Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Developmental Biology

말의 난 모세포에서의 염색체 분리, 히스톤 아세틸 화 및 스핀들 형태의 분석

doi: 10.3791/55242 Published: May 11, 2017

Summary

이 원고는 형태 학적 및 생화학 적으로 말의 난 모세포를 특성화하기위한 실험적 접근법을 기술한다. 특히, 본 연구는 초음파 유도 난자 채취 (OPU)에 의한 미성숙 및 성숙한 난 모세포를 수집하는 방법과 염색체 분리, 스핀들 형태, 전 세계 히스톤 아세틸 화 및 mRNA 발현을 조사하는 방법을 설명한다.

Abstract

보조 생식 분야는 여성, 동반자 동물 및 멸종 위기 종의 불임 치료를 위해 개발되었습니다. 말의 보조 생식은 또한 스포츠 경력을 방해하지 않고 높은 수행자의 배아 생산을 허용하고 높은 유전 적 가치의 암말로부터 도태 한 새끼 수의 증가에 기여합니다. 본 원고는 난자 채취 (OPU)를 이용하여 말의 난소에서 미성숙 및 성숙 난 모세포를 채취하는 과정을 설명한다. 이 난 모세포는 마우스에서 이전에 개발 된 프로토콜을 적용하여 이수 배수 체의 발병률을 조사하는데 사용되었다. 특히, 중기 II 세포 (MII) 난 모세포의 염색체와 중심체 (centromeres)는 공 촛점 레이저 현미경 검사 후 순차적 초점 계획에서 형광으로 분류되고 계수되었다. 이 분석은 미성숙 난 모세포가 난포에서 채취 되고 생체 외에서 성숙되었을 때 이수 배수체 비율에서 더 높은 발병률을 나타냈다.생체 내. 특정 라이신 잔기에서 튜 불린 및 히스톤 4의 아세틸 화 형태에 대한 면역 염색 또한 감수 분열의 형태 및 히스톤 아세틸 화의 전체 패턴에서의 차이를 나타냈다. 마지막으로, 역전사 및 정량적 PCR (q-PCR)에 의해 히스톤 탈 아세틸 화 효소 (HDAC) 및 아세틸 트랜스퍼 라제 (HAT)를 코딩하는 mRNA의 발현을 조사 하였다. 시험 관내생체 내에서 성숙한 난 모세포 사이 에서 전사 물의 상대적인 발현에 차이는 관찰되지 않았다. oocyte 성숙 동안 전사 활동의 일반적인 침묵과 일치하여 총 전사 양의 분석은 mRNA 안정성 또는 분해를 나타낼 수 있습니다. 따라서 이러한 결과는 다른 번역 및 번역 후 규정이 영향을받을 수 있음을 나타냅니다.

전반적으로,이 연구는 형태학 및 생화학 적으로 말의 난 모세포, cell 유형은 낮은 샘플 가용성으로 인해 연구하기 매우 어렵습니다. 그러나, 그것은 생식 생물학 및 monovulatory 종족에 불임에 대한 우리의 지식을 확장 할 수 있습니다.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

여성, 동반자 동물 및 멸종 위기에 처한 종의 불임 치료를 위해 광범위한 재현 기술이 개발되었습니다. 임상 환경에서 가장 보편적 인 절차 중 하나는 초음파 유도 질식 흡입, 난자 채집 (OPU) 1 에 의한 난소에서 난태 (metaphase) II (MII) 단계 난 모세포를 회수하는 것입니다. 이 난 모세포는 수용체 자궁에 이식 된 배아와 함께 시험 관내 (IVF)에서 수정된다. MII- 단계 (성숙한) 난 모세포는 외인성 생식선 자극 호르몬의 투여 후에 회수된다. 그러나이 치료법은 일부 환자에서 난소과 자극 증후군 (OHSS) 2 의 발병과 관련이 있습니다.

한 번 모낭에서 분리 된 자발적으로 감수 분열을 재개하기위한 완전히 성장한 미숙 난 모세포 (GV-stage)의 내재적 인 능력을 이용하여, 관리자없이 성숙한 난 모체를 얻을 수 있습니다gonadotropin 조율 3 . 이 과정은 난자 시험관 내 성숙 (IVM)이라고 불리우며 생식 기술을 돕는 데있어 덜 약물 지향적이고 덜 비싸며 환자 친화적 인 접근 방식을 의미합니다. 그러나 체외 에서 성숙 된 난 모세포 를 이용한 배아 발달의 성공은 일반적 으로 생체 내에서 성숙한 난 모세포보다 더 낮다. 가능한 설명은 체외에서 성숙한 난 모세포가 염색체 분리의 오류에 더 영향을 받고, 결과 배수체가 정상 배아 발생을 저해한다는 것이다.

IVM 동안의 염색체 오 분류의 분자 적 기초를 이해하는 것은 궁극적으로이 기술의 잠재력을 밝혀 줄 것입니다. 이 정맥 에서 in vitro에서 성숙한 난 모세포의 형태 학적 및 생화학 적 특징을 생체 내 성숙과 비교하는 실험 접근법ed oocytes는 7 , 8에 기술되어 있다. 구체적으로, 미성숙 및 성숙 난 모세포의 OPU 및 미성숙 난 모세포의 IVM 절차는 실험 모델로서 성인 및 자연 사이클링 말을 사용하여 설명됩니다. 그런 다음 immunofluorescence 및 이미지 분석은 염색체 분리, 스핀들 형태 및 이러한 배우자의 히스톤 아세틸 화의 전체적인 패턴을 조사하는 데 사용됩니다. 마지막으로 mRNA 발현 분석을 위해 역전사 및 정량적 PCR 프로토콜을 설명합니다.

설치류 동물 모델과 비교하여 말은 유전자 조작을 허용하지 않으며 조작하기가 쉽지 않으며 값 비싼 유지 관리가 필요합니다. 그러나이 모델은 난 모세포 생리학과의 유사성으로 인해 난 모세포의 성숙에 대한 연구에 상당한 관심을 보이고있다 9 , 10 </ sup>. 더욱이, 말에서 IVM-IVF의 신뢰할 수있는 프로토콜의 개발은 높은 유전 적 가치의 암말로부터의 새끼의 수를 증가시킬 수 있기 때문에 상당한 경제적 이익을 갖는다.

난 모세포 (oocytes), 특히 독성이있는 종에서 실험을 수행하는 데있어 한계 중 하나는 제한된 샘플 가용성입니다. 이 한계는 샘플 손실을 최소화하는 염색체 계수를 수행하기 위해 이전에 생쥐에서 개발 된 접근법을 말 난 모세포 13 , 14 로 조정하여 여기서 극복되었습니다 (다른 가능한 기술과의 비교에 대한 설명 참조). 또한, 트리플 형광 얼룩 프로토콜은 동일한 샘플에 대한 여러 분석을 수행하기 위해 최적화되었으며, q - PCR 분석은 2 oocytes의 수영장에서만 수행되었습니다.

전반적으로, 본 연구는 형태 학적 및 생화학 적으로 cha낮은 샘플 가용성으로 인해 연구하기가 극히 어려운 세포 유형 인 말 oocyte를 괴롭 히고 있습니다. 그러나, 그것은 생식 생물학 및 monovulatory 종족의 불임에 대한 우리의 지식을 확장 할 수 있습니다.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

모든 절차는 동물 보호 및 사용위원회 CEEA Val de Loire Number 19에 의해 승인되었으며 실험실 동물의 관리 및 사용에 관한 지침에 따라 수행되었습니다.

1. 난 모세포 수집 및 생체 외 성숙

  1. 오옴 픽업
    1. 매일 성인 암말 집단에서 난소 난소의 직경을 초음파로 평가합니다. 난포가 33 mm 이상일 때, 정맥 정맥 상부에 1,500 IU의 인간 chorionic gonadotrophin (hCG)을 주입한다 (iv).
      1. 주사를하기 전에 알코올로 부위를 닦고 경정맥을 찾은 다음 주사 부위 아래에 2 ~ 3cm 정도의 엄지 손가락을 대어 정맥이 올라 오도록하십시오. 바늘을 목에 거의 평행하게 삽입하고 바늘이 정맥에 있는지 확인하십시오 (혈액이 주사기로 들어갑니다). 이 시점에서 주사; hCG는우성 여포에있는 난 모세포의 발달.
    2. hCG 주사 35 시간 후 detomidine (15 μg / kg, iv), butorphanol tartrate (10 μg / kg, iv) 및 butylscopolamine bromure (0.2-0.3 mg / kg, 15 mL / mare, iv)로 수컷을 진정시킨다.
    3. 바늘을 초음파 탐침에 연결하십시오. 초음파 프로브를 질식 삽입하고 초음파 프로브를 직면하도록 난소를 직립 상태로 유지하십시오. 한 명의 조작원에게 바늘을 조종하고 다른 하나는 초음파 프로브를 마주 보는 난자를 제자리에 놓습니다 . 우세한 난포가있는 난소에서 시작하십시오.
    4. 질 벽과 지배적 인 여포의 벽을 바늘로 찔러 넣으십시오 (OPU 용 초음파 프로브에는 흡입 시스템에 연결된 바늘 용 채널이 있습니다). theneedle은 echographic 이미지에서 볼 수 있습니다.
    5. 흡입 시스템에 연결된 50 ML 원추형 튜브에 follicular 유체를 대기음. 원추형의 내용물을 붓는다.튜브를 큰 배양 접시에 넣고 stereomicroscope를 사용하여 cumulus-oocyte complex (COC)를 찾는다.
    6. COC는 항상 난포액으로 검색되지 않기 때문에, 5 IU / mL heparinat 37 ° C를 함유 한 Dulbecco의 변형 된 인산염 완충 식염수 (DPBS)로 여포를 세척하십시오. 이미 1.1.5 단계에서 난포액에 대해 설명한대로 DPBS의 COC 존재를 검사하십시오. COC가 회수 될 때까지 여러 번 세척하십시오.
    7. 지배적 인 여포에서 COC가 검색되면, 1.1.3-1.1.4 단계에서 지배적 인 여포에 대해 설명한 바와 같이 ≥ 5 및 ≤25mm의 모공을 뚫고 플러시하십시오. 5 개 이상 ≤25 개는 황체 형성 호르몬 / 콜리 오가 나도 트로 핀 수용체 (LHCGR)를 발현하지 않으므로 hCG에 반응하여 성숙하지 않으며 GV 단계 (미성숙)에서 수집됩니다. 여러 가지 완전한 층의 적운 세포와 갈색, 미세하게 과립 화 된 ooplasm으로 만 COC를 유지하십시오. 다른 사람들은 버립니다.
    8. OPU가 끝날 때,감염을 방지하기 위해 수컷은 벤질 - 페니실린 15,000IU / 동물을 투여하십시오.
    9. 최소한 2 시간 동안 조용하고 깨끗한 상태에서 암말을 입으십시오. 귀의 위치, 자극에 대한 반응 ( 예 : 소음)을 측정하고 암말을 다른 동물의 회사에 반환하기 전에 걸음 걸이로인지의 흔적을 확인하십시오.
  2. 체외 성숙
    1. 헤파린 1,790 IU / L, 0.4 % 소 혈청 알부민 (BSA), 페니실린 및 스트렙토 마이신을 보충 한 따뜻한 HEPES- 완충 된 TCM199 (20 mM Hepes) 37 ° C. 미리이 매체를 준비하십시오. 필터를 살균하고 최대 6 개월 동안 4 ° C에서 보관하십시오.
    2. 50 NG / ML 상피 성장 인자 (EGF)와 20 % 송아지 혈청 7 NaHCO 3 - 보충 TCM199 (25 MM NaHCO 3 ) 보완하여 IVM 매체를 준비합니다. 새로운 병을 뗀 후 3 주 이내에 NaHCO 3 보충 TCM199를 사용하십시오. EGF를 미리 100x 배지로 준비하고 -20 ° C에서 동결 시켜라.6 개월 이내에 사용하십시오. 최소한 2 시간 동안 38.5 ° C에서 5 % CO 2 가 포함 된 가습 공기 중에서 4-well dish의 웰에 500 μL를 분배하고 배양하십시오.
    3. 5 ~ 25 밀리미터 이상 모낭에서 COC를 회수 한 후 HEPES-TCM199 2 mL가 채워진 페트리 접시 (직경 3.5 cm)에 넣으십시오. 세포 파편을 씻어 내기 위해 COC를 접시의 다른 영역으로 옮기십시오.
    4. COCs를 IVM 배지에 옮기고 38.5 ° C에서 5 % CO2의 가습 공기 중에서 28 시간 배양합니다.

2. 면역 형광 및 이미지 분석

  1. 염색체 수
    1. 우세한 모낭 또는 IVM의 끝에 수집 후, 38.5 ° C에서 5 % CO 2 와 가습 공기에서 1 시간 100 μm의 monastrol와 COC를 품어. monastrol을 미리 100x 축척으로 준비하고 -20 ° C에서 1 년까지 저장할 수 있습니다.
    2. 적운 세포 제거0.5 % hyaluronidase로 치료하거나 부드럽게 pipetting; 0.2 % pronase에서 처리하여 투명대를 제거합니다. 사전에 hyaluronidase와 pronase를 10x 배지로 준비하고 -20 ° C에서 1 년까지 보관하십시오.
    3. 4 ° C에서 추가로 45 분 후 38.5 ° C에서 15 분 동안 DPBS의 4 % paraformaldehyde에 난 모세포를 수정.
      주의! 파라 포름 알데히드를 취급 할 때는 개인 보호 장비를 착용하고 유해 폐기물 처리 지침에 따라 오염 된 물질을 처리하십시오.
    4. 0.1 % 폴리 비닐 알콜 (PVA)을 보충 한 DPBS 500 μL로 채워진 3 개의 웰에 순차적으로 옮겨 난 모세포를 세척한다. 실온 (RT)에서 10 분 동안 0.3 % Triton X-100에서 침투.
    5. RT에서 적어도 30 분 동안 1 % 소 혈청 알부민 (DPBS-1 % BSA)과 10 % 정상 당나라 혈청을 보충 한 DPBS에서 비특이적 결합 배양을 차단하십시오. 시료는 4 ℃에서 3 ~ 4 일 동안 blocking 용액에 보관할 수 있습니다.
    6. 기본 얼룩 들어, 4 ° C 하룻밤 1 % BSA (희석 1시 50 분)로 보충 DPBS의 토끼 방지 오로라 B phospho - Thr232에 oocytes를 품어.
    7. 단계 2.1.4에서 설명한대로 oocytes를 씻으십시오. 어둠 속에서 실온에서 1 시간 동안 tetra - methylrhodamine isothiocyanate (TRITC) - 결합 당나귀 안티 - 토끼 IgG (DPBS - 1 % BSA에 1 : 100)의 oocytes을 품어.
    8. 단계 2.1.4에서 설명한대로 oocytes을 씻어 다음 유리 슬라이드에 20 μm의 YOPRO1 보충 비 경화, 안티 페이드 장착 매체 한 방울에 3-4 oocytes를 놓으십시오. 모든 난 모세포가 장착 될 때까지 절차를 반복하십시오 (슬라이드 당 3-4 개의 난 모세포).
    9. oocytes가 장착 매체에 약 10 분 동안 정착 수 있도록하고 coverslip으로 그들을 커버. oocytes을 분쇄하지 않도록, 유리 슬라이드에 coverslip을 배치하기 전에 양면 테이프 두 스트립을 적용합니다.
      참고 :이 예방 조치는 모든 샘플이 유리 슬리드 coverslip. 유리 슬라이드는 -20 ° C에서 얼 수 있으며 다음 2-3 일 동안 이미지화됩니다.
    10. 적색 (centromeres) 및 녹색 (염색체) 채널 7 , 13 , 14 , 20 , 21을 사용하여 60X 목적과 공 촛점 레이저 스캐닝 현미경에 샘플을 이미지. 0.35 μm 간격으로 z 축에 전체 metaphasic 플레이트에 걸친 샘플을 스캔하십시오. 모든 단일 계획의 디지털화 된 이미지를 저장하십시오.
    11. NIH ImageJ 소프트웨어 (https://imagej.nih.gov/ij/plugins/cell-counter.html에서 구할 수 있음)의 셀 카운트 기능을 사용하여 직렬 공 촛점 절에서 센트로 메어를 센다.
      참고 : 숫자 코드가있는 순차적 섹션에서 나타나고 머물러 있고 사라지는 중심체를 식별하여 인접한 섹션에 나타나는 centromeres의 반복 횟수를 피하십시오.
    12. 염색체를 반복한다.독립 운영자에게 2.1.11 절에서 unting.
      참고 : euploid (32 염색체), 과잉 배수 (> 32) 또는 저배수 (<32)로 난 모세포를 분류하십시오.
  2. 스핀들 형태와 히스톤 아세틸 화
    1. 지배적 인 여포 또는 IVM의 끝에 수집 후, 단계 2.1.2에서 설명한대로 0.5 % hyaluronidase 또는 부드러운 pipetting으로 치료하여 cumulus 세포를 제거합니다.
    2. 단계 2.1.4에서와 같이 DPBS - PVA의 oocytes을 씻고 38 ° C에서 20 분 동안 2.5 % 파라 포름 알데히드에 그들을 수정. 단계 2.1.4에서 설명한대로 광범위하게 씻어서 0.1 % Triton X-100에서 5 분간 RT에서 투과 시키십시오.
      참고 : 파라 포름 알데히드를 취급 할 때는 개인 보호 장비를 착용하고 유해 폐기물 처리 지침에 따라 오염 된 물질을 처리하십시오.
    3. 2 % 소 혈청 알부민 (DPBS - 2 % BSA), 0.05 % 사포닌 및 10 % 정상 당나라 혈청을 보충 한 DPBS에서 비특이적 결합 배양을 차단RT에서 2 시간.
      참고 : 시료는 4 ℃에서 3 ~ 4 일 동안 블로킹 용액에 보관할 수 있습니다.
    4. 기본 얼룩 들어, 밤새 4 ° C에서 0.05 % 사포닌과 DPBS - 2 % BSA에서 마우스 anti-alpha-tubulin (1 : 150) 및 토끼 anti-acH4K16 (1 : 250)에서 oocytes를 품어.
    5. 단계 2.1.4와 같이 oocytes을 씻으십시오. 0.05 % 사포닌을 함유 한 DPBS-2 % BSA에서 녹색 형광 염료 - 접합 당나귀 항 마우스 IgG (1 : 500) 및 TRITC- 결합 당나귀 항 - 토끼 IgG (1 : 100)의 용액에서 난 모세포를 1 시간 동안 항온 배양한다 어둠 속에서 RT.
    6. 단계 2.1.4에서와 같이 난 모세포를 씻어 낸 다음 1 μg / ML 4 ', 6 - diamidino - 2 - phenylindole (DAPI)을 보충 한 비 경화, 안티 - 페이드 장착 매체 한 방울에 3-4 oocytes를 놓습니다. 유리 슬라이드에.
    7. 단계 2.1.8에서 설명한대로 유리 슬라이드에 oocytes를 탑재합니다.
    8. 빨간색 (acH4K16), 녹색 (알파 - 튜 불린) 및 파란색 (DNA) 채널을 사용하여 60x 대물 렌즈로 공 촛점 레이저 스캐닝 현미경에서 샘플을 이미지화하십시오.
      참고 : 모든 샘플을 수집하는 동안 빨간색과 파란색 채널에 대한 레이저 설정을 일정하게 유지하십시오. 모든 감광 스핀들과 metaphasic 플레이트에 걸쳐 0.35 μm 간격으로 z 축에서 샘플을 스캔하십시오. 디지털화 된 이미지 (단일 계획 및 투사 된 3D 이미지)를 저장하십시오.
    9. NIH ImageJ 소프트웨어 (https://imagej.nih.gov/ij/docs/guide/146-30)의 측정 기능을 사용하여 투영 된 이미지의 최대 너비에서 pole-to-pole 스핀들 길이와 스핀들 직경을 측정하십시오. .html). 각 3 번 반복하고 평균을 계산하십시오.
    10. NIH ImageJ 소프트웨어 (https://imagej.nih.gov/ij/docs/guide/146-30.html)의 통합 밀도 기능을 사용하여 acH4K16의 상대적 형광을 정량화하십시오. DAPI 염색의 통합 밀도를 위해 표준화하십시오.

3. mRNA 발현 분석

  1. 5 ~ 25 mm 모낭에서 COC를 회수 한 후 육아종 세포를 수집합니다페트리 접시에 남아 uspension 및 2 분 10,600 XG에서 원심 분리하여 차가운 DPBS에서 두 번 씻으십시오. 액체 질소에서 급히 동결. -80 ° C에서 최대 6 개월 동안 샘플을 보관하십시오. 세포는 표준 곡선을 위해 봉사 할 것이다.
  2. 미숙 (GV), 체외에서 성숙 및 생체 내에서 성숙 oocytes에서 단계 2.1.2에서 설명한대로 모든 cumulus 세포를 조심스럽게 제거하십시오.
  3. 2.1.4에 설명 된대로 oocytes을 DPBS - PVA에서 씻어, 1 μL 볼륨에서 그들을 수집하고 위에 2 μL RNALater 누워. 액체 질소에서 급속 동결. -80 ° C에서 최대 6 개월 동안 샘플을 보관하십시오.
  4. 루키 페라 제 RNA 2 μg을 각 시료에 스파이크 인 (spike-in)으로 첨가하십시오. oocytes 2 X 2 풀과 작은 샘플에서 RNA를 복구하는 데 적합한 실리카 멤브레인 필터 기반 키트를 사용하여 전체 RNA를 추출하십시오.
  5. 37 μM에서 1 시간 동안 0.25 μg 무작위 hexamers 및 마우스 Moloney 백혈병 바이러스 역전사 효소와 10 μL에서 RNA 역전사 - 176 ℃. 최대 6 개월 동안 -20 ° C에서 샘플을 보관하십시오.
  6. RNAse없는 물에서 granulosa 세포에서 cDNA를 50 NG / μL로 희석. 이 용액을 1:10으로 희석하여 5 ng / μL, 0.5 ng / μL, 0.05 ng / μL 및 0.005 ng / μL 용액을 얻으십시오.
  7. 기질로서 0.05 oocytes에 해당하는 cDNA 또는 granulosa 세포 cDNA의 연속 희석액 5 μL, SYBR 녹색 supermix 10 μL 및 각 특정 프라이머의 0.3 μm의를 사용하여 반응 당 총 20 μL의 총 볼륨에서 triplicate로 반응을 조립 표 1 ).
  8. 3 단계 프로토콜을 사용하여 열 순환 장치에서 반응을 실행하십시오 : 95 ° C 30 초, 60 ° C 30 초 및 72 ° C 20 초, 40 회 반복. 마지막으로, 60 ° C부터 시작하여 용융 곡선을 얻고 95 ° C까지 20 ° C마다 0.5 ° C 씩 온도를 올립니다.
  9. 표준 곡선을 사용하여 oocyte 샘플에서 특정 mRNA의 시작 수량 (SQ)을 평가granulosa 세포 샘플을 기준으로 계산 된 f> 15. 해당 유전자의 SQ와 하우스 키핑 유전자의 SQ 사이의 비율로 데이터를 표현하십시오.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

이 실험에 대한 최초의 발견은 앞서 깊이있게 설명되었으며 본원에서 기술 된 프로토콜을 사용하여 얻을 수있는 결과의 예로서보고되었다.

성숙 비율

지배 모낭으로부터 OPU에 의해 회수 된 32 개의 COC 중 28 개 (88 %)가 MII 단계에 있었다. 크기가 5-25mm 인 모낭으로부터 수집 된 58 개의 COC 중 14 개는 mRNA 발현 연구를 위해 미성숙 난자로 즉각적으로 동결되었다. 나머지 44 명은 시험 관내에서 성숙되었고, 37 명은 MII 단계 (85 %)에 도달했다. 성숙 효율은 두 군에서 유의 한 차이가 없었다 (Fisher 's exact test P> 0.05).

이수 배수체 비율

IVM ca2 차 난 모세포와 첫 번째 극체 사이의 충실한 염색체 분할을 교란 시키면 MII 단계에서 염색체의 수를 계산하여 감수 분열 중 염색체 분리 결과를 나타냅니다. 그림 1A 에서 볼 수 있듯이, Anti-Aurora B phospho-Thr232 항체는 말 난 모세포의 동소체 영역을 특이 적으로 염색하여 염색체의 수를 세는 것을 허용한다. 생체 외에서 성숙한 난 모세포 (0/12, Fisher 's exact test, P <0.05, Figure 1B )와 비교했을 때, 시험 관내에서 성숙한 난 모세포가 이수 배수체 (5/11)에 의해 현저히 더 많은 영향을 받았다. 이수 배수체 난 모세포 (4/5)의 대부분은 과발현이었고; 따라서 염색체 전파와 같이 염색체 손실을 결정하는 표본 준비 과정에서 이수 배율은 인공물에 기인하지 않는다. 동위 원소 영역의 면역 염색도 항 -CENPA 및 항 -AURKB 항체로 시도되었지만, 신호는 관찰되지 않았다두 경우 모두에서 실현되었다 (데이터는 표시되지 않음).

스핀들 형태와 H4K16의 아세틸 화

그림 2 에서와 같이 pole-to-pole 스핀들 길이와 최대 폭에서 스핀들 직경이 측정되었습니다. 이 측정에 따르면, 생체 내 성숙 난 모세포 (길이 14.57 ± 1.7 μm, 직경 13.56 ± 0.91 μm, 비경제 t 세포)와 비교하여 체외 성숙 난 모세포가 19.89 ± 1.15 μm로 더 길고 (17.28 ± 0.81 μm) - 테스트, P <0.05). 동일한 샘플에서 H4K16의 전체 아세틸 화 수준도 측정되었으며, H4K16에서의 아세틸 화가 IVM 난 모세포 의 생체 내 대응 물 ( 그림 2 , 빨간색)과 비교하여 유의하게 낮았다는 것을 확인했습니다.

트란의 표현히스톤 아세틸 트랜스퍼 라제 및 탈 아세틸 화 효소를 암호화하는 스크립트

히스톤 아세틸 화 - 탈 아세틸 화 과정에 관여하는 유전자의 발현 이 시험 관내 - 성숙 난자에서 q-PCR로 조사되었는지 여부. Histone acetyl-transferase 1 ( HAT1 ), K-acetyltransferase 8 (KAT8 ), histone deacetylase 1 ( HDAC1 ), NAD-dependent protein deacetylase sirtuin 1 ( SIRT1 )이 추정 표적이었다. 미성숙, 시험 관내 성숙 및 생체 내 성숙 난자에서 이들 전사 물의 발현의 유의 한 차이는 사용 된 표준화와는 독립적으로 관찰되지 않았다. 구체적으로, 그림 3 에서보고 된 전사 발현 분석 결과는 SQ 방법을 사용하여 표준 곡선에 대해 계산되었고 하우스 키핑 글리세롤 알데히드 -3- 인산 탈수소 효소 ( GAPDH )에 대해 정상화되었다. 마찬가지로 diffe도 없습니다.결과는 루시퍼 라제의 스파이크에 대해 정상화 된 경우 또는 ΔΔct 방법을 사용했을 때 관찰되었다 (미도시).

목표 Fw 프라이머 Rv 프라이머 Amplicon 크기
가프 ATCACCATCTTCCAGGAGCGAGA GTCTTCTGGGTGGCAGTGATGG 241 bp
HAT1 CTGACATGAGTGATGCTGAACA TAACGCGTCGGTAATCTTCC 219bp
HDAC1 GAAGGCGGTCGCAAGAAT CCAACTTGACCTCCTCCTTGA 166bp
KAT8 ACTGGTCTTGGGTCCTGCTG GGGCACTTTTGAGGTGTTCC 198 bp
루시퍼 라제 TCATTCTTCGCCAAAAGCACTCTG d> AGCCCATATCCTTGTCGTATCCC 148bp
SIRT1 GACTCGCAAAGGAGCAGATT GGACTCTGGCATGTTCCACT 169 bp

표 1 : 프라이머 세트. 글리세롤 알데히드 -3- 인산 탈수소 효소 ( GAPDH ) , 히스톤 아세틸 트랜스퍼 라제 1 ( HAT1 ) , 히스톤 ( HAT1 ) , 히스톤 아세틸 트랜스퍼 라제 1 ( HAT1 ) ( HDAC1 ) , K- 아세틸 트랜스퍼 라제 8 ( KAT8 ) , 루시퍼 라제 및 NAD- 의존성 단백질 데 아세틸 라제 시트르산 ( SIRT1 )을 포함한다. 참고 문헌 7의 허락을 받아 증쇄.

/55242fig1.jpg "/>
그림 1 : Vivo- 및 In Vitro 말의 난 모세포의 Aneuploidy rate. ( A ) monastrol로 치료 한 MII- 단계 말 난 모세포의 오로라 B 포스 포 -Thr232 (적색) 및 DNA (녹색) 염색을 나타내는 대표 이미지. 배수 이골 세포 (32 염색체)가 표시됩니다. 스케일 바 = 5 μm. ( B ) 막대 그래프 는 생체 내 (n = 12) 및 시험 관내 (n = 11) 성숙 난 모세포에서의 배수체 및 이배체 MII- 단계 난 모세포의 분포를 나타낸다. * aneuploidy 속도의 유의 한 차이를 나타냅니다 (Fisher 's exact test, P <0.05). 참고 문헌 7의 허가를 받아 증쇄. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 2 그림 2 : Vivo-In Vitro 말 성 난 모세포의 스핀들 측정 및 H4K16 아세틸 화. in vivo (n = 4) 또는 in vitro (n = 14) 성숙 후 MII 난 모세포에서 tubulin (녹색), acetylated H4K16 (적색) 및 DNA (청색)를 나타내는 대표 이미지. 튜 블린 이미지는 스핀들 길이와 직경 측정에 사용 된 축을 보여줍니다. 스케일 바 = 5 μm. 참고 문헌 7 에서 수정 됨. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 3
그림 3 : KAT8, SIRT1 , HAT1 , Immatu의 HDAC1다시, Vivo에서 , In Vitro Matured Oocytes. 막대 그래프는 KAT8 , SIRT1 , HAT1 의 상대 mRNA 발현의 평균 ± SEM을 나타내고 , HDAC1 , 하우스 키핑으로 사용 된 GAPDH 의 SQ와 비교하여 관심있는 성적 증명서의 시작 수량 (SQ)으로 표현됩니다. 미성숙 (GV, n = 14), 생체 내 (n = 14), 및 시험 관내 (n = 12) 성숙 난 모세포 사이에는 통계적 차이가 관찰되지 않았다 (일원 분산 분석, P > 0.05). 참고 문헌 7의 허락을 받아 증쇄. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

비록 IVM이 20 년 이상 말에서 수행되었지만, 우리는 인간에게 제안 된 것처럼 난 모세포가 배아 이수 배체의 기원이 될 수 있는지 여부를 아직 모른다. 그 이유는 염색체 계수를위한 난 모세포의 준비가 상당한 표본 손실을 초래할 수 있기 때문일 것입니다. 이를 염두에두고 염색체 분리의 오류를 조사하는 데 사용 된 방법을 조사하여 말의 난 모세포에 적용 할 수있는 가장 적합한 기술을 찾아 냈습니다. 과학 문헌에서 네 가지 주요 기술이 발견되었습니다 : 1) 염색체 확산 5 , 18 , 19 , 2) 형광 in situ hybridization (FISH) 4 , 6 , 17 , 20 , 3) monastrol-collapsed spindle , 14 , 21 , 22 , 4) 염색체 수없이 염색체 형광 염색 23 , 24 , 25 .

이미 언급했듯이, Giemsa 염색이 뒤 따르는 염색체 확산의 준비는 높은 샘플 손실 속도로 인해 복잡합니다. 이 방법은 많은 경우 다른 프로브를 사용하여 다른 염색체를 매핑하는 FISH로 대체되었습니다. FISH 기법의 단점은 적은 수의 프로브가 사용될 때 가짜 음성의 발생률이 증가 할 수 있다는 것입니다 ( 즉, 누락 된 염기 또는 과다 염색체가 탐색되지 않았으므로 이수 배수 인 세포를 정상적으로 식별 할 수 있음). 따라서 FISH의 신뢰성있는 사용은 주로 이수 배수체에 의해 영향을 많이받는 염색체 의 선험적 지식에 기반한다 ( 예.., 인간의 21 번 염색체). FISH는 이전에 2 번 염색체 2와 4 번 염색체 20 에 대해 2 개의 프로브를 사용하여 말 태아의 염색체 이상을 조사하는 데 사용되었습니다. 이 실험에 따르면, 체외에서 생산 된 배아의 핵은 생체 내에서 생산 된 배아보다 염색체 이상 의해 영향을 받기 쉽다. 이 발견은 IVM 난 모세포에서 monastrol-collapse 방법을 사용하여 위에서보고 된 관찰과 일치한다. 그러나 IVM 난 모세포에서 이수 배수체의 발병률 은 시험관에서 생산 된 배아 에서 FISH를 사용하여보고 된 것보다 훨씬 높았다. 이 부분적 불일치는 FISH 실험에 오직 두 개의 염색체 특이 적 프로브 만 사용되었다는 사실로 설명 할 수 있습니다. 이 접근법은 다른 염색체와 관련된 이수 배수성의 발생을 과소 평가했을 수 있습니다. 특히 말에는 32 염색체가 있다고 생각할 때 그렇습니다. 그러나 심각한 aneu는 제외 될 수 없습니다.중요한 유전 적 이상에 영향을받는 배우자가 더 발전하지 않기 때문에 난 모세포에서 검출 할 수있는 배수체는 배아에서 유지되지 않는다.

monastrol 처리, 염색체 및 centromere 얼룩 및 공 촛점 현미경 검사의 조합은 최소 샘플 손실과 MII 단계 말의 oocytes의 염색체 번호의 일관된 카운트 허용. 말 oocytes에 대한이 기술을 개발에서 발생 기술적 한계는 말 특정 항체의 가용성이었다. Aurora B phospho- (Thr232)를 사용하기 전에 두 개의 다른 항체 (anti-Aurora B 및 anti-CENPA)가 동소체 얼룩을 생성하지 않았습니다. 주목할 만하게, anti-Aurora B 및 anti-CENPA는 이미 소 및 인간 세포에서 성공적으로 사용되었다 26 , 27 , 28 ; 그러므로 그들은 말과 관련이 없다고 결론 지었다. 이 기술은 또한 공 촛점 레이저 sc의 가용성에 의해 제한 될 수 있습니다anning 현미경 및 이미지 분석 소프트웨어. 또한 운영자 유도 유물을 배제하기 위해서는 두 명의 독립 운영자가 장님으로 계산하는 것이 필수적입니다. monastrol-collapsed 스핀들의 염색체 수는 세포 형태학을 잘 보존하고 표본 손실을 방지하는 접근법이지만,이 기술은 염색체의 기본 수의 차이를 관찰 할 수 있습니다. 핵형 분석 및 경우에 따라 FISH에 의해 밝혀 질 수있는 다른 염색체 이상 ( 예 : 전좌, 분절 인터체인지 )에는 유익하지 않습니다.

염색체 분리의 오류는 염색체 수 23 , 24 , 25 번을 수행하지 않고 스핀들 및 염색체 면역 형광법으로 조사했습니다. 이 경우 심각한 변칙과 지연 또는 흩어져있는 염색체가있는 스핀들은 이상한 염색체의 흔적으로 간주됩니다나 분리. 따라서, 시험 관내 에서 흩어져 있던 염색체 가 시험 관내에서 성숙한 난 모세포 (aneuploidy에 의해 영향을 받기 쉬운 종류) 에서 관찰되었다. 그러나 염색체 계수는 정량화 할 수있는 정보를 전달하는 이점이 있습니다.

요약하면, 기술 된 다른 기술과 비교하여, monastrol 및 centromere 염색의 사용은 샘플 손실을 방지하고, 위음매의 발생을 최소화하고, 정량화 할 수 있다는 장점이 있습니다.

epigenetic 수정의 변경은 oocyte aneuploidy의 발병에 가능한 메커니즘으로 제안되었습니다 18 , 24 , 25 . 삼중 형광 염색을 사용하여 감작 스핀을 시각화하고 측정하고 지연 / 분산 염색체를 관찰하는 것이 가능했습니다. 동시에, 항체의 개발 덕분에H4K16의 아세틸 화 수준은 동일한 시료에서 수행되었습니다.이 접근법은 분석에 필요한 난 모세포의 양을 줄이고 H4 아세틸 화와 스핀들의 형태학을 연관시키는 두 가지 목적을 수행했습니다.

공유 단백질 변형의 정량화는 Western blot으로 수행 할 수있다. 그러나이 기술은 더 큰 샘플 크기를 필요로하며 형태학 연구를 위해 샘플의 무결성을 보존하지 못합니다. 삼중 형광 염색 접근법은 다른 히스톤 변형 및 잠재적으로 다른 2 차 항체 8 에 의해 인식 될 수있는 단백질에 적용될 수있다. 유일한 제한 요인은 말 특이 적 항체의 이용 가능성이다. 이런 맥락에서 저자는 말 모델에주의를 기울이는 것이이 종의 기본적인 생물학적 기작에 대한 관심을 증가시킬 수 있기를 희망하며,전용 도구.

마지막으로, 역전사 및 정량적 PCR (q-PCR)에 의해 수행 된 히스톤 탈 아세틸 화 효소 (HDACs) 및 아세틸 트랜스퍼 라제 (HATs)를 코딩하는 mRNA의 발현 연구가 또한 기재되어있다. q-PCR은 널리 보급 된 기술이다. 그러나 말 oocytes에 대한 사용은 확산되지 않습니다. oocyte maturation 29 동안의 전사 활성의 일반적 침묵으로 인해 총 전사 양의 분석은이 배경에서 mRNA 안정성이나 분해 만 나타낼 수 있음을 명기하는 것이 필수적이다. 시험관 내생체 내 성숙 사이 에서 전사 물의 상대적 발현의 차이는 관찰되지 않았다. 이러한 결과는 번역 및 post-translational 규제가 ​​IVM에 의해 영향을받을 수 있음을 보여 주며 translational 및 po를 조사하기위한 다른 실험 접근법의 개발 필요성을 지적합니다단일 세포 수준에서의 단일 - 번역 메커니즘.

전반적으로, 본 연구는 형태 학적 및 생화학 적으로 말의 난 모세포를 특성화하기위한 실험적 접근법을 기술한다. 이 접근법은 인간이나 멸종 위기에 처한 종을 포함하여 낮은 회수율로 유사하게 영향을받는 다른 종의 난 모세포에 적용될 수 있습니다. 이 연구는 포유 동물의 생식 생물학에 대한 지식을 넓히고 불임에 대한 우리의 이해에 기여할 것입니다.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

저자는 공개 할 것이 없습니다.

Acknowledgments

저자들은 레이저 스캐닝 공 촛점 현미경 (LSCM) , Philippe Barrière 및 Thierry Blard의 매일 초음파 난소 스캐닝 및 hCG 주입에 대한 지원을 위해 Fabrice Vincent에게 감사드립니다. 이 작품은 부분적으로 "Regione Sardegna and Regione Lombardia"프로젝트 "Ex Ovo Omnia"(보조금 26096200에서 AML로)에 의해 지원되었습니다. "L' Oreal Italia per le Donne e la Scienza 2012"Fellowship (2012 년 FF로 계약), FP7-PEOPLE-2011-CIG, 연구 집행 기관 (REA) "Pro-Ovum"(부여 번호 303640 - VL); 유럽 ​​사회 기금, 인적 자원 개발 부문 별 운영 프로그램 (2007-2013 년 계약 번호 : POSDRU / 89 / 1.5 / S / 62371 in IM)이 공동으로 후원하는 농업 및 수의학 박사 과정이있다. in vivo oocyte collection은 Français du Cheval et de l' Equitation에 의해 지원되었습니다.

Materials

Name Company Catalog Number Comments
ultrasound probe Aloka UST-5820-7,5
human chorionic gonadotrophin centravet CHO004 1,500 unit/animal IV
detomidine centravet MED010 9 - 15 µg/kg IV
butylscopolamine bromure centravet EST001 0.2 mg/kg IV
stereomicroscope NIKON SMZ-2B
butorphanol centravet DOL003 10µg/kg IV
benzyl-penicillin centravet DEP203 IM 15,000 UI/animal
TCM199 Sigma-Aldrich M3769 10X1L powder for hepes-buffered TCM199
Hepes sodium salt Sigma-Aldrich H3784-100G
bovine serum albumin Sigma-Aldrich A8806
heparin  Sigma-Aldrich H3149-10KU
NaHCO3-buffered TCM199 Sigma-Aldrich M2154-500ML liquid for IVM medium
epidermal growth factor Sigma-Aldrich E4127
newborn calf serum Sigma-Aldrich N4762-500ML
4-well dishes NUNCLON 144444
incubator Heraeus BB6060
monastrol Sigma-Aldrich M8515
hyaluronidase Sigma-Aldrich H3506
pronase Sigma-Aldrich P5147
paraformaldehyde Sigma-Aldrich P6148
polyvinyl alcohol Sigma-Aldrich 341584
triton-X 100 Sigma-Aldrich T8787
normal donkey serum Sigma-Aldrich D9663
rabbit anti-Aurora B phospho-Thr232 BioLegend 636102
TRITC-conjugated donkey anti-rabbit IgG Vector Laboratories 711-025-152
Vecta-Shield Vector Laboratories H-1000
YOPRO1 Thermofisher Scientific Y3603
confocal laser scanning microscope LSM 780 Zeiss
confocal laser scanning microscope LSM 700 Zeiss
ImageJ software rsb.info. nih.gov/ij/download.html free resource
mouse anti-alpha-tubulin Sigma-Aldrich T8203
rabbit anti-acH4K16 Upstate Biotechnology 07-329
AlexaFluor 488-coniugated donkey anti-mouse IgG Life Technologies A21202
4’,6-diamidino-2-phenylindole Sigma-Aldrich D8417 DAPI
centrifuge Eppendorf 5417R
RNALater Invitrogen AM7020
Luciferase RNA Promega L4561
PicoPure RNA Isolation Kit Applied Biosystems 12204-01
random hexamers Thermofisher Scientific N8080127
mouse Moloney leukaemia virus reverse transcriptase Thermofisher Scientific 28025013
SYBR green supermix BioRad 1708880
specific primers Sigma-Aldrich specific primers were designed using Primer3Plus software (free resource)
thermal-cycler BioRad MyiQ
mouse monoclonal anti-CENPA Abcam ab13939
mouse monoclonal anti-Aurora B Abcam ab3609

DOWNLOAD MATERIALS LIST

References

  1. Dellenbach, P. Transvaginal, sonographically controlled ovarian follicle puncture for egg retrieval. Lancet. 1, (8392), 1467 (1984).
  2. Humaidan, P. Ovarian hyperstimulation syndrome: review and new classification criteria for reporting in clinical trials. Hum Reprod. (2016).
  3. Pincus, G., Enzmann, E. V. The Comparative Behavior of Mammalian Eggs in Vivo and in Vitro : I. The Activation of Ovarian Eggs. J Exp Med. 62, (5), 665-675 (1935).
  4. Emery, B. R., Wilcox, A. L., Aoki, V. W., Peterson, C. M., Carrell, D. T. In vitro oocyte maturation and subsequent delayed fertilization is associated with increased embryo aneuploidy. Fertil Steril. 84, (4), 1027-1029 (2005).
  5. Nichols, S. M., Gierbolini, L., Gonzalez-Martinez, J. A., Bavister, B. D. Effects of in vitro maturation and age on oocyte quality in the rhesus macaque Macaca mulatta. Fertil Steril. 93, (5), 1591-1600 (2010).
  6. Requena, A. The impact of in-vitro maturation of oocytes on aneuploidy rate. Reprod Biomed Online. 18, (6), 777-783 (2009).
  7. Franciosi, F. In vitro maturation affects chromosome segregation, spindle morphology and acetylation of lysine 16 on histone H4 in horse oocytes. Reprod Fertil Dev. (2015).
  8. Franciosi, F. Changes in histone H4 acetylation during in vivo versus in vitro maturation of equine oocytes. Mol Hum Reprod. 18, (5), 243-252 (2012).
  9. Choi, Y. H., Gibbons, J. R., Canesin, H. S., Hinrichs, K. Effect of medium variations (zinc supplementation during oocyte maturation, perifertilization pH, and embryo culture protein source) on equine embryo development after intracytoplasmic sperm injection. Theriogenology. (2016).
  10. Hendriks, W. K. Maternal age and in vitro culture affect mitochondrial number and function in equine oocytes and embryos. Reprod Fertil Dev. 27, (6), 957-968 (2015).
  11. Carnevale, E. M. The mare model for follicular maturation and reproductive aging in the woman. Theriogenology. 69, (1), 23-30 (2008).
  12. Ginther, O. J. The mare: a 1000-pound guinea pig for study of the ovulatory follicular wave in women. Theriogenology. 77, (5), 818-828 (2012).
  13. Chiang, T., Duncan, F. E., Schindler, K., Schultz, R. M., Lampson, M. A. Evidence that weakened centromere cohesion is a leading cause of age-related aneuploidy in oocytes. Curr Biol. 20, (17), 1522-1528 (2010).
  14. Duncan, F. E., Chiang, T., Schultz, R. M., Lampson, M. A. Evidence that a defective spindle assembly checkpoint is not the primary cause of maternal age-associated aneuploidy in mouse eggs. Biol Reprod. 81, (4), 768-776 (2009).
  15. Larionov, A., Krause, A., Miller, W. A standard curve based method for relative real time PCR data processing. BMC Bioinformatics. 6, (62), (2005).
  16. Choi, Y. H., Hochi, S., Braun, J., Sato, K., Oguri, N. In vitro maturation of equine oocytes collected by follicle aspiration and by the slicing of ovaries. Theriogenology. 40, (5), 959-966 (1993).
  17. Hassold, T., Hunt, P. To err (meiotically) is human: the genesis of human aneuploidy. Nat Rev Genet. 2, (4), 280-291 (2001).
  18. Akiyama, T., Nagata, M., Aoki, F. Inadequate histone deacetylation during oocyte meiosis causes aneuploidy and embryo death in mice. Proc Natl Acad Sci U S A. 103, (19), 7339-7344 (2006).
  19. Homer, H. A. Mad2 prevents aneuploidy and premature proteolysis of cyclin B and securin during meiosis I in mouse oocytes. Genes Dev. 19, (2), 202-207 (2005).
  20. Rambags, B. P. Numerical chromosomal abnormalities in equine embryos produced in vivo and in vitro. Mol Reprod Dev. 72, (1), 77-87 (2005).
  21. Nabti, I., Marangos, P., Bormann, J., Kudo, N. R., Carroll, J. Dual-mode regulation of the APC/C by CDK1 and MAPK controls meiosis I progression and fidelity. J Cell Biol. 204, (6), 891-900 (2014).
  22. Shomper, M., Lappa, C., FitzHarris, G. Kinetochore microtubule establishment is defective in oocytes from aged mice. Cell Cycle. 13, (7), 1171-1179 (2014).
  23. Luzzo, K. M. High fat diet induced developmental defects in the mouse: oocyte meiotic aneuploidy and fetal growth retardation/brain defects. PLoS One. 7, (11), e49217 (2012).
  24. Ma, P., Schultz, R. M. Histone deacetylase 2 (HDAC2) regulates chromosome segregation and kinetochore function via H4K16 deacetylation during oocyte maturation in mouse. PLoS Genet. 9, (3), e1003377 (2013).
  25. Yang, F., Baumann, C., Viveiros, M. M., De La Fuente, R. Histone hyperacetylation during meiosis interferes with large-scale chromatin remodeling, axial chromatid condensation and sister chromatid separation in the mammalian oocyte. Int J Dev Biol. 56, (10-12), 889-899 (2012).
  26. Luciano, A. M. Oocytes isolated from dairy cows with reduced ovarian reserve have a high frequency of aneuploidy and alterations in the localization of progesterone receptor membrane component 1 and aurora kinase B. Biol Reprod. 88, (3), 58 (2013).
  27. Luciano, A. M., Lodde, V., Franciosi, F., Ceciliani, F., Peluso, J. J. Progesterone receptor membrane component 1 expression and putative function in bovine oocyte maturation, fertilization, and early embryonic development. Reproduction. 140, (5), 663-672 (2010).
  28. Terzaghi, L. PGRMC1 participates in late events of bovine granulosa cells mitosis and oocyte meiosis. Cell Cycle. 1-14 (2016).
  29. Susor, A., Jansova, D., Anger, M., Kubelka, M. Translation in the mammalian oocyte in space and time. Cell Tissue Res. 363, (1), 69-84 (2016).
  30. Chen, J. Genome-wide analysis of translation reveals a critical role for deleted in azoospermia-like (Dazl) at the oocyte-to-zygote transition. Genes Dev. 25, (7), 755-766 (2011).
  31. Ma, J., Flemr, M., Strnad, H., Svoboda, P., Schultz, R. M. Maternally recruited DCP1A and DCP2 contribute to messenger RNA degradation during oocyte maturation and genome activation in mouse. Biol Reprod. 88, (1), 11 (2013).
말의 난 모세포에서의 염색체 분리, 히스톤 아세틸 화 및 스핀들 형태의 분석
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Franciosi, F., Tessaro, I., Dalbies-Tran, R., Douet, C., Reigner, F., Deleuze, S., Papillier, P., Miclea, I., Lodde, V., Luciano, A. M., Goudet, G. Analysis of Chromosome Segregation, Histone Acetylation, and Spindle Morphology in Horse Oocytes. J. Vis. Exp. (123), e55242, doi:10.3791/55242 (2017).More

Franciosi, F., Tessaro, I., Dalbies-Tran, R., Douet, C., Reigner, F., Deleuze, S., Papillier, P., Miclea, I., Lodde, V., Luciano, A. M., Goudet, G. Analysis of Chromosome Segregation, Histone Acetylation, and Spindle Morphology in Horse Oocytes. J. Vis. Exp. (123), e55242, doi:10.3791/55242 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter