3-4 ביציות טיפה של הלא מתקשה, אנטי דוהה הרכבה בינונית בתוספת 1 מיקרוגרם / מ"ל ​​4, 6-diamidino-2-phenylindole (DAPI) על שקופית זכוכית.
    7. הר ביציות על שקופיות זכוכית כמתואר בשלב 2.1.8.
    8. תמונה דגימות על מיקרוסקופ לייזר confocal סריקה עם מטרה 60x באמצעות אדום (acH4K16), ירוק (אלפא טובולין), וכחול (DNA) ערוצים.
      הערה: שמור את הגדרות הלייזר עבור הערוצים האדומים והכחולים קבוע במהלך הרכישה של כל הדגימות. סרוק את דגימות פורש את כל ציר מיוטית צלחת metaphasic על ציר ה- Z, עם צעדים כל 0.35 מיקרומטר. שמור את התמונות הדיגיטליות (תוכניות יחיד ותמונה 3D מוקרן).
    9. מדוד את אורך ציר מוט אל מוט ואת קוטר ציר על רוחב מרבי על התמונה המוקרנת באמצעות פונקציית המדידה של NIH ImageJ תוכנה (https://imagej.nih.gov/ij/docs/guide/146-30 .html). חזור על כל 3 פעמים ולחשב את הממוצע.
    10. לכמת את הקרינה היחסית של acH4K16 באמצעות פונקציית צפיפות משולבת של NIH ImageJ תוכנה (https://imagej.nih.gov/ij/docs/guide/146-30.html). לנרמל את זה עבור צפיפות משולבת של מכתים DAPI.

3. ניתוח הביטוי mRNA

  1. לאחר COCs כבר לאחזר 5 עד 25 מ"מ זקיקים, לאסוף את התאים granulosaUspension שנותר בצלחת פטרי לשטוף אותו פעמיים DPBS קר על ידי צנטריפוגה ב XG 10,600 במשך 2 דקות. הצמד להקפיא חנקן נוזלי. חנות דגימות ב -80 מעלות צלזיוס למשך עד 6 חודשים; התאים ישמשו עבור עקומת תקן.
  2. בזהירות להסיר את כל התאים cumulus, כמתואר בשלב 2.1.2, מ בוגר (GV), במבחנה התבגר, ב vivo התבגר ביציות.
  3. שטפו את הביציות, כמתואר 2.1.4, ב DPBS-PVA, לאסוף אותם ביחידות 1 μL, ושכב 2 RNALater μL על גבי. הצמד להקפיא חנקן נוזלי. חנות דגימות ב -80 מעלות צלזיוס למשך עד 6 חודשים.
  4. הוסף 2 pg של RNA לוציפראז לכל מדגם כמו ספייק ב. בריכה ביציות 2 x 2 ו לחלץ את סך RNA באמצעות סיליקה קרום מסנן מבוסס ערכת מתאים לשחזר RNA מדגמים קטנים.
  5. היפוך-לתמלל את ה- RNA μL 10 עם 0.25 מיקרוגרם מיקרוגרם אקראי העכבר Moloney לוקמיה וירוס transcriptase הפוך עבור 1 שעה ב 37 & # 176; חנות דגימות ב -20 מעלות צלזיוס למשך עד 6 חודשים.
  6. לדלל את cDNA מהתאים גרנולוזה במים RNAse חינם ל 50 ng / μL. סדרתי לדלל את הפתרון הזה 1:10 כדי לקבל 5 ng / μL, 0.5 ng / μL, 0.05 ng / μL, ו 0.005 ng / פתרונות μL.
  7. להרכיב תגובות בשלושה עותקים בהיקף של 20 μL לכל תגובה באמצעות cDNA שווה 0.05 ביציות כמו המצע, או 5 μL של דילולים סדרתי של cDNA תא granulosa, 10 μL של supermix SYBR ירוק, 0.3 מיקרומטר של כל פריימר ספציפי ( טבלה 1 ).
  8. הפעל את התגובה cycler תרמי באמצעות פרוטוקול 3 שלבים: 95 מעלות צלזיוס למשך 30 שניות, 60 מעלות צלזיוס למשך 30 שניות, ו 72 מעלות צלזיוס במשך 20 שניות, חוזרות על עצמה 40 פעמים. לבסוף, לרכוש את עקומת ההיתוך, החל מ 60 מעלות צלזיוס, ולהגדיל את הטמפרטורה על ידי 0.5 מעלות צלזיוס כל 20 s עד 95 ° C.
  9. להעריך את כמות ההתחלה (SQ) של mRNA ספציפי בדגימות הביצית באמצעות עקומת תקןF "15 מחושב על בסיס מדגם התא גרנולוזה, להביע את הנתונים כיחס בין SQ של הגן של עניין SQ של הגנים משק בית.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

הממצאים המקוריים של ניסויים אלה תוארו בעומק בעבר 7 והם מדווחים כאן כדוגמה לתוצאות שניתן להשיג באמצעות הפרוטוקולים המתוארים.

שיעור התבגרות

מתוך 32 COCs שאוחזרו על ידי OPU מזקיקים דומיננטיים, 28 (88%) היו בשלב MII. ארבעה עשר מתוך 58 COCs שנאספו זקיקים 5-25 מ"מ בגודל היו מיד קפוא קפוא כמו ביציות בשלה עבור המחקר ביטוי mRNA. 44 הנותרים היו במבחנה הבשיל, ו 37 הגיעו לשלב MII (85%). היעילות של ההבשלה לא הייתה שונה משמעותית בשתי הקבוצות (המבחן המדויק של פישר P> 0.05).

שיעור aneuploidy

כדי ללמוד אם IVM CAN מפרידים את החלוקה הכרומוזומלית הנאמנה בין הביצית המשנית לבין הגוף הקוטב הראשון, מספר הכרומוזומים בשלב MII נספר, שכן הוא מייצג את התוצאה של הפרדה כרומוזומית במהלך המיאוזיה I. כפי שמוצג באיור 1 א , האנטי-אורורה B Phospho-Thr232 נוגדן מוכתם במיוחד באזור centromeric ביציות סוס, המאפשר אחד לספור את מספר הכרומוזומים. ב ביציות במבחנה מעובדים הושפעו באופן משמעותי יותר על ידי aneuploidy (5/11) לעומת vivo התבגר ביציות (0/12, המבחן המדויק של פישר, P <0.05, איור 1 ב ). רוב הביציות aneuploid (4/5) היו היפרפלואידים; לכן, שיעור aneuploidy אינו נובע ממצאים בהכנת המדגם קביעת הפסד כרומוזומלי, כפי שקורה עם ממרחים כרומוזומליים. Immunostaining של האזור centromeric ניסו גם עם נוגדנים נגד CPA ו אנטי AURKB, אבל לא היה איתות היהUalized בשני המקרים (נתונים לא מוצגים).

ציר מורפולוגיה ו acetylation של H4K16

אורך ציר הקוטב לקוטב וקוטר הציר ברוחב המקסימלי נמדדו, כפי שמוצג באיור 2 . על פי מדידות אלו, ביציות במבחנה- מעבדה היו ארוכות יותר באופן משמעותי (19.89 ± 1.15 מיקרומטר) ו רחב יותר (17.28 ± 0.81 מיקרומטר) לעומת vivo התבגר ביציות (14.57 ± 1.7 מיקרומטר אורך ו 13.56 ± 0.91 מיקרומטר בקוטר, unaired t -Test, P <0.05). על דגימות אותו, רמת acetylation העולמי של H4K16 נמדד גם, המאשר כי acetylation ב H4K16 היה נמוך משמעותית ביציות IVM בהשוואה שלהם עמיתים vivo ( איור 2 , אדום).

ביטוי של טראןסקריפטים קידוד acetyltransferases היסטון ו deacetylases

אם הביטוי של גנים המעורבים בתהליך ההיסטציה של היסטון אצטילציה- deacetylation השתנה ב ביציות במבחנה מעבדה נחקר על ידי q-PCR. היסטון אצטיל-טרנזיס 1 ( HAT1 ), K-acetyltransferase 8 (KAT8 ), היסטון deacetylase 1 ( HDAC1 ), ו- NAD תלויי חלבון deacetylase sirtuin 1 ( SIRT1 ) זוהו מטרות משוערות. הבדלים משמעותיים בביטויים אלה תמלילים ב בוגר, במבחנה התבגר, ב vivo התבגר vocytes לא נצפו, עצמאית של הנורמליזציה בשימוש. באופן ספציפי, את התוצאות של ניתוח ביטוי תמליל שדווח באיור 3 חושבו נגד עקומת תקן באמצעות שיטת SQ ו מנורמל עבור ghyceraldehyde-3-phosphate dehydrogenase ( GAPDH ). באופן דומה, לא diffeRences נצפו כאשר התוצאות שבו מנורמל עבור ספייק בלוציפראז או כאשר השיטה ΔΔct שימש (לא מוצג).

יַעַד Fw תחל Rv תחל גודל אמפליקון
GAPDH ATCACCATCTTCCAGAGAGAGGAGAGA GTCTTCTGGGTGGCAGTGATGG 241 bp
HAT1 CTGACATGAGTGATGCTGAACA TAACGCGTCGGTAATCTTCC 219 bp
HDAC1 GAAGGCGGTCGCAAGAAT CCAACTTGACCTCCTCCTTGA 166 bp
KAT8 ACTGGTCTTGGGTCCTGCTG GGGCACTTTGGGTGTTTCC 198 bp
לוציפראז TCATTCTTCGCCAAAAGCACTCTG D> AGCCCATATCCTTGGTATCCCC 148 bp
SIRT1 GACTCGCAAAGGAGCAGATT GGACTCTGGCATGTTACT 169 bp

טבלה 1: פרטים ראשוניים. רצף 5 '> 3' של פריימרים קדמי (Fw) ו - Rv, ואת גודל amplicon צפוי ניתנים עבור כל תמליל ניתח: glyceraldehyde-3-phosphate dehydrogenase ( GAPDH ) , היסטון אצטיל- transferase 1 ( HAT1 ) , היסטון Deacetylase 1 ( HDAC1 ) , K-acetyltransferase 8 ( KAT8 ) , בלוציפראז , ו- NAD תלויי חלבון deceetylase sirtuin 1 ( SIRT1 ). הודפס מחדש באישור מהתייחסות 7 .

/55242fig1.jpg "/>
איור 1: Aneuploidy שיעור ב ויוו, ובביצים סוס מעובד. ( א ) נציג תמונות מראה אורורה B phospho-Thr232 (אדום) ו- DNA (ירוק) מכתים של הביצית בשלב הביולוגי MI שטופלו monastrol. ביצית euploid (32 כרומוזומים) מוצג. סולם בר = 5 מיקרומטר. ( B ) גרף עמודות מייצג את ההתפלגות של ביציות בשלב הביולוגי של ה- euluoid ו- aneuploid ב- vivo (n = 12) ובביציות חוץ-גופית (n = 11). * מצביע על הבדל משמעותי בשיעור aneuploidy (המבחן המדויק של פישר, P <0.05). הודפס באישור מתוך הפניה 7. אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו.

איור 2 איור 2: מדידה ציר ו H4K16 אצטילציה ב ויוו, ובביצים סוס מעובד. תמונות נציג המייצג טובולין (ירוק), H4K16 אצטילטד (אדום), ו- DNA (כחול) בביציות MII לאחר in vivo (n = 4) או במבחנה (n = 14) התבגרות. התמונות tubulin להראות את הצירים המשמשים אורך ציר קוטר מדידות. סולם בר = 5 מיקרומטר. שונה מהתייחסות 7 . אנא לחץ כאן כדי להציג גרסה גדולה יותר של נתון זה.

איור 3
איור 3: ביטוי של KAT8 , SIRT1 , HAT1 , ו HDAC1 ב ImmatuRe, בשנת Vivo , ו ביציות התבגרות Vitro . גרפים בר מייצגים את הממוצע ± SEM של ביטוי mRNA יחסית של KAT8 , SIRT1 , HAT1 , ו HDAC1 , כפי שבאה לידי ביטוי בכמות ההתחלה (SQ) של תמליל הריבית בהשוואה ל - SQ של GAPDH , המשמש כניהול משק הבית. לא נמצאו הבדלים סטטיסטיים בין מבוגרים (GV, n = 14), ב- vivo (n = 14), ובבדיקות (n = 12) ביציות בוגרות (חד-כיווני ANOVA, P > 0.05). הודפס מחדש באישור מהתייחסות 7 . אנא לחץ כאן כדי להציג גרסה גדולה יותר של נתון זה.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

למרות IVM בוצעה בסוסים במשך יותר מ 20 שנים 16 , אנחנו עדיין לא יודעים אם הביצית יכולה להיות המקור של aneuploidy עובריים, כפי שהוצע עבור בני אדם 17 . הסיבה היא כנראה כי הכנת מתפשט הביצית עבור ספירת כרומוזום התוצאות להפסד מדגם ניכר. עם זאת, בסקר של שיטות המשמשות לחקירת טעויות הפרדה כרומוזום נערך לחפש את הטכניקה המתאימה ביותר ליישם ביציות סוס. ארבע טכניקות עיקריות נמצאו בספרות המדעית: 1) פרוסות כרומוזומליות 5 , 18 , 19 , 2) הכלאה פלואורסצנטית באתרו (FISH) , 4 , 6 , 17 , 20 , 3) ספירת centromere על צירים מונסטרול , 14 , 21 , 22 , ו - 4) מכתים chromosome הקרינה ללא ספירת כרומוזום 23 , 24 , 25 .

כאמור, הכנת המרווחים כרומוזומליים ואחריו מכתים Giemsa מסובך על ידי שיעור גבוה של אובדן מדגם. שיטה זו הוחלפה במקרים רבים על ידי FISH, אשר משתמש בדיקות ספציפיות למפות כרומוזומים שונים. חיסרון של טכניקות דגים הוא שכאשר מספר קטן של בדיקות משמשים, שכיחות שלילית שלילית עלולה להגדיל ( כלומר, זיהוי כתא נורמלי הוא aneuploid כי כרומוזום חסר או supernumerary לא נבדק). השימוש המהיר של דגים תלוי במידה רבה על הידע מראש של הכרומוזומים הנפוצים יותר על ידי aneuploidy ( למשל., כרומוזום 21 בבני אדם). דגים שימש בעבר כדי לחקור חריגות כרומוזומליות בעוברים סוס באמצעות 2 בדיקות, נגד כרומוזום 2 ו chromosome 4 20 . על פי ניסויים אלה, גרעינים של עוברי מיוצר במבחנה נוטים יותר להיות מושפעים על ידי חריגות כרומוזומליות מאשר עוברי מיוצר vivo . ממצא זה עולה בקנה אחד עם תצפית שדווחו לעיל באמצעות שיטת monastrol- קריסה ביציות IVM. עם זאת, השכיחות של aneuploidy ב ביציות IVM היה אפילו גבוה יותר מאשר דיווחו באמצעות דגים ב עובריים מיוצר במבחנה 20 . אי התאמה חלקית זו יכולה להיות מוסברת על ידי העובדה כי רק שני כרומוזומים ספציפיים בדיקות שימשו ניסויים FISH. גישה זו עשויה להמעיט בערך ההיארעות של aneuploidy הכרומוזומים האחרים, במיוחד כאשר שוקלים כי סוסים יש 32 כרומוזומים. עם זאת, זה לא יכול להיות נכלל כי aneu חמורהPloidies לזיהוי ביציות לא נשמרים בעוברים כי gametes מושפע על ידי קשיים קריטיים גנטית לא יכול להתפתח עוד יותר.

השילוב של טיפול monastrol, כרומוזום מכתים centromere, מיקרוסקופיה confocal מותר לספור עקבית של מספר הכרומוזומים בביציות סוס שלב MII עם הפסד מדגם מינימלי. המגבלה הטכנית נתקל בפיתוח טכניקה זו עבור ביציות סוס היה זמינות של נוגדנים ספציפיים לסוס. לפני השימוש ב- Aurora B phospho (Thr232), שני נוגדנים אחרים (אנטי-אורורה B ו- Anti-CENPA) לא יצרו כתם סנטרומי. יש לציין, אנטי Aurora B ו אנטי CNA כבר היו בשימוש בהצלחה בתאי הבקר 26 , 27 , 28 ; לכן, הגיע למסקנה כי הם לא היו ספציפיים לסוס. טכניקה זו יכולה גם להיות מוגבלת על ידי הזמינות של לייזר לייזר confocalAnning מיקרוסקופ ותמונה ניתוח תוכנה. כמו כן, סריקה עיוורת על ידי שני מפעילי עצמאית חיונית כדי להוציא את המפעיל המושרה חפצים. למרות הספירה הכרומוזומלית של ציר מונסטרול, הוא משמר טוב יותר את המורפולוגיה של התא ומונע אובדן מדגם, טכניקה זו מאפשרת רק תצפית של הבדלים במספר הבסיסי של כרומוזומים; זה לא אינפורמטיבי על הפרעות כרומוזומליות אחרות ( למשל, translocations, מחלפים קטגורי, וכו ' ), כי ניתן במקום להתגלות על ידי karyotyping, ובמקרים מסוימים, על ידי דגים.

טעויות הפרדה כרומוזום יש גם נחקרו על ידי ציר ו immunromluorescence כרומוזום, ללא ביצוע כרומוזומלית ספירה 23 , 24 , 25 . במקרה זה, צירים עם אנומליות חמורות ופיגורים או כרומוזומים מפוזרים נחשבים לסימנים של כרומוזום לא יציבאני הפרדה. לפיכך, הכרומוזומים שהיו מפוזרים מתוך הציר נצפו ב ביציות בוגרים חוץ גופית 7 (הכיתה כי סביר יותר מושפע aneuploidy). עם זאת ספירת כרומוזומלית יש את היתרון של העברת מידע לכמות.

לסיכום, לעומת טכניקות אחרות שתוארו, השימוש monastrol ו מכתים centromere יש את היתרון של מניעת אובדן מדגם, מזעור השכיחות של תשלילים שקר, להיות לכמות.

השינוי של השינויים epigenetic הוצע כמנגנון אפשרי בתחילתו של ביצית aneuploidy 18 , 24 , 25 . באמצעות כתם פלואורסצנטי משולש, ניתן היה לדמיין ולמדוד את ציר מיוטי ולהבחין כרומוזומים מפגרת / מפוזרים. במקביל, הודות לפיתוח של נוגדנים כילזהות שינויים שאריות ספציפיות, רמת acetylation של H4K16 בוצע על המדגם אותו.גישה זו שימשה את המטרה כפולה של הפחתת כמות ביציות הדרושים לניתוח וקורלציה אצטיל H4 עם המורפולוגיה של ציר.

כימות שינויים חלבון קוולנטי יכול להתבצע על ידי כתם המערבי. עם זאת, טכניקה זו דורשת גודל דגימות גדול יותר ולא לשמור על שלמות המדגם למחקרים מורפולוגיים. גישת הכתמים שלוש פלואורסצנטי ניתן ליישם שינויים היסטון אחרים, פוטנציאל, על כל חלבון זה יכול להיות מוכר על ידי נוגדנים משני שונים 8 ; הגורם המגביל היחיד הוא הזמינות של נוגדנים ספציפיים לסוס. בהקשר זה, מקווים החוקרים כי העלאת תשומת הלב למודל הסוסים תגביר את העניין בחקירת מנגנונים ביולוגיים בסיסיים במינים אלה, ולכן,כלי ייעודי.

לבסוף, המחקר ביטוי של mRNAs קידוד עבור היסטון deacetylases (HDACs) ו acetyl- העברות (HATs) שנערך על ידי שעתוק לאחור ו כמותי- PCR (q-PCR) מתואר גם. Q-PCR היא טכניקה בהרחבה; עם זאת, השימוש בו עבור ביציות סוס אינו מפוזר. חשוב לציין כי בשל השתקה כללית של פעילות תעתיק במהלך התבגרות הביציות 29 , הניתוח של כמות התמליל הכולל יכול רק לחשוף יציבות mRNA או השפלה ברקע הזה 30 , 31 . הבדלים בביטוי היחסי של תמלילי בין במבחנה לבין התבגרות vivo לא נצפו. ממצאים אלה מצביעים על כך שתקנות טרנסלציוניות ופוסט-טרנסלציוניות עשויות להיות מושפעות על ידי IVM, ומציינות את הצורך בפיתוח של גישות ניסיוניות אחרות שמטרתן לחקור translational ו- poSt-translational מנגנונים ברמת תא בודד.

בסך הכל, המחקר הנוכחי מתאר גישה ניסיונית מורפולוגית ביוכימית לאפיין ביציות סוס. גישה זו יכולה להיות מיושמת על ביציות של מינים אחרים אשר מושפעים באופן דומה על ידי שיעור התאוששות נמוך, כולל בני אדם או מינים בסכנת הכחדה. מחקרים אלה ירחיבו את הידע שלנו על ביולוגיה הרבייה יונקים יתרום ההבנה שלנו של פוריות.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

למחברים אין מה לחשוף.

Acknowledgments

המחברים היו רוצים להודות Fabrice וינסנט לתמיכה עם לייזר סריקת מיקרוסקופיה confocal (LSCM) , ואת פיליפ Barrière ו תיירי בלארד לביצוע אולטרסאונד סריקה השחלה היומית וזריקה hCG. עבודה זו נתמכה בחלקו על ידי פרויקט "אזור Sardegna ו Regione Lombardia" "Ex Ovo Omnia" (מענק מס '26096200 ל AML); את "לוריאל איטליה עבור כל דון e la Scienza 2012" המלגה (חוזה 2012 ל FF), FP7-PEOPLE-2011- CIG, מחקר הסוכנות (REA) "Pro-Ovum" (מענק מס '303640 ל VL); ועל ידי בית הספר הפוסט-דוקטורט לחקלאות ולרפואה וטרינרית, במימון משותף של הקרן החברתית האירופית, תוכנית מבצעית סקטוריאלית לפיתוח משאבי אנוש 2007-2013 (חוזה מס 'POSDRU / 89 / 1.5 / S / 62371 ל- IM). אוסף הביציות של vivo מומן על ידי מכון המחקר של Cheval et de l'Equitation.

Materials

Name Company Catalog Number Comments
ultrasound probe Aloka UST-5820-7,5
human chorionic gonadotrophin centravet CHO004 1,500 unit/animal IV
detomidine centravet MED010 9 - 15 µg/kg IV
butylscopolamine bromure centravet EST001 0.2 mg/kg IV
stereomicroscope NIKON SMZ-2B
butorphanol centravet DOL003 10µg/kg IV
benzyl-penicillin centravet DEP203 IM 15,000 UI/animal
TCM199 Sigma-Aldrich M3769 10X1L powder for hepes-buffered TCM199
Hepes sodium salt Sigma-Aldrich H3784-100G
bovine serum albumin Sigma-Aldrich A8806
heparin  Sigma-Aldrich H3149-10KU
NaHCO3-buffered TCM199 Sigma-Aldrich M2154-500ML liquid for IVM medium
epidermal growth factor Sigma-Aldrich E4127
newborn calf serum Sigma-Aldrich N4762-500ML
4-well dishes NUNCLON 144444
incubator Heraeus BB6060
monastrol Sigma-Aldrich M8515
hyaluronidase Sigma-Aldrich H3506
pronase Sigma-Aldrich P5147
paraformaldehyde Sigma-Aldrich P6148
polyvinyl alcohol Sigma-Aldrich 341584
triton-X 100 Sigma-Aldrich T8787
normal donkey serum Sigma-Aldrich D9663
rabbit anti-Aurora B phospho-Thr232 BioLegend 636102
TRITC-conjugated donkey anti-rabbit IgG Vector Laboratories 711-025-152
Vecta-Shield Vector Laboratories H-1000
YOPRO1 Thermofisher Scientific Y3603
confocal laser scanning microscope LSM 780 Zeiss
confocal laser scanning microscope LSM 700 Zeiss
ImageJ software rsb.info. nih.gov/ij/download.html free resource
mouse anti-alpha-tubulin Sigma-Aldrich T8203
rabbit anti-acH4K16 Upstate Biotechnology 07-329
AlexaFluor 488-coniugated donkey anti-mouse IgG Life Technologies A21202
4’,6-diamidino-2-phenylindole Sigma-Aldrich D8417 DAPI
centrifuge Eppendorf 5417R
RNALater Invitrogen AM7020
Luciferase RNA Promega L4561
PicoPure RNA Isolation Kit Applied Biosystems 12204-01
random hexamers Thermofisher Scientific N8080127
mouse Moloney leukaemia virus reverse transcriptase Thermofisher Scientific 28025013
SYBR green supermix BioRad 1708880
specific primers Sigma-Aldrich specific primers were designed using Primer3Plus software (free resource)
thermal-cycler BioRad MyiQ
mouse monoclonal anti-CENPA Abcam ab13939
mouse monoclonal anti-Aurora B Abcam ab3609

DOWNLOAD MATERIALS LIST

References

  1. Dellenbach, P. Transvaginal, sonographically controlled ovarian follicle puncture for egg retrieval. Lancet. 1, (8392), 1467 (1984).
  2. Humaidan, P. Ovarian hyperstimulation syndrome: review and new classification criteria for reporting in clinical trials. Hum Reprod. (2016).
  3. Pincus, G., Enzmann, E. V. The Comparative Behavior of Mammalian Eggs in Vivo and in Vitro : I. The Activation of Ovarian Eggs. J Exp Med. 62, (5), 665-675 (1935).
  4. Emery, B. R., Wilcox, A. L., Aoki, V. W., Peterson, C. M., Carrell, D. T. In vitro oocyte maturation and subsequent delayed fertilization is associated with increased embryo aneuploidy. Fertil Steril. 84, (4), 1027-1029 (2005).
  5. Nichols, S. M., Gierbolini, L., Gonzalez-Martinez, J. A., Bavister, B. D. Effects of in vitro maturation and age on oocyte quality in the rhesus macaque Macaca mulatta. Fertil Steril. 93, (5), 1591-1600 (2010).
  6. Requena, A. The impact of in-vitro maturation of oocytes on aneuploidy rate. Reprod Biomed Online. 18, (6), 777-783 (2009).
  7. Franciosi, F. In vitro maturation affects chromosome segregation, spindle morphology and acetylation of lysine 16 on histone H4 in horse oocytes. Reprod Fertil Dev. (2015).
  8. Franciosi, F. Changes in histone H4 acetylation during in vivo versus in vitro maturation of equine oocytes. Mol Hum Reprod. 18, (5), 243-252 (2012).
  9. Choi, Y. H., Gibbons, J. R., Canesin, H. S., Hinrichs, K. Effect of medium variations (zinc supplementation during oocyte maturation, perifertilization pH, and embryo culture protein source) on equine embryo development after intracytoplasmic sperm injection. Theriogenology. (2016).
  10. Hendriks, W. K. Maternal age and in vitro culture affect mitochondrial number and function in equine oocytes and embryos. Reprod Fertil Dev. 27, (6), 957-968 (2015).
  11. Carnevale, E. M. The mare model for follicular maturation and reproductive aging in the woman. Theriogenology. 69, (1), 23-30 (2008).
  12. Ginther, O. J. The mare: a 1000-pound guinea pig for study of the ovulatory follicular wave in women. Theriogenology. 77, (5), 818-828 (2012).
  13. Chiang, T., Duncan, F. E., Schindler, K., Schultz, R. M., Lampson, M. A. Evidence that weakened centromere cohesion is a leading cause of age-related aneuploidy in oocytes. Curr Biol. 20, (17), 1522-1528 (2010).
  14. Duncan, F. E., Chiang, T., Schultz, R. M., Lampson, M. A. Evidence that a defective spindle assembly checkpoint is not the primary cause of maternal age-associated aneuploidy in mouse eggs. Biol Reprod. 81, (4), 768-776 (2009).
  15. Larionov, A., Krause, A., Miller, W. A standard curve based method for relative real time PCR data processing. BMC Bioinformatics. 6, (62), (2005).
  16. Choi, Y. H., Hochi, S., Braun, J., Sato, K., Oguri, N. In vitro maturation of equine oocytes collected by follicle aspiration and by the slicing of ovaries. Theriogenology. 40, (5), 959-966 (1993).
  17. Hassold, T., Hunt, P. To err (meiotically) is human: the genesis of human aneuploidy. Nat Rev Genet. 2, (4), 280-291 (2001).
  18. Akiyama, T., Nagata, M., Aoki, F. Inadequate histone deacetylation during oocyte meiosis causes aneuploidy and embryo death in mice. Proc Natl Acad Sci U S A. 103, (19), 7339-7344 (2006).
  19. Homer, H. A. Mad2 prevents aneuploidy and premature proteolysis of cyclin B and securin during meiosis I in mouse oocytes. Genes Dev. 19, (2), 202-207 (2005).
  20. Rambags, B. P. Numerical chromosomal abnormalities in equine embryos produced in vivo and in vitro. Mol Reprod Dev. 72, (1), 77-87 (2005).
  21. Nabti, I., Marangos, P., Bormann, J., Kudo, N. R., Carroll, J. Dual-mode regulation of the APC/C by CDK1 and MAPK controls meiosis I progression and fidelity. J Cell Biol. 204, (6), 891-900 (2014).
  22. Shomper, M., Lappa, C., FitzHarris, G. Kinetochore microtubule establishment is defective in oocytes from aged mice. Cell Cycle. 13, (7), 1171-1179 (2014).
  23. Luzzo, K. M. High fat diet induced developmental defects in the mouse: oocyte meiotic aneuploidy and fetal growth retardation/brain defects. PLoS One. 7, (11), e49217 (2012).
  24. Ma, P., Schultz, R. M. Histone deacetylase 2 (HDAC2) regulates chromosome segregation and kinetochore function via H4K16 deacetylation during oocyte maturation in mouse. PLoS Genet. 9, (3), e1003377 (2013).
  25. Yang, F., Baumann, C., Viveiros, M. M., De La Fuente, R. Histone hyperacetylation during meiosis interferes with large-scale chromatin remodeling, axial chromatid condensation and sister chromatid separation in the mammalian oocyte. Int J Dev Biol. 56, (10-12), 889-899 (2012).
  26. Luciano, A. M. Oocytes isolated from dairy cows with reduced ovarian reserve have a high frequency of aneuploidy and alterations in the localization of progesterone receptor membrane component 1 and aurora kinase B. Biol Reprod. 88, (3), 58 (2013).
  27. Luciano, A. M., Lodde, V., Franciosi, F., Ceciliani, F., Peluso, J. J. Progesterone receptor membrane component 1 expression and putative function in bovine oocyte maturation, fertilization, and early embryonic development. Reproduction. 140, (5), 663-672 (2010).
  28. Terzaghi, L. PGRMC1 participates in late events of bovine granulosa cells mitosis and oocyte meiosis. Cell Cycle. 1-14 (2016).
  29. Susor, A., Jansova, D., Anger, M., Kubelka, M. Translation in the mammalian oocyte in space and time. Cell Tissue Res. 363, (1), 69-84 (2016).
  30. Chen, J. Genome-wide analysis of translation reveals a critical role for deleted in azoospermia-like (Dazl) at the oocyte-to-zygote transition. Genes Dev. 25, (7), 755-766 (2011).
  31. Ma, J., Flemr, M., Strnad, H., Svoboda, P., Schultz, R. M. Maternally recruited DCP1A and DCP2 contribute to messenger RNA degradation during oocyte maturation and genome activation in mouse. Biol Reprod. 88, (1), 11 (2013).
ניתוח של הפרדת כרומוזום, אצטון היסטון, ומורפולוגיה ציר ב סוס ביציות
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Franciosi, F., Tessaro, I., Dalbies-Tran, R., Douet, C., Reigner, F., Deleuze, S., Papillier, P., Miclea, I., Lodde, V., Luciano, A. M., Goudet, G. Analysis of Chromosome Segregation, Histone Acetylation, and Spindle Morphology in Horse Oocytes. J. Vis. Exp. (123), e55242, doi:10.3791/55242 (2017).More

Franciosi, F., Tessaro, I., Dalbies-Tran, R., Douet, C., Reigner, F., Deleuze, S., Papillier, P., Miclea, I., Lodde, V., Luciano, A. M., Goudet, G. Analysis of Chromosome Segregation, Histone Acetylation, and Spindle Morphology in Horse Oocytes. J. Vis. Exp. (123), e55242, doi:10.3791/55242 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter