Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Developmental Biology

Análisis de la segregación cromosómica, acetilación de histonas y morfología de huso en ovocitos de caballo

doi: 10.3791/55242 Published: May 11, 2017

Summary

Este manuscrito describe un enfoque experimental para caracterizar morfológicamente y bioquímicamente ovocitos de caballo. Específicamente, el presente trabajo ilustra cómo recolectar ovocitos de caballo inmaduros y maduros mediante recogida de óvulos guiada por ultrasonido (OPU) y cómo investigar la segregación de cromosomas, morfología de huso, acetilación de histonas globales y expresión de mRNA.

Abstract

El campo de la reproducción asistida se ha desarrollado para tratar la infertilidad en mujeres, animales de compañía y especies amenazadas. En el caballo, la reproducción asistida también permite la producción de embriones de alto rendimiento sin interrumpir su carrera deportiva y contribuye a un aumento en el número de potros de yeguas de alto valor genético. El presente manuscrito describe los procedimientos utilizados para recolectar ovocitos inmaduros y maduros de ovarios de caballo utilizando la recolección de óvulos (OPU). Estos ovocitos se utilizaron entonces para investigar la incidencia de aneuploidia mediante la adaptación de un protocolo previamente desarrollado en ratones. Específicamente, los cromosomas y los centrómeros de los ovocitos de la metafase II (MII) se marcaron fluorescentemente y se contaron en planos focales secuenciales después de un escaneado con microscopio láser confocal. Este análisis reveló una mayor incidencia en la tasa de aneuploidía cuando ovocitos inmaduros fueron recogidos de los folículos y madurado in vitro en comparación conIn vivo. La inmunotinción para la tubulina y la forma acetilada de la histona cuatro en residuos de lisina específicos también reveló diferencias en la morfología del huso meiótico y en el patrón global de acetilación de las histonas. Por último, la expresión de mRNAs que codifican histonas deacetilasas (HDAC) y acetil-transferasas (HATs) se investigó mediante transcripción inversa y PCR cuantitativa (q-PCR). No se observaron diferencias en la expresión relativa de los transcritos entre ovocitos madurados in vitro e in vivo . De acuerdo con un silenciamiento general de la actividad transcripcional durante la maduración de ovocitos, el análisis de la cantidad total de transcripción sólo puede revelar la estabilidad del ARNm o la degradación. Por lo tanto, estos hallazgos indican que otras regulaciones traslacionales y postraduccionales podrían verse afectadas.

En general, el presente estudio describe un enfoque experimental para caracterizar morfológicamente y bioquímicamente el ovocito de caballo, ceLl tipo que es extremadamente difícil de estudiar debido a la baja disponibilidad de la muestra. Sin embargo, puede ampliar nuestro conocimiento sobre la biología reproductiva y la infertilidad en las especies monovulatorias.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Se ha desarrollado una amplia gama de técnicas de reproducción asistida para tratar la infertilidad en mujeres, animales de compañía y especies en peligro de extinción. Uno de los procedimientos más comunes en los contextos clínicos es la recuperación de ovocitos de la fase metafásica II (MII) de los folículos ováricos por aspiración transvaginal guiada por ultrasonido, recolección de óvulos (OPU) 1 . Estos ovocitos son entonces fertilizados in vitro (FIV), con el (los) embrión (es) resultante (s) implantado (s) en un útero receptor. Los ovocitos de fase MII (maduros) se recuperan después de la administración de gonadotropinas exógenas. Sin embargo, este tratamiento se asocia, en algunos pacientes, con el desarrollo del síndrome de hiperestimulación ovárica (SHO) 2 .

Aprovechando la capacidad intrínseca de los ovocitos inmaduros (GV-etapa) para reanudar espontáneamente la meiosis una vez aislado de sus folículos, es posible obtener ovocitos maduros sin adminisLa gonadotropina 3 . Este procedimiento se denomina maduración in vitro de ovocitos (IVM) y representa un enfoque menos orientado a fármacos, menos costoso y más amigable con el paciente a la tecnología de reproducción asistida. Sin embargo, el éxito del desarrollo embrionario con ovocitos madurados in vitro es generalmente menor que con los ovocitos madurados in vivo 4 , 5 . Una posible explicación es que ovocitos madurados in vitro son más afectados por errores en la segregación cromosómica, y la aneuploidía resultante impide el desarrollo embrionario normal [ 6] .

Entender las bases moleculares de la segregación cromosómica errónea durante la IVM revelaría en última instancia todo el potencial de esta técnica. En este sentido, el enfoque experimental utilizado para investigar las características morfológicas y bioquímicas de los ovocitos madurados in vitro , en comparación con la madurez in vivoEd oocitos se describe aquí 7 , 8 . Específicamente, los procedimientos para la OPU de ovocitos inmaduros y maduros y la IVM de ovocitos inmaduros se ilustran utilizando caballos adultos y de ciclo natural como modelo experimental. Luego, la inmunofluorescencia y el análisis de imágenes se utilizan para investigar la segregación cromosómica, la morfología del huso, y el patrón global de acetilación de histonas en estos gametos. Finalmente, se describe un protocolo de transcripción inversa y PCR cuantitativa para el análisis de la expresión de mRNA.

En comparación con los modelos animales de roedores, los caballos no permiten la manipulación genética, son menos fáciles de manipular y requieren un mantenimiento costoso. Sin embargo, este modelo está ganando interés considerable para el estudio de la maduración de ovocitos 9 , 10 debido a la similitud con la fisiología ovárica humana 11 , 12 </ Sup>. Por otra parte, el desarrollo de protocolos fiables de IVM-IVF en el caballo tiene un interés económico sustancial, ya que permitiría un aumento en el número de potros de yeguas de alto valor genético.

Una de las limitaciones de realizar experimentos en ovocitos, especialmente en especies monovulatorias, es la disponibilidad restringida de muestras. Este límite se ha superado aquí ajustando un enfoque, previamente desarrollado en ratones, a ovocitos de caballo 13 , 14 con el fin de llevar a cabo el recuento de cromosomas que minimiza la pérdida de muestra (véase la discusión para una comparación con otras técnicas disponibles). Además, se ha optimizado un protocolo de tinción con fluorescencia triple para realizar múltiples análisis en la misma muestra, y se realizaron análisis de q-PCR en agrupaciones de 2 oocitos solamente.

En general, el presente estudio describe un enfoque experimental dirigido a morfológicamente y bioquímicamente chaRacterizar el ovocito del caballo, un tipo de célula que es extremadamente difícil de estudiar debido a la baja disponibilidad de la muestra. Sin embargo, puede ampliar nuestro conocimiento de la biología reproductiva y la infertilidad de las especies monovulatorias.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Todos los procedimientos fueron aprobados por el Comité de Cuidado y Uso de Animales CEEA Val de Loire Número 19 y se realizaron de acuerdo con los Principios Rectores para el Cuidado y Uso de Animales de Laboratorio.

1. Recolección de ovocitos y maduración in vitro

  1. Recolección de óvulos
    1. Evaluar diariamente por ultrasonido el diámetro de los folículos ováricos en una cohorte de yeguas adultas. En la aparición de un folículo ≥ 33 mm (folículo dominante), inyectar a la yegua 1.500 UI de gonadotropina coriónica humana (hCG) en la parte superior de la vena yugular (iv).
      1. Antes de realizar la inyección, limpie el área con alcohol, ubique el surco yugular y coloque el pulgar 2-3 cm bajo el sitio de inyección para inducir la elevación de la vena. Inserte la aguja casi paralela al cuello y aspire para asegurarse de que la aguja está en la vena (la sangre entrará en la jeringa). En este punto, inyecte; HCG inducirá la mActualización del ovocito en el folículo dominante.
    2. 35 h después de la inyección de hCG, sedar la yegua con detomidina (15 μg / kg, iv), tartrato de butorfanol (10 μg / kg, iv) y bromuro de butilscopolamina (0.2-0.3 mg / kg, 15 mL / yegua iv).
    3. Conecte la aguja a la sonda de ultrasonido. Insertar la sonda de ultrasonido por vía vaginal y mantener el ovario transrectal para hacer frente a la sonda de ultrasonido. Instruir a un operador para que maniobre la aguja y el otro para mantener el ovario en su lugar, con el folículo frente a la sonda de ultrasonido . Comience desde el ovario con el folículo dominante.
    4. Perforar la pared vaginal y la pared del folículo dominante con la aguja (las sondas de ultrasonido para OPU están equipadas con un canal para la aguja conectada a un sistema de succión); Será visible en la imagen ecográfica.
    5. Aspirar el líquido folicular en un tubo cónico de 50 mL conectado al sistema de succión. Verter el contenido de la cónicaTubo en una placa de Petri grande y la búsqueda de la cumulus-oocito complejo (COC) utilizando un estereomicroscopio.
    6. Dado que el COC no siempre se recupera con el líquido folicular, enjuague el folículo con solución salina tamponada con fosfato modificada (DPBS) de Dulbecco que contiene 5 UI / ml de heparinato a 37 ° C. Examinar DPBS para la presencia de COC, como se describió anteriormente para el líquido folicular en el paso 1.1.5. Enjuague varias veces hasta que se recupere el COC.
    7. Una vez recuperado el COC del folículo dominante, puntee y limpie los folículos ≥5 y ≤25 mm, como se describe para el folículo dominante en los pasos 1.1.3-1.1.4; Los folículos ≥5 y ≤25 no expresan el receptor de la hormona luteinizante / coriogonadotropina (LHCGR) y, por tanto, sus ovocitos no madurarán en respuesta a la hCG y se recogerán en el estadio GV (inmaduro). Sólo mantenga COCs con varias capas completas de células del cúmulo y de ooplasma marrón finamente granulado. Descarta los otros.
    8. Al final de la OPU, enJect la yegua con bencil-penicilina 15.000 UI / animal para prevenir la infección.
    9. Casa de la yegua en un tranquilo, estable limpio por lo menos 2 h. Compruebe los signos de conciencia mediante la determinación de la posición de los oídos, la reacción a los estímulos ( por ejemplo, el ruido), y la marcha antes de regresar la yegua a la compañía de otros animales.
  2. Maduración in vitro
    1. TCM199 tamponado con HEPES caliente (Hepes 20 mM) suplementado con heparina de 1790 UI / L, albúmina de suero bovino (BSA) al 0,4%, penicilina y estreptomicina a 37ºC. Prepare este medio por adelantado. Filtrar-esterilizar y mantenerlo a 4 ° C por hasta 6 meses.
    2. Preparar el medio IVM mediante la suplementación de NaHCO3 - tamponado TCM199 (25 mM NaHCO 3 ) con 50 ng / mL de factor de crecimiento epidérmico (EGF) y 20% de suero de ternera [ 7] . Use NaHCO 3 -buffered TCM199 dentro de 3 semanas de abrir una nueva botella. Preparar el FCE por adelantado como 100x existencias, congelar a -20 ° C, Y utilizarlo en el plazo de 6 meses. Dispense 500 μL en los pocillos de una placa de 4 pocillos e incube en aire humidificado con 5% de CO 2 a 38,5 ° C durante al menos 2 h.
    3. Después de la recuperación de los COC de los folículos de ≥5 y ≤25 mm, ponerlos en una placa petri (3,5 cm de diámetro) llena con 2 mL de HEPES-TCM199. Mueva los COCs a diferentes áreas del plato para lavar los restos celulares.
    4. Transferir los COC al medio de IVM e incubar durante 28 h en aire humidificado con 5% de CO 2 a 38,5 ° C.

2. Análisis de inmunofluorescencia y de imágenes

  1. Recuento de cromosomas
    1. Después de la recolección del folículo dominante o al final de la IVM, incubar los COC con 100 μ M monastrol durante 1 h en el aire humidificado con 5% de CO 2 a 38,5 ° C. Preparar monastrol por adelantado como 100x existencias y almacenar a -20 ° C por un año.
    2. Eliminar las células cumulusTratándolos con hialuronidasa al 0,5% o pipeteando suavemente; Quitar la zona pelúcida tratándola en 0,2% de pronasa. Preparar la hialuronidasa y la pronasa por adelantado como 10x existencias y almacenarlos a -20 ° C durante un máximo de 1 año.
    3. Fijar los ovocitos en paraformaldehído al 4% en DPBS durante 15 min a 38,5ºC seguido por otros 45 min a 4ºC.
      ¡PRECAUCIÓN! Utilice equipo de protección personal cuando manipule paraformaldehído y deseche los materiales contaminados de acuerdo con las directrices de eliminación de desechos peligrosos.
    4. Lavar los oocitos mediante transferencia secuencial en 3 pocillos rellenos con 500 μl de DPBS suplementado con alcohol polivinílico al 0,1% (PVA). Permeabilizar en Triton X-100 al 0,3% durante 10 min a temperatura ambiente (RT).
    5. Bloquear la unión no específica mediante incubación en DPBS suplementado con albúmina de suero bovino al 1% (DPBS-1% de BSA) y suero normal de burro al 10% durante al menos 30 minutos a TA. Las muestras se pueden mantener en solución de bloqueo a 4 ° C durante 3-4 días.
    6. Para la tinción primaria, incubar los oocitos en conejo anti-Aurora B fosfo-Thr232 en DPBS suplementado con 1% de BSA (dilución 1:50) a 4 ° C durante la noche.
    7. Lave los ovocitos como se describe en el paso 2.1.4. Incubar los oocitos en una solución de IgG anti-conejo (1: 100 en DPBS-1% de BSA) de burro conjugado con tetra-metilrhodamina (TRITC) durante 1 h a TA en la oscuridad.
    8. Lave los oocitos como se describe en el paso 2.1.4 y luego coloque 3-4 oocitos en una gota de medio de montaje antideslizante sin endurecimiento suplementado con YOPRO1 20 μM en un portaobjetos de vidrio. Repita el procedimiento hasta que todos los ovocitos estén montados (3-4 oocitos por diapositiva).
    9. Deje que los oocitos se asienten durante unos 10 minutos en el medio de montaje y luego cubrirlos con un cubreobjetos. Para evitar el aplastamiento de los ovocitos, aplique dos tiras de cinta de doble cara antes de colocar el cubreobjetos en el portaobjetos de vidrio.
      NOTA: Esta precaución también asegurará que todas las muestras estén igualmente comprimidas entre el vidrio sliDe y el cubreobjetos. Los portaobjetos de vidrio se pueden congelar a -20 ° C y obtener imágenes durante los siguientes 2-3 días.
    10. Imagen de las muestras en un microscopio confocal de barrido láser con un objetivo de 60X utilizando los canales rojo (centromeres) y verde (cromosomas) 7 , 13 , 14 , 20 , 21 . Escanear las muestras que abarcan toda la placa metafásica en el eje z, con pasos cada 0,35 μm. Guarda las imágenes digitalizadas de cada plan.
    11. Cuente los centrómeros en secciones confocales en serie utilizando la función de recuento de células del software NIH ImageJ (disponible en: https://imagej.nih.gov/ij/plugins/cell-counter.html).
      NOTA: Evite un recuento repetido de centrómeros que aparecen en secciones adyacentes identificando los centrómeros que aparecen, permanecen y desaparecen en secciones secuenciales con un código numérico.
    12. Repita el cromosómico coEn el paso 2.1.11 con un operador independiente.
      NOTA: Clasifique los ovocitos como euploides (32 cromosomas), hiperploides (> 32), o hipoploides (<32).
  2. Morfología del huso y acetilación de las histonas
    1. Después de la recolección del folículo dominante o al final de la IVM, retire las células del cúmulo por tratamiento en hialuronidasa al 0,5% o mediante pipeteo suave, como se describe en el paso 2.1.2.
    2. Lavar los oocitos en DPBS-PVA, como en la etapa 2.1.4, y fijarlos en paraformaldehído al 2,5% durante 20 min a 38 ° C. Lavar a fondo, como se describe en el paso 2.1.4, y permeabilizar en Triton X-100 al 0,1% durante 5 min a RT.
      NOTA: Use equipo de protección personal cuando maneje paraformaldehído y deseche los materiales contaminados de acuerdo con las directrices de eliminación de desechos peligrosos.
    3. Bloquear la unión no específica mediante incubación en DPBS suplementado con 2% de albúmina de suero bovino (DPBS - 2% BSA), 0,05% de saponina y 10% de suero normal de burro foR 2 h a TA.
      NOTA: Las muestras pueden mantenerse en solución de bloqueo a 4 ° C durante 3 - 4 días.
    4. Para la tinción primaria, incubar los oocitos en ratón anti-α-tubulina (1: 150) y conejo anti-acH4K16 (1: 250) en DPBS-2% BSA con 0,05% de saponina a 4 ° C durante la noche.
    5. Lavar los ovocitos como en el paso 2.1.4. Incubar los oocitos en una solución de IgG anti-ratón de burro conjugado con colorante fluorescente verde (1: 500) y IgG anti-conejo conjugado con TRITC (1: 100) en DPBS-BSA al 2% con saponina al 0,05% durante 1 h a RT en la oscuridad.
    6. Lavar los ovocitos como en el paso 2.1.4, y luego colocar 3-4 oocitos en una gota del medio de montaje no endurecible y antideslizante suplementado con 1 μg / mL de 4 ', 6-diamidino-2-fenilindol (DAPI) En una diapositiva de cristal.
    7. Monte los oocitos en los portaobjetos de vidrio como se describe en el paso 2.1.8.
    8. Image las muestras en un microscopio confocal de barrido láser con un objetivo de 60x utilizando los canales rojo (acH4K16), verde (alfa-tubulina) y azul (ADN).
      NOTA: Mantenga los ajustes del láser para los canales rojo y azul constantes durante la adquisición de todas las muestras. Escanear las muestras que abarcan todo el huso meiótico y la placa metafásica en el eje z, con pasos cada 0,35 μm. Guarda las imágenes digitalizadas (planos únicos y la imagen 3D proyectada).
    9. Mida la longitud del husillo polo-polo y el diámetro del husillo a la anchura máxima en la imagen proyectada usando la función de medición del software NIH ImageJ (https://imagej.nih.gov/ij/docs/guide/146-30 .html). Repetir cada 3 veces y calcular la media.
    10. Cuantifique la fluorescencia relativa de acH4K16 utilizando la función de densidad integrada del software NIH ImageJ (https://imagej.nih.gov/ij/docs/guide/146-30.html). Normalizar para la densidad integrada de la tinción DAPI.

3. Análisis de la expresión del mRNA

  1. Después de que los COC se hayan recuperado de los folículos de 5 a 25 mm, recoger la célula granulosa sUspensión que permaneció en la placa de Petri y se lavó dos veces en DPBS frío centrifugando a 10.600 xg durante 2 min. Congelación instantánea en nitrógeno líquido. Almacenar las muestras a -80 ° C durante un máximo de 6 meses; Las células servirán para la curva estándar.
  2. Eliminar con cuidado todas las células del cúmulo, como se describe en el paso 2.1.2, a partir de ovocitos maduros (GV), madurados in vitro e in vivo .
  3. Lavar los ovocitos, como se describe en 2.1.4, en DPBS-PVA, recogerlos por separado en volúmenes de 1 μL y colocar 2 μl de RNALater en la parte superior. Snap-freeze en nitrógeno líquido. Almacenar las muestras a -80 ° C durante un máximo de 6 meses.
  4. Añada 2 pg de ARN de luciferasa a cada muestra como espiga. Piscina de los ovocitos 2 x 2 y extraer el total de ARN utilizando una membrana de sílice a base de filtro de kit adecuado para recuperar el ARN de pequeñas muestras.
  5. Reverse-transcribe el ARN en 10 μL con 0,25 μg de hexámeros aleatorios y la transcriptasa inversa del virus de la leucemia Moloney de ratón durante 1 h a 37 & # 176; C. Almacene las muestras a -20 ° C durante un máximo de 6 meses.
  6. Diluir el ADNc de las células de la granulosa en agua libre de ARNasa a 50 ng / μl. Diluya en serie esta solución 1:10 para obtener soluciones de 5 ng / μl, 0,5 ng / μL, 0,05 ng / μl y 0,005 ng / μL.
  7. Ensamble las reacciones por triplicado en un volumen total de 20 μL por reacción utilizando un cDNA equivalente a 0,05 oocitos como sustrato, o 5 μL de las diluciones en serie del ADNc de la célula de la granulosa, 10 μL de la supermezcla verde SYBR y 0,3 μM de cada cebador específico Tabla 1 ).
  8. Se lleva a cabo la reacción en un ciclador térmico usando un protocolo de 3 etapas: 95ºC durante 30 s, 60ºC durante 30 s, y 72ºC durante 20 s, repetido 40 veces. Finalmente, adquirir la curva de fusión, comenzando a partir de 60 ° C, y aumentar la temperatura en 0,5 ° C cada 20 s hasta 95 ° C.
  9. Evaluar la cantidad de partida (SQ) del mRNA específico en las muestras de ovocitos utilizando la curva estándarF "> 15 calculado sobre la base de la muestra de células de la granulosa Expresar los datos como la relación entre la SQ del gen de interés y la SQ de los genes de limpieza.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Los hallazgos originales de estos experimentos se describieron en profundidad anteriormente 7 y se describen aquí como un ejemplo de resultados que se pueden obtener usando los protocolos descritos.

Tasa de maduración

De los 32 COC recuperados por OPU de los folículos dominantes, 28 (88%) estaban en la etapa MII. Catorce de los 58 AOC recogidos de los folículos de 5 a 25 mm de tamaño fueron instantáneamente congelados como ovocitos inmaduros para el estudio de expresión de mRNA. Los 44 restantes se maduraron in vitro , y 37 alcanzaron la etapa MII (85%). La eficiencia de maduración no fue significativamente diferente en los dos grupos (prueba exacta de Fisher P> 0,05).

Tasa de Aneuploidy

Con el fin de estudiar si IVM caN perturbar la fiel cromosómica partición entre el ovocito secundario y el primer cuerpo polar, el número de cromosomas en la etapa MII fue contado, ya que representa el resultado de la segregación cromosómica durante la meiosis I. Como se muestra en la Figura 1A , el anti-Aurora B El anticuerpo fosfo-Thr232 teñió específicamente la región centromérica en ovocitos de caballo, permitiendo contar el número de cromosomas. Los ovocitos madurados in vitro fueron significativamente más afectados por la aneuploidía (5/11) en comparación con los ovocitos madurados in vivo (0/12, prueba exacta de Fisher, P <0.05, Figura 1B ). La mayoría de los ovocitos aneuploides (4/5) eran hiperploides; Por lo tanto, la tasa de aneuploidía no resulta de artefactos en la preparación de la muestra que determina la pérdida cromosómica, como ocurre con los diferenciales cromosómicos. La inmunotinción de la región centromérica también se intentó con los anticuerpos anti-CENPA y anti-AURKB, pero no se observó señalEn ambos casos (datos no presentados).

Morfología del eje y acetilación de H4K16

Se midieron la longitud del husillo de polo a polo y el diámetro del husillo a la anchura máxima, como se ilustra en la Figura 2 . De acuerdo con estas mediciones, los ovocitos madurados in vitro fueron significativamente más largos (19,89 ± 1,15 μm) y más anchos (17,28 ± 0,81 μm) en comparación con los ovocitos madurados in vivo (14,57 ± 1,7 μm de longitud y 13,56 ± 0,91 μm de diámetro , P <0,05). En las mismas muestras, también se midió el nivel de acetilación global de H4K16, lo que confirma que la acetilación en H4K16 fue significativamente menor en los ovocitos IVM en comparación con sus homólogos in vivo ( Figura 2 , rojo).

Expresión de tranSecuencias de comandos que codifican histona acetiltransferasas y desacetilasas

Se investigó por q-PCR si se alteró la expresión de genes implicados en el proceso de acetilación-desacetilación de histonas en ovocitos madurados in vitro . Se identificaron histona acetil transferasa 1 ( HAT1 ), K-acetiltransferasa 8 (KAT8 ), histona desacetilasa 1 ( HDAC1 ) y proteína desacetilasa sirtuina 1 ( SIRT1 ) dependiente de NAD como dianas putativas. No se observaron diferencias significativas en la expresión de estos transcritos en ovocitos inmaduros, madurados in vitro e in vivo , independientemente de la normalización utilizada. Específicamente, los resultados del análisis de expresión transcrito reportado en la Figura 3 se calcularon frente a una curva estándar utilizando el método SQ y se normalizaron para la administración de gliceraldehído-3-fosfato deshidrogenasa ( GAPDH ). Similarmente, no hay diferenciaRences se observaron cuando los resultados se normalizaron para el pico en luciferase o cuando se usó el método ΔΔct (no se muestra).

Objetivo Fw primer Rv primer Tamaño del amplicón
GAPDH ATCACCATCTTCCAGGAGCGAGA GTCTTCTGGGTGGCAGTGATGG 241 pb
HAT1 CTGACATGAGTGATGCTGAACA TAACGCGTCGGTAATCTTCC 219 pb
HDAC1 GAAGGCGGTCGCAAGAAT CCAACTTGACCTCCTCCTTGA 166 pb
KAT8 ACTGGTCTTGGGTCCTGCTG GGGCACTTTTGAGGTGTTCC 198 pb
Luciferasa TCATTCTTCGCCAAAAGCACTCTG D AGCCCATATCCTTGTCGTATCCC 148 pb
SIRT1 GACTCGCAAAGGAGCAGATT GGACTCTGGCATGTTCCACT 169 pb

Tabla 1: Primer Setails. La secuencia 5 '> 3' de los cebadores delanteros (Fw) y (Rv) y el tamaño de amplicón esperado se dan para cada transcripción analizada: gliceraldehído-3-fosfato deshidrogenasa ( GAPDH ) , histona acetiltransferasa 1 ( HAT1 ) , histona Desacetilasa 1 ( HDAC1 ) , K-acetiltransferasa 8 ( KAT8 ) , luciferasa , y NAD-dependiente proteína desacetilasa sirtuina 1 ( SIRT1 ). Reimpreso con permiso de la referencia 7 .

/55242fig1.jpg "/>
Figura 1: Tasa de Aneuploidía en Ovocitos de Caballo Vivos e In Vitro- madurados. ( A ) Imágenes representativas que muestran coloración de aurora B fosfo-Thr232 (rojo) y ADN (verde) de un ovocito de caballo de etapa MII tratado con monastrol. Se muestra un ovocito euploide (32 cromosomas). Barra de escala = 5 μm. ( B ) El gráfico de barras representa la distribución de ovocitos euploides y aneuploides de fase MII en ovocitos madurados in vivo (n = 12) e in vitro (n = 11). * Indica una diferencia significativa en la tasa de aneuploidía (prueba exacta de Fisher, P <0,05). Reimpreso con el permiso de la referencia 7. Haga clic aquí para ver una versión más grande de esta figura.

Figura 2 Figura 2: Medición del huso y la acetilación de H4K16 en ovocitos de caballo madurados in vivo e in vitro . Imágenes representativas que muestran tubulina (verde), H4K16 acetilado (rojo) y ADN (azul) en ovocitos MII después de maduración in vivo (n = 4) o in vitro (n = 14). Las imágenes de tubulina muestran los ejes utilizados para las mediciones de longitud y diámetro del husillo. Barra de escala = 5 μm. Modificado a partir de la referencia 7 . Haga clic aquí para ver una versión más grande de esta figura.

figura 3
Figura 3: Expresión de KAT8 , SIRT1 , HAT1 , Y HDAC1 en ImmatuRe, In Vivo , Y ovocitos maduros in vitro . Los gráficos de barras representan la media pm SEM de la expresión relativa de mRNA de KAT8 , SIRT1 , HAT1 , Y HDAC1 , Expresada como la cantidad inicial (SQ) de la transcripción de interés en comparación con la SQ de GAPDH , utilizada como limpieza. No se observaron diferencias estadísticas entre ovocitos maduros (GV, n = 14), in vivo (n = 14) e in vitro (n = 12) (ANOVA unidireccional, P > 0,05). Reimpreso con permiso de la referencia 7 . Haga clic aquí para ver una versión más grande de esta figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

A pesar de que la IVM se ha realizado en caballos durante más de 20 años 16 , todavía no sabemos si el ovocito puede ser el origen de la aneuploidía embrionaria, como se ha propuesto para los seres humanos [ 17] . La razón es, probablemente, que la preparación de los diferenciales de oocitos para el conteo de cromosomas da lugar a una pérdida considerable de muestras. Con esto en mente, una encuesta de los métodos utilizados para investigar errores en la segregación cromosómica se llevó a cabo para buscar la técnica más adecuada para aplicar a ovocitos de caballos. Cuatro técnicas principales fueron encontradas en la literatura científica: 1) spreads cromosómicos 5 , 18 , 19 , 2) hibridación in situ fluorescente (FISH) 4 , 6 , 17 , 20 , 3) centromero contar con husillos monastrol-colapsados , 13 , 14 , 21 , 22 y 4) tinción de fluorescencia de cromosomas sin recuento de cromosomas 23 , 24 , 25 .

Como ya se ha mencionado, la preparación de los diferenciales cromosómicos seguida por la tinción de Giemsa se complica por una alta tasa de pérdida de muestras. Este método ha sido sustituido en muchos casos por FISH, que utiliza sondas específicas para asignar diferentes cromosomas. Un inconveniente de las técnicas de FISH es que cuando se utiliza un pequeño número de sondas, la incidencia de un falso negativo puede aumentar ( es decir, identificar como normal una célula que es aneuploide debido a que el cromosoma desaparecido o supernumerario no ha sido probado). El uso fiable de FISH se basa en gran medida en el conocimiento a priori de los cromosomas que son más frecuentemente afectados por la aneuploidía ( por ejemplo,, El cromosoma 21 en seres humanos). FISH se ha utilizado previamente para investigar anormalidades cromosómicas en embriones de caballo utilizando 2 sondas, contra el cromosoma 2 y el cromosoma 4 [ 20] . De acuerdo con estos experimentos, los núcleos de embriones producidos in vitro son más propensos a ser afectados por anormalidades cromosómicas que los embriones producidos in vivo . Este hallazgo está de acuerdo con la observación anterior, utilizando el método monastrol-colapso en ovocitos IVM. Sin embargo, la incidencia de aneuploidía en los ovocitos IVM fue incluso mayor que la reportada usando FISH en embriones producidos in vitro [ 20] . Esta discrepancia parcial puede explicarse por el hecho de que sólo dos sondas cromosómicas específicas se utilizaron para los experimentos FISH. Este enfoque podría haber subestimado la incidencia de aneuploidía que implican otros cromosomas, especialmente cuando se considera que los caballos tienen 32 cromosomas. No obstante, no se puede excluir que losLas ploidías detectables en los ovocitos no se mantienen en los embriones debido a que los gametos afectados por anomalías genéticas críticas podrían no desarrollarse más.

La combinación de tratamiento con monastrol, coloración cromosómica y centromérica y microscopía confocal permitió contar de forma consistente el número de cromosomas en ovocitos de caballos de etapa MII con una pérdida mínima de muestras. La limitación técnica encontrada en el desarrollo de esta técnica para los ovocitos de caballos fue la disponibilidad de anticuerpos específicos de caballo. Antes de utilizar Aurora B phospho- (Thr232), otros dos anticuerpos (anti-Aurora B y anti-CENPA) no produjeron una mancha centromérica. En particular, anti-Aurora B y anti-CENPA ya se han utilizado con éxito en las células bovina y humana 26 , 27 , 28 ; Por lo tanto, se concluyó que no eran específicos para el caballo. Esta técnica también puede ser limitada por la disponibilidad de un láser confocal scY un software de análisis de imágenes. Además, el conteo ciego por dos operadores independientes es esencial para excluir los artefactos inducidos por el operador. A pesar de que el recuento cromosómico de un huso colapsado monastrol es un enfoque que preserva mejor la morfología de la célula y evita la pérdida de muestras, esta técnica sólo permite observar diferencias en el número básico de cromosomas; No es informativo sobre otras anormalidades cromosómicas ( por ejemplo, translocaciones, intercambios segmentarios, etc. ) que pueden ser reveladas por cariotipo y, en algunos casos, por FISH.

Los errores en la segregación cromosómica también se han investigado por huso y la inmunofluorescencia cromosómica, sin realizar un recuento cromosómico 23 , 24 , 25 . En este caso, los husos con anomalías graves y cromosomas rezagados o dispersos se consideran signos de cromoso erráticoSegregación. En consecuencia, se observaron cromosomas que se dispersaron fuera del huso en ovocitos madurados in vitro 7 (la clase que es más probable que se vea afectada por aneuploidía). Sin embargo, el conteo cromosómico tiene la ventaja de transmitir información cuantificable.

En resumen, en comparación con las otras técnicas descritas, el uso de tinción monastrol y centrómero tiene la ventaja de prevenir la pérdida de muestras, minimizar la incidencia de falsos negativos y ser cuantificable.

La alteración de las modificaciones epigenéticas se ha propuesto como un posible mecanismo en el inicio de la aneuploidía de ovocitos [ 18 , 24 , 25] . Utilizando una tinción triple fluorescente, fue posible visualizar y medir el huso meiótico y observar cromosomas rezagados / dispersos. Al mismo tiempo, gracias al desarrollo de anticuerpos queReconocen las modificaciones de residuos específicas, el nivel de acetilación de H4K16 se llevó a cabo en la misma muestra. Este enfoque tuvo el doble propósito de reducir la cantidad de oocitos necesarios para el análisis y la correlación de acetilación H4 con la morfología del huso.

La cuantificación de las modificaciones de las proteínas covalentes puede realizarse mediante transferencia Western. Sin embargo, esta técnica requiere un mayor tamaño de las muestras y no preserva la integridad de la muestra para los estudios morfológicos. El enfoque de tinción con fluorescencia triple se puede aplicar a otras modificaciones de histonas y, potencialmente, a cualquier proteína que pueda ser reconocida por diferentes anticuerpos secundarios 8 ; El único factor limitante es la disponibilidad de anticuerpos específicos para caballos. En este contexto, los autores esperan que la atención al modelo de caballos aumente el interés en la investigación de los mecanismos biológicos básicos en esta especie y, por tanto, en el desarrolloHerramientas dedicadas.

Finalmente, se describe también el estudio de expresión de ARNm que codifican histonas desacetilasas (HDAC) y acetil-transferasas (HATs), realizadas mediante transcripción inversa y PCR cuantitativa (q-PCR). Q-PCR es una técnica ampliamente difundida; Sin embargo, su uso para los ovocitos de caballo no es difuso. Es esencial especificar que, debido al silenciamiento general de la actividad transcripcional durante la maduración de ovocitos [ 29] , el análisis de la cantidad total de transcripción sólo puede revelar la estabilidad del ARNm o la degradación en este fondo [ 30 , 31] . No se observaron diferencias en la expresión relativa de los transcritos entre maduración in vitro e in vivo . Estos hallazgos indican que la regulación traslacional y traslacional puede verse afectada por la IVM, señalando la necesidad de desarrollar otros enfoques experimentales dirigidos a investigar la translación y poSt-translacional mecanismos a nivel de una sola célula.

En general, el presente estudio describe un enfoque experimental para caracterizar morfológicamente y bioquímicamente ovocitos de caballo. Este enfoque puede aplicarse a los ovocitos de otras especies que se ven afectadas de manera similar por una baja tasa de recuperación, incluidos los seres humanos o las especies en peligro de extinción. Estos estudios ampliarán nuestro conocimiento de la biología reproductiva de mamíferos y contribuirán a nuestra comprensión de la infertilidad.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores no tienen nada que revelar.

Acknowledgments

Los autores desean agradecer a Fabrice Vincent por el soporte con microscopía confocal de barrido láser (LSCM) , y Philippe Barrière y Thierry Blard por realizar el ultrasonido de exploración ovárica diaria y la inyección de hCG. Este trabajo fue apoyado en parte por el proyecto "Regione Sardegna y Regione Lombardia" "Ex Ovo Omnia" (Subvención 26096200 a AML); La beca "L'Oreal Italia per le Donne e la Scienza 2012" (Contrato 2012 a FF), FP7-PEOPLE-2011- CIG, Agencia Ejecutiva de Investigación (REA) "Pro-Ovum" (Subvención 303640 a VL); Y por la Escuela Postdoctoral de Agricultura y Medicina Veterinaria, cofinanciada por el Fondo Social Europeo, Programa Operativo Sectorial para el Desarrollo de los Recursos Humanos 2007-2013 (Contrato POSDRU / 89 / 1.5 / S / 62371 a IM). La colección de ovocitos in vivo fue financiada por el Institut Français du Cheval et de l'Equitation.

Materials

Name Company Catalog Number Comments
ultrasound probe Aloka UST-5820-7,5
human chorionic gonadotrophin centravet CHO004 1,500 unit/animal IV
detomidine centravet MED010 9 - 15 µg/kg IV
butylscopolamine bromure centravet EST001 0.2 mg/kg IV
stereomicroscope NIKON SMZ-2B
butorphanol centravet DOL003 10µg/kg IV
benzyl-penicillin centravet DEP203 IM 15,000 UI/animal
TCM199 Sigma-Aldrich M3769 10X1L powder for hepes-buffered TCM199
Hepes sodium salt Sigma-Aldrich H3784-100G
bovine serum albumin Sigma-Aldrich A8806
heparin  Sigma-Aldrich H3149-10KU
NaHCO3-buffered TCM199 Sigma-Aldrich M2154-500ML liquid for IVM medium
epidermal growth factor Sigma-Aldrich E4127
newborn calf serum Sigma-Aldrich N4762-500ML
4-well dishes NUNCLON 144444
incubator Heraeus BB6060
monastrol Sigma-Aldrich M8515
hyaluronidase Sigma-Aldrich H3506
pronase Sigma-Aldrich P5147
paraformaldehyde Sigma-Aldrich P6148
polyvinyl alcohol Sigma-Aldrich 341584
triton-X 100 Sigma-Aldrich T8787
normal donkey serum Sigma-Aldrich D9663
rabbit anti-Aurora B phospho-Thr232 BioLegend 636102
TRITC-conjugated donkey anti-rabbit IgG Vector Laboratories 711-025-152
Vecta-Shield Vector Laboratories H-1000
YOPRO1 Thermofisher Scientific Y3603
confocal laser scanning microscope LSM 780 Zeiss
confocal laser scanning microscope LSM 700 Zeiss
ImageJ software rsb.info. nih.gov/ij/download.html free resource
mouse anti-alpha-tubulin Sigma-Aldrich T8203
rabbit anti-acH4K16 Upstate Biotechnology 07-329
AlexaFluor 488-coniugated donkey anti-mouse IgG Life Technologies A21202
4’,6-diamidino-2-phenylindole Sigma-Aldrich D8417 DAPI
centrifuge Eppendorf 5417R
RNALater Invitrogen AM7020
Luciferase RNA Promega L4561
PicoPure RNA Isolation Kit Applied Biosystems 12204-01
random hexamers Thermofisher Scientific N8080127
mouse Moloney leukaemia virus reverse transcriptase Thermofisher Scientific 28025013
SYBR green supermix BioRad 1708880
specific primers Sigma-Aldrich specific primers were designed using Primer3Plus software (free resource)
thermal-cycler BioRad MyiQ
mouse monoclonal anti-CENPA Abcam ab13939
mouse monoclonal anti-Aurora B Abcam ab3609

DOWNLOAD MATERIALS LIST

References

  1. Dellenbach, P. Transvaginal, sonographically controlled ovarian follicle puncture for egg retrieval. Lancet. 1, (8392), 1467 (1984).
  2. Humaidan, P. Ovarian hyperstimulation syndrome: review and new classification criteria for reporting in clinical trials. Hum Reprod. (2016).
  3. Pincus, G., Enzmann, E. V. The Comparative Behavior of Mammalian Eggs in Vivo and in Vitro : I. The Activation of Ovarian Eggs. J Exp Med. 62, (5), 665-675 (1935).
  4. Emery, B. R., Wilcox, A. L., Aoki, V. W., Peterson, C. M., Carrell, D. T. In vitro oocyte maturation and subsequent delayed fertilization is associated with increased embryo aneuploidy. Fertil Steril. 84, (4), 1027-1029 (2005).
  5. Nichols, S. M., Gierbolini, L., Gonzalez-Martinez, J. A., Bavister, B. D. Effects of in vitro maturation and age on oocyte quality in the rhesus macaque Macaca mulatta. Fertil Steril. 93, (5), 1591-1600 (2010).
  6. Requena, A. The impact of in-vitro maturation of oocytes on aneuploidy rate. Reprod Biomed Online. 18, (6), 777-783 (2009).
  7. Franciosi, F. In vitro maturation affects chromosome segregation, spindle morphology and acetylation of lysine 16 on histone H4 in horse oocytes. Reprod Fertil Dev. (2015).
  8. Franciosi, F. Changes in histone H4 acetylation during in vivo versus in vitro maturation of equine oocytes. Mol Hum Reprod. 18, (5), 243-252 (2012).
  9. Choi, Y. H., Gibbons, J. R., Canesin, H. S., Hinrichs, K. Effect of medium variations (zinc supplementation during oocyte maturation, perifertilization pH, and embryo culture protein source) on equine embryo development after intracytoplasmic sperm injection. Theriogenology. (2016).
  10. Hendriks, W. K. Maternal age and in vitro culture affect mitochondrial number and function in equine oocytes and embryos. Reprod Fertil Dev. 27, (6), 957-968 (2015).
  11. Carnevale, E. M. The mare model for follicular maturation and reproductive aging in the woman. Theriogenology. 69, (1), 23-30 (2008).
  12. Ginther, O. J. The mare: a 1000-pound guinea pig for study of the ovulatory follicular wave in women. Theriogenology. 77, (5), 818-828 (2012).
  13. Chiang, T., Duncan, F. E., Schindler, K., Schultz, R. M., Lampson, M. A. Evidence that weakened centromere cohesion is a leading cause of age-related aneuploidy in oocytes. Curr Biol. 20, (17), 1522-1528 (2010).
  14. Duncan, F. E., Chiang, T., Schultz, R. M., Lampson, M. A. Evidence that a defective spindle assembly checkpoint is not the primary cause of maternal age-associated aneuploidy in mouse eggs. Biol Reprod. 81, (4), 768-776 (2009).
  15. Larionov, A., Krause, A., Miller, W. A standard curve based method for relative real time PCR data processing. BMC Bioinformatics. 6, (62), (2005).
  16. Choi, Y. H., Hochi, S., Braun, J., Sato, K., Oguri, N. In vitro maturation of equine oocytes collected by follicle aspiration and by the slicing of ovaries. Theriogenology. 40, (5), 959-966 (1993).
  17. Hassold, T., Hunt, P. To err (meiotically) is human: the genesis of human aneuploidy. Nat Rev Genet. 2, (4), 280-291 (2001).
  18. Akiyama, T., Nagata, M., Aoki, F. Inadequate histone deacetylation during oocyte meiosis causes aneuploidy and embryo death in mice. Proc Natl Acad Sci U S A. 103, (19), 7339-7344 (2006).
  19. Homer, H. A. Mad2 prevents aneuploidy and premature proteolysis of cyclin B and securin during meiosis I in mouse oocytes. Genes Dev. 19, (2), 202-207 (2005).
  20. Rambags, B. P. Numerical chromosomal abnormalities in equine embryos produced in vivo and in vitro. Mol Reprod Dev. 72, (1), 77-87 (2005).
  21. Nabti, I., Marangos, P., Bormann, J., Kudo, N. R., Carroll, J. Dual-mode regulation of the APC/C by CDK1 and MAPK controls meiosis I progression and fidelity. J Cell Biol. 204, (6), 891-900 (2014).
  22. Shomper, M., Lappa, C., FitzHarris, G. Kinetochore microtubule establishment is defective in oocytes from aged mice. Cell Cycle. 13, (7), 1171-1179 (2014).
  23. Luzzo, K. M. High fat diet induced developmental defects in the mouse: oocyte meiotic aneuploidy and fetal growth retardation/brain defects. PLoS One. 7, (11), e49217 (2012).
  24. Ma, P., Schultz, R. M. Histone deacetylase 2 (HDAC2) regulates chromosome segregation and kinetochore function via H4K16 deacetylation during oocyte maturation in mouse. PLoS Genet. 9, (3), e1003377 (2013).
  25. Yang, F., Baumann, C., Viveiros, M. M., De La Fuente, R. Histone hyperacetylation during meiosis interferes with large-scale chromatin remodeling, axial chromatid condensation and sister chromatid separation in the mammalian oocyte. Int J Dev Biol. 56, (10-12), 889-899 (2012).
  26. Luciano, A. M. Oocytes isolated from dairy cows with reduced ovarian reserve have a high frequency of aneuploidy and alterations in the localization of progesterone receptor membrane component 1 and aurora kinase B. Biol Reprod. 88, (3), 58 (2013).
  27. Luciano, A. M., Lodde, V., Franciosi, F., Ceciliani, F., Peluso, J. J. Progesterone receptor membrane component 1 expression and putative function in bovine oocyte maturation, fertilization, and early embryonic development. Reproduction. 140, (5), 663-672 (2010).
  28. Terzaghi, L. PGRMC1 participates in late events of bovine granulosa cells mitosis and oocyte meiosis. Cell Cycle. 1-14 (2016).
  29. Susor, A., Jansova, D., Anger, M., Kubelka, M. Translation in the mammalian oocyte in space and time. Cell Tissue Res. 363, (1), 69-84 (2016).
  30. Chen, J. Genome-wide analysis of translation reveals a critical role for deleted in azoospermia-like (Dazl) at the oocyte-to-zygote transition. Genes Dev. 25, (7), 755-766 (2011).
  31. Ma, J., Flemr, M., Strnad, H., Svoboda, P., Schultz, R. M. Maternally recruited DCP1A and DCP2 contribute to messenger RNA degradation during oocyte maturation and genome activation in mouse. Biol Reprod. 88, (1), 11 (2013).
Análisis de la segregación cromosómica, acetilación de histonas y morfología de huso en ovocitos de caballo
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Franciosi, F., Tessaro, I., Dalbies-Tran, R., Douet, C., Reigner, F., Deleuze, S., Papillier, P., Miclea, I., Lodde, V., Luciano, A. M., Goudet, G. Analysis of Chromosome Segregation, Histone Acetylation, and Spindle Morphology in Horse Oocytes. J. Vis. Exp. (123), e55242, doi:10.3791/55242 (2017).More

Franciosi, F., Tessaro, I., Dalbies-Tran, R., Douet, C., Reigner, F., Deleuze, S., Papillier, P., Miclea, I., Lodde, V., Luciano, A. M., Goudet, G. Analysis of Chromosome Segregation, Histone Acetylation, and Spindle Morphology in Horse Oocytes. J. Vis. Exp. (123), e55242, doi:10.3791/55242 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter