Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Rensing av High Molecular Weight Genomisk DNA fra meldugg for Long-Les Sekvense

doi: 10.3791/55463 Published: March 31, 2017
* These authors contributed equally

Abstract

De meldugg sopp er en gruppe av økonomisk viktige sopp plantepatogener. Relativt lite er kjent om den molekylære biologi og genetikk av disse patogener, delvis på grunn av en mangel på godt utviklede genetiske og genomiske ressurser. Disse organismene har store, repeterende genomer, som har gjort genomsekvensering og montering prohibitivt vanskelig. Her beskriver vi fremgangsmåter for innsamling, ekstraksjon, rensing og kvalitetskontroll vurdering av høy molekylvekt av genomisk DNA fra en meldugg art, Golovinomyces cichoracearum. Protokollen er beskrevet omfatter mekanisk oppbrytning av sporer, etterfulgt av en optimalisert fenol / kloroform-ekstraksjon av genomisk DNA. Et typisk utbytte var 7 pg DNA pr 150 mg konidier. Det genomiske DNA som er isolert ved hjelp av denne fremgangsmåten er egnet for lang lese sekvensering (dvs.> 48,5 kbp). Kvalitetskontroll tiltak for å sikre at størrelsen, utbyttet og renheten av det genomiske DNA er ogsåbeskrevet i denne fremgangsmåte. Sekvensering av det genomiske DNA av den kvalitet som er beskrevet her gjør det mulig for sammenstillingen og sammenligning av flere pulveraktig meldugg genomer, som i sin tur vil føre til en bedre forståelse og forbedret kontroll av denne jordbruks patogen.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Pulveraktig meldugg er en gruppe av obligat biotrophic sopp plantepatogener som, når de tas sammen, er den største årsaken til plantesykdom verden over en. Det er over 900 beskrevne arter av meldugg, som har blitt taksonomisk gruppert i fem stammer innen familien Erisyphaceae 2. Både på grunn av sin økonomiske betydning og det intime forholdet de utvikler med sine verter, har meldugg sykdommer vært gjenstand for forskning i> 100 år. Ved infeksjon, pulveraktig meldugg fremkalle drastiske endringer i den cellulære struktur, metabolisme og molekylær biologi av deres verter, for å dra nytte av dette patogen. Imidlertid er studiet av pulver-meldugg særlig utfordrende på grunn av sin obligat livsstil, og vekst av soppen i renkultur har ennå ikke blitt beskrevet 3, 4, 5,"xref"> 6, 7, 8. Pålitelig og stabil genetisk transformasjon av pulver-meldugg har også ennå ikke er oppnådd, selv om forbigående transformasjonen har blitt rapportert i noen arter 9, 10.

Den sekvensering og montering av meldugg genomer har vist seg vanskelig på grunn av en rekke trekk ved selve genomet. Meldugg genomer er store (120-180 MBP) i forhold til andre sopp genomer, og består av 60 til 90% som er jevnt fordelt repeterende elementene 11. Disse elementene omfatter ikke-lange terminale gjentagelser, samt Uncategorized repeterende elementer. To formae speciales av en enkelt meldugg arter, Blumeria graminis f. sp. hordei og f. sp. tritici (Bgh og BGT, henholdsvis) så vel som drue meldugg Erysiphe necator, har bien sekvensert, og utkast genomer for flere andre har blitt fullført 12, 13, 14. Den repeterende naturen til genomet har gjort sammenstilling vanskelig, og den ferdige Bgh genomet ble satt sammen til 6,989 supercontigs med en L50 på 2 Mb 12.

Til tross for det store genomet, pulveraktig meldugg ser ut til å ha et lite antall proteinkodende gener, med 5.845 og 6,540 gener predikerte i Bgh og BGT, henholdsvis. De sekvenserte pulveraktige meldugg også synes å mangle i det minste 99 kjerne gener som er essensielle i andre fungi, noe som er konsistent med avhengighet av sopp på sin vertsplante for overlevelse 11, 12, 13, 14.

Repetitive sekvenser i nærheten av telomerer, sentromerer, ribosomal RNEt gen matriser og regioner som er anriket på transposable elementer er dårlig satt sammen av korte lese sekvensering strategier og er ofte underrepresentasjon av genomet sammenstillinger 15. Slike områder, tenkt å være ansvarlig for mange av de hull som oppstår i genomsekvenser, og dette gjelder pulveraktig meldugg med deres omfattende utvidelse av repetitive elementer 16. Sterkt plastgenomområder ofte finnes i slike repetitive regioner 3. De tjener som et område av kromosomet omordninger og ofte koder for gener under sterk seleksjonstrykk, slik som genene som koder for effektor-proteiner og gener som koder for enzymer til sekundær metabolisme. Fremskritt i single-molekyl lang leser sekvense teknologi gir en potensiell løsning for sekvensering over repetitive regioner av genomer 15. For eksempel, Faino et al. (2015) fant at også på lang sekvens lese teknologi og optisk mapping tillot dem å fremstille en gap-mindre genomsekvens for to stammer av sopp plantepatogen Verticillium Dahlia, tredoble mengden av repeterende DNA-sekvenser i genomet, noe som øker antallet av gene merknader (og reduksjon av antall av delvis eller mangler genet kommentarer ) og avslørende genomet rearrangementer 17.

Å ansette disse lange leste sekvense teknologier, høye konsentrasjoner av høy kvalitet genomisk DNA, med minimal størrelse> 20 kbp, er nødvendig. Her beskriver vi våre fremgangsmåter for Konidiale samling, rensing av høy molekylvekt-DNA fra konidier og for kvalitetskontroll vurderinger ved hjelp av meldugg arten Golovinomyces cichoracearum dyrket på agurk 18. Denne protokollen er basert på en protokoll utviklet i laboratoriet B. Keller gruppe (University of Haller Zürich Sveits) 13, 19og omfatter flere modifikasjoner som førte til økte DNA-utbytte og en høyere andel av DNA> 48,5 kbp i størrelse. Protokollen inneholder også kvalitetskontroll skritt basert på anbefalinger fra United States Department of Energy Joint Genome Institute 20, 21, 22.

Funksjonen av hver reagens som inngår i lyseringsbuffer, og begrunnelsen for hvert rensetrinn, er som beskrevet i Henry (2008) 23. Tilgjengelige, publiserte protokoller for isolering av høy molekylvekt genomisk DNA fra plante og mikrobielle vev ble også konsultert under utformingen av denne protokollen 24, 25, 26, 27, 28.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Fremstilling av soppmateriale

  1. Økende meldugg
    1. Dyrke planter i vekstkammer med de følgende betingelser: 22 ° C dag temperatur, 20 ° C nattetemperaturen, 80% relativ fuktighet, 14-h dagers-lengde og en lysintensitet på 125 μE / m2 / s (levert av lysstoffrør ).
    2. Infisere agurkplanter (Cucumis sativa rekke Bush Champion) med Golovinomyces cichoracearum belastning UCSC1 som beskrevet 18, 29.
  2. Høsting meldugg Sporer
    1. Høste conidia fra infiserte planter på 7 - 10 dager etter inokulasjon ved anvendelse av en liten vakuum med et in-line filter (11 um) på hvilket conidia akkumulere. Påføring av et lett trykk kjøres vakuummunnstykket langs den flate av bladet for å samle konidier.
      NB: Det gjennomsnittlige utbyttet av G. cichoracearum er 20 mg sporer fra en tungt infected agurk blad på ca 130 cm 2 i området.
    2. Børste omtrent 150 mg av conidia (ca. 375 ul volum, eller konidier fra 7-8 infiserte blader agurk) fra filteret på et ark av rent papir. Herfra overføres konidier i 2 ul cryovials med to 5-/ 32-inch diameter på forhånd avkjølt (i flytende nitrogen) stål oppmalingskuler. Umiddelbart tilbake rør til flytende nitrogen. Oppbevar rørene ved -80 ° C.
  3. Breaking Åpne Sporer av Ball Milling
    1. Flash fryse aluminiumsplater av kulemølle i flytende nitrogen. Belastnings cryovials inn i kulemølle rack. Rist de cryovials med konidie- og stålkulene i kulemølle i 30 sekunder ved 30 perioder / s (ved romtemperatur). Umiddelbart fryses cryovials i flytende nitrogen.
      MERK: I utgangspunktet tilgang til et utvalg av sporer av mikroskopi ved 100X forstørrelse for effektiviteten av celleveggen brudd under sliping. Hvis nødvendig, male opp i ytterligere 1 - 2 runder av 30 s for 30 sykluser / s, bUT holde antall runder til et minimum. Rutine vurdering av Konidiale brudd ved mikroskopi på dette trinn er ikke nødvendig når optimale betingelser er blitt etablert.

2. Genomisk DNA Purification

  1. sporer Lysis
    1. Arbeider raskt for å unngå tining konidier, fjerne stålkulene fra fryseflasker med en magnet. Legg 700 ul 65 ° C lyseringsbuffer (tabell 1) og vortex 5 - 10 s, inntil en oppslemning er dannet.
    2. Tilsett 300 ul forvarmet (65 ° C) 5% (v / v) sarcosyl og forsiktig invertere for å blande (1 inversjon per 3 r) fem ganger. Inkuber rørene i 30 minutter ved 65 ° C; invertere forsiktig 3 ganger ved 10, 20 og 30 min. Ved hjelp av en vid boring pipettespissen, overføre hele løsningen til nye 2 ml mikrosentrifugerør. Ved alle etterfølgende trinn, blandes ved forsiktig, langsom inversjon og overføre DNA-inneholdende oppløsninger med vid boring pipettespisser.
  2. DNA-ekstraksjon jeg
    1. Tilsett 1 volum av klorform: isoamylalkohol (24: 1 v / v) til den lyseløsningen og snus forsiktig for å blande fem ganger. Inkuber i 10 minutter ved romtemperatur, forsiktig invertere for å blande fem ganger ved halvveis og igjen på slutten av inkubering. Sentrifuger ved romtemperatur i 15 min ved 14.000 x g. Ved hjelp vid boring pipettespissen, overfører det vandige lag til et nytt 2 ml mikrosentrifugerør nøye; unngå å få med materiale fra grenseflaten.
  3. DNA Nedbør jeg
    1. Tilsett 1 volum romtemperatur 100% isopropanol (ca. 750 ul) og forsiktig invertere for å blande seks ganger. Sentrifuger ved romtemperatur i 15 min ved 14.000 x g. fjern supernatanten forsiktig og kastes.
    2. Legg 450 ul pre-avkjølt (-20 ° C) 70% etanol. Sentrifuger i 5 minutter ved romtemperatur ved 14 000 x g. fjern supernatanten forsiktig og kastes. Sentrifuger ved 1000 x g i 3 s, fjern forsiktig supernatanten med fin pipettespissen og kast den. Luft-tørke pellet i 15 min ent værelsestemperatur. Ikke tørk i mer enn 15 min.
    3. Resuspender pelleten i 300 pl TE (10 mM Tris-Cl, 1 mM etylendiamintetra-eddiksyre, pH 8,0). Inkuber over natten ved 4 ° C. Knips forsiktig å suspendere eventuelle gjenværende materiale som ikke går i oppløsning.
  4. For å fjerne RNA forurensning, tilsett 10 ul RNase A (10 mg / ml). Snu forsiktig å blande tre ganger. Sentrifuger ved 1000 xg i 3 s. Inkuber ved 37 ° C i 2 timer.
  5. DNA-ekstraksjon II
    1. Tilsett 300 ul fenol: kloroform: isoamylalkohol (25: 24: 1 v / v) og forsiktig invertere for å blande fem ganger. Inkuber 10 minutter ved romtemperatur, forsiktig snu å blande fem ganger på halvveis og igjen på slutten av inkubasjon. Sentrifuger i 15 minutter ved romtemperatur ved 14 000 x g. Ved hjelp av en vid boring pipettespissen, Overfør supernatanten til et nytt 1,5 ml mikrosentrifugerør.
  6. DNA Utfelling II
    1. Legg 0,01 volum 3 M natriumacetat pH 5,2 (approximately 3 mL), forsiktig invertere å blande fem ganger. Legg 2,5 volumer på forhånd avkjølt (-20 ° C) 100% etanol (ca. 750 ul). Snu forsiktig å blande fem ganger. Inkuber over natten ved -20 ° C
    2. Sentrifuger i 30 minutter ved 4 ° C ved 14.000 x g. fjern supernatanten forsiktig og kastes.
    3. Legg 450 ul pre-avkjølt (-20 ° C) 70% etanol. Sentrifuger i 5 min ved 4 ° C ved 14.000 x g. fjern supernatanten forsiktig og kastes. Sentrifuger ved 1000 xg i 3 s. Fjern forsiktig supernatanten med fin pipettespissen og kast den.
    4. Luft-tørke pellet i 30-60 minutter ved romtemperatur. Resuspender pellet i 27,5 pl TE. Inkuber over natten ved 4 ° C. Knips forsiktig å suspendere eventuelle gjenværende materiale som ikke går i oppløsning.
    5. Alikvoter 2,5 pl til 22,5 pl TE (endelig volum 25 ul) for kvalitetstester (se nedenfor). Oppbevar DNA-prøver ved 4 ° C før innsending for sekvensering. For langtidslagring, lagre prøveneved -80 ° C og minimalisere fryse-tine-sykluser for å forhindre skråstilling.
      MERK: Vær forsiktig når du pipettering på dette trinnet som høy molekylvekt genomisk DNA kan være vanskelig å pipettere riktig, og det er viktig å sikre at "QC Delmengde" er en nøyaktig gjengivelse av genomisk DNA-prøve.

3. Kvalitetskontroll

  1. Prøve Purity
    1. Ved hjelp av en TE blank, vurdere prøven renheten av DNA ved lasting av 1 pl QC Alikvoter på et lite volum spektrofotometer. Record A260 / A280 og A260 / A230 avlesninger. Rent DNA vil ha et A260 / A280-forhold på omtrent 1,8 og A260 / A230-forhold mellom 1,8 og 2,2.
  2. Kvantifisering av Genomisk DNA
    1. Utfører kvantifisering av QC alikvot ved å bruke et kommersielt dobbelttrådet DNA kvantifisering Assaysett ifølge produsentens instruksjoner.
  3. DNA Quality Assessment jeg
    1. Belastning omtrent 60 ng genomisk DNA og enDNA stige på en 0,7% agarosegel i 1 x TAE (40 mM Tris, 20 mM eddiksyre, og 1 mM EDTA, pH 8,0). Kjør gelen-apparat ved 70 V i 40 - 45 min til genom-DNA-bånd er omtrent 2 cm fra brønnen og bandet separasjon i stigen er åpenbar. Disse forhold kan trenge å bli justert på grunnlag av tilgjengelige gelelektroforese apparat.
  4. DNA Quality Assessment II
    1. Belastning omtrent 60 ng genomisk DNA, og en høy molekylvekt-DNA stige (egnet for pulsfelt-gelelektroforese) på en 1% agarosegel i 0,5x TBE (44,5 mM Tris, 44.5 mM borsyre, 1 mM EDTA, pH 8,3) og kjøres i 0,5 x TBE-rennende buffer ved anvendelse av en 5-80 kbp bølgepulsfelt-gelelektroforese protokollen i 16 timer.
  5. Vurdering av bakterier, sopp og Plant Forurensninger
    1. Utføre polymerase kjedereaksjon (PCR) for å amplifisere de passende indre transkriberte avstandsstykker (ITS) regioner av de ribosomale gener ved anvendelse av primere og utvidelsesforholdene listeed i tabell 2. Belastning 10 pl av den resulterende reaksjons på en gel.
      MERK: En bånd som representerer meldugg sin region bør amplifiseres med sopp DETS primere. DNA fra dette fragment, og et hvilket som helst fragment generert med bakterier eller planter primere skal bli sekvensert for å bestemme opprinnelsen til forurensning. Bare meldugg DETS sekvenser bør finnes i sopp fragment.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Et representativt eksempel på 60ng renset genomisk DNA fra G. cichoracearum kjørt på en agarosegel ved hjelp av gelelektroforese og ved anvendelse av pulset felt gel-elektroforese er vist i figurene 1 og 2, respektivt. Genomiske DNA-preparater som passerer, marginalt passerer og mislykkes kvalitetskontroll er representert. Genomisk DNA-preparater som fullt passerer kvalitetskontroll er ideelle for sekvensering ved hjelp av lang leser genomsekvense tilnærminger. Preparater som marginalt passerer kvalitetskontroll er akseptable, men preparater som fullt ut passerer, er foretrukket. Preparater som ikke kvalitetskontroll er ikke akseptabelt for lange lese genom sekvensering tilnærminger.

Figur 1
Figur 1: agarosegel-elektroforese av renset genomisk DNA. Lane 1: Spor 2: genomisk DNA som gikk kvalitetskontroll; Felt 3: genomisk DNA som ble ansett som marginal; og Felt 4: genomisk DNA som mislyktes kvalitetskontroll. Akseptable og marginale genomiske DNA-prøver har et enkelt bånd som løper over 20 kbp med minimal overstrålingen ved <20 kbp. Genomiske DNA-prøver som ikke kvalitetskontroll får avsmitting under 20 kbp, og kan inkludere lav molekylvekt fragmenter på omtrent 100 bp (*). Pulset felt gelelektroforese er nødvendig for å skille mellom akseptable og marginale DNA-prøver. Etidiumbromid ble tilsatt til gelen før elektroforese for å visualisere det genomiske DNA. Prøvene ble underkastet elektroforese ved 60 V i 50 minutter. Gelen ble fotografert under UV lys ved hjelp av en gel dokumentasjonssystem.

Figur 2
Figur2: Pulsed-Field gelelektroforese (PFGE) av renset meldugg Genomisk DNA. Felt 1: molekylvektstandarder, med den høyeste band på 48,5 kbp og den laveste ved 8,1 kbp. Sporene 2 og 5: molekylvektstandarder som viser bånd 20, 10, 7, 5, 4, 3, 2 og 1,5 kbp (ved bunnen av gelen bilde). Felt 3: en marginal prøve-DNA, med det meste av DNA mellom 20 og 48,5 kbp i størrelse. Felt 4: en akseptabel prøve-DNA, med det meste av DNA> 48.5 kbp (*). Prøver ble kjørt ved 75 V i 15 timer ved å bruke en 5-80 kbp PFGE bølgeform program. DNA-farging fargen ble satt til gelen etter elektroforese og gelen ble fotografert under UV-lys ved anvendelse av en gel dokumentasjonssystem.

reagens endelig Konsentrasjon
kalium Metabisulfite (K 2 S 2 O 5) 0,25 M
Tris-buffer pH 7,5 0,2 M
Etylendiamintetraeddiksyre (EDTA) 50 mM
Natriumklorid (NaCl) 2 M
Cetyltrimetylammoniumbromid (CTAB) 2% v / v

Tabell 1: Fremstilling av lyseringsbuffer. Bring til et volum på 5 ml med dH 2 O.

Mål primer Name primer Sekvens Tm (° C) Forventet Product Size (bp)
fungal ITS2 FW (ITS9) GAACGCAGCRAAIIGYGA 56 til 61,3 336
RV (ITS4) TCCTCCGCTTATTGATATGC 52.1
Bakteriell 16S V4 FW (515F) GTGCCAGCMGCCGCGGTAA 63,8 til 66,5 331
RV (805R) GGACTACHVGGGTWTCTAAT 46,9 til 53,8
Bakterielle 16S V4-V5 FW (515F-Y) GTGYCAGCMGCCGCGGTAA 60,8 til 66,5 450
RV (926R) CCGYCAATTYMTTTRAGTTT 43,9 til 53,8
Fungal 18S V4 FW CCAGCASCYGCGGTAATTCC 58,7 til 61,5 431
RV ACTTTCGTTCTTGATYRA 43,2 til 48,3
Cucumis sativus PDS (LOC101204524) CsPDS F GTGAGTAAGGTTACCGTTTGGGGCTTATCCCAAT 63.8 750
CsPDS R GCGTGAGCTCGGTACTCTCATCCACTCTTGCAC 66.6

Tabell 2: Primere for forurensning Assessment.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

For å oppnå ren, høy molekylvekt genomisk DNA fra obligate biotrophic meldugg sopp, ble en modifisert versjon av tidligere beskrevne fremgangsmåter er utviklet 30. Den gjennomsnittlige utbytte ved anvendelse av denne protokollen er optimalisert 7 pg DNA pr 150 mg konidier, en dobling av det utbytte som oppnås med en tidligere protokoll. Dessuten økes den gjennomsnittlige størrelse fra ca. 20 kbp til over 48,5 kbp. Denne protokollen ble optimalisert i cucumber- G. cichoracearum system. For å oppnå den beste kvalitet og høy renhet DNA i annen meldugg eller obligate biotrophic sopp, kan ytterligere modifikasjon av denne protokollen være nødvendig. I fremtiden kan denne protokoll anvendes for å oppnå høy molekylvekt-DNA egnet for lang lese DNA-sekvensering fra andre obligate biotrophic sopp, skjønt ytterligere modifikasjon kan være nødvendig.

Balansering høy DNA-utbytte og med høy molekylvekt av ekstraherte DNA ble en bekymringunder optimalisering av denne protokollen. Trinn omfattende vortexblanding ble fjernet for å minimere klipping av DNA, og ble erstattet av forsiktig blanding ved inversjon. Denne endringen økt kvaliteten av det ekstraherte DNA uten i betydelig grad å redusere utbyttet. I tillegg, fjerning av stålkulene ved begynnelsen av cellelysetrinnet økes betydelig DNA-utbyttet i forhold til forlater kulene i oppløsningen inntil slutten av lyseringstrinnet.

Ingen G. cichoracearum koni forble intakt etter kulemaleprosedyren i trinn 1.3. For å oppnå gode utbytter av høy molekylvekt genomisk DNA, er det avgjørende at den fungale cellevegg er forstyrret i løpet av dette trinn. Konidiale integritet kan bli undersøkt i mikroskopet, og ytterligere kulemaling eller alternative metoder for avbrudd kan være nødvendig for andre sopparter.

Noen sopp sporer, spesielt Blumeria sp., Inneholder pigmenter som kan fortsaminere DNA ekstraksjon og rensing forsøk. I slike tilfeller anbefales det omfatter DNA som filtreringstrinnet som beskrevet i Bourras et al. (2015) -protokollen 19 og et ytterligere vasketrinn med TE etter filtreringstrinnet. Tilsetningen av filtreringstrinnet resulterte i en liten, men signifikant økning i DNA-degradering, og bør bare være inkludert hvis overdreven pigmentering gjenstår etter den andre DNA-utfellingstrinnet. Disse pigmentene, hvis det tillates å forbli i oppløsning, kan forstyrre senere analyse av kvaliteten og kvantiteten av DNA og kan potensielt forstyrre sekvenseringsreaksjoner.

Denne protokollen innbefatter både en tradisjonell agarosegelelektroforese trinn og en pulset felt gelelektroforese trinn. Den første er en første vurdering av fraksjonen av DNA som er> 20 kbp, og den fraksjon som går som et utstryk på <20 kbp. For det formål å nedstrøms sekvenseringsreaksjoner som er nødvendig for pulver mildugg genomer, fraksjonen av DNA <20 kbp bør være minimal (se figur 1, felt 2 versus spor 4). Den pulsfelt-gelelektroforese vurdering gir et bedre estimat av den størrelse som DNA> 20 kbp kan separeres etter størrelse. DNA fra> 48,5 kbp er ønskelige for anvendelse i påfølgende sekvenseringsreaksjoner (se figur 2, spor 4).

Den soppmateriale anvendt i disse eksperimentene ble dyrket i vekstkamrene og forurensning var begrenset ved bruk av strenge isolasjonsmetoder og personalkontroll. På grunn av dette, forurensning med andre, ikke-meldugg patogener var minimal, og sekvensering av sin region amplifisert ved anvendelse av sopp-spesifikke primere gjenvinnes bare G. cichoracearum sekvenser. Dette kan ikke være tilfelle for pulveraktig meldugg oppsamlet fra feltet nettsteder eller i drivhus mangler de samme isolasjons kontrollene, og forurensning vurdering i disse cases vil være avgjørende for montering av høykvalitets genomer fra det ekstraherte DNA.

Ingen modifikasjon av de forskjellige sopp DNA isoleringsmetoder var entydig viktig. Heller små modifikasjoner på mange trinn resulterte i de forholdsvis høye utbytter av høy molekylvekt meldugg DNA rapportert her.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
MM400 Ball Mill Retsch 20.745.0001 Or equivalent ball mill
2 mL tubes for ball milling Sarstedt  72.694.007
5/32" stainless steel milling balls OPS Diagnostics GBSS 165-5000-01
Microprocessor controlled 280 Series Water Bath Preset to 65 °C  Thermo Fisher Scientific 2825 Or equivalent water bath
Microprocessor controlled 280 Series Water Bath Preset to 37 °C Thermo Fisher Scientific 2825 Or equivalent water bath
Eppendorf 5417R refrigerated microcentrifuge Krakeler Scientific  38-022621807 Or equivalent microcentrifuge
Chlorform:IAA (24:1 v/v) Sigma-Aldrich  C0549 Hazardous in case of skin contact or inhalation. Wear nitrile gloves, protective eyewear, lab coat and work in chemical hood
Phenol:Chloroform:IAA
(25:24:1 v/v)
Thermo Fisher Scientific 15593031 Hazardous in case of skin contact or inhalation. Wear nitrile gloves, protective eyewear, lab coat and work in chemical hood
100% Isopropanol Sigma-Aldrich  W292907
100% Ethanol Sigma-Aldrich  34923 Chill to -20 °C prior use
Sodium Acetate Sigma-Aldrich  S2889
Rnase, Dnase-free (10 mg/mL) Thermo Fisher Scientific EN0531
Potassium metabisulfite Sigma-Aldrich  P2522
Sodium Lauryl Sacroinate Sigma-Aldrich  L9150
Tris base Sigma-Aldrich  10708976001
Ethylenediaminetetraacetic acid (EDTA) Sigma-Aldrich  EDS
Sodium chloride (NaCl) Sigma-Aldrich  S9888
Cetyltrimethyl ammonium bromide (CTAB) Sigma-Aldrich  H6269
Uvex by Honeywell Futura Goggles S345C, Uvextreme Staples 423263 Or equivalent eyewear
High Five COBALT nitrile gloves, LARGE Neta Scientific HFG-N193 Or equivalent gloves
GelRed Nucleic Acid Gel Stain 10,000x in water Biotium 41003
Ethidium Bromide 10 mg/mL Biotium 40042 Hazardous in case of skin contact. Wear nitrile gloves and protective eyewear
Agarose Ultrapure Bioreagent VWR International LLC JT4063
GeneRuler 1 kb Plus DNA Ladder Thermo Fisher Scientific FERSM1332
8 - 48 kb CHEF DNA size standards Bio-Rad 170-3707
Pippin Prep Life Technologies Corporation 4472172 Or equivalent pulse-field gel aparatus
Whatman qualitative filter paper, Grade 1 Sigma-Aldrich  WHA1001042 Or equivalent growth chamber
Percival Growth Chamber Percival AR66LXC9
NanoDrop 8000 UV-Vis Spectrophotometer Thermo Fisher Scientific ND-8000-GL Or equivalent spectrophotometer
Quant-iT PicoGreen dsDNA Assay Kit Thermo Fisher Scientific P11496
TAE Buffer (Tris-acetate-EDTA) (50x) Thermo Fisher Scientific B49 Dilute 1/50 with water before use (to 1x)
TE Buffer Thermo Fisher Scientific 12090015 
Tris-Borate-EDTA, 10x Solution (Electrophoresis) Thermo Fisher Scientific BP13334 Dilute 1/10 with water before use (to 1x)
Liquid Nitrogen Liquid nitrogen (-196 °C) is a freezing hazard. It will also expand rapidly upon warming and should not keep in a tightly closed container

DOWNLOAD MATERIALS LIST

References

  1. Agrios, G. N. Plant Pathology. 4th, Academic Press. (1969).
  2. Braun, U., Cook, R. T. Taxonomic manual of the Erysiphales (Powdery Mildews). CBS-KNAW Fungal Biodiversity Centre Utrecht. The Netherlands. (2012).
  3. Both, M., Csukai, M., Stumpf, M. P. H., Spanu, P. D. Gene expression profiles of Blumeria graminis indicate dynamic changes to primary metabolism during development of an obligate biotrophic pathogen. Plant Cell. 17, (7), 2107-2122 (2005).
  4. Glawe, D. A. The powdery mildews: A review of the world's most familiar (yet poorly known) plant pathogens. Annu Rev Phytopathol. 46, 27-51 (2008).
  5. Fabro, G., et al. Genome-wide expression profiling Arabidopsis at the stage of Golovinomyces cichoracearum haustorium formation. Plant Physiol. 146, (3), 1421-1439 (2008).
  6. Hückelhoven, R., Panstruga, R. Cell biology of the plant-powdery mildew interaction. Curr Opin Plant Biol. 14, (6), 738-746 (2011).
  7. Micali, C. O., Neumann, U., Grunewald, D., Panstruga, R., O'Connell, R. Biogenesis of a specialized plant-fungal interface during host cell internalization of Golovinomyces orontii haustoria. Cell Microbiol. 13, (2), 210-226 (2011).
  8. Chandran, D., Inada, N., Hather, G., Kleindt, C. K., Wildermuth, M. C. Laser microdissection of Arabidopsis cells at the powdery mildew infection site reveals site-specific processes and regulators. Proc Natl Acad Sci. 107, (1), 460-465 (2010).
  9. Spanu, P. D., Panstruga, R. Powdery mildew genomes in the crosshairs. New Phytol. 195, (1), 20-22 (2012).
  10. Vela-Corcía, D., Romero, D., Torés, J. A., De Vicente, A., Pérez-García, A. Transient transformation of Podosphaera xanthii by electroporation of conidia. BMC Microbiol. 15, (20), (2015).
  11. Hacquard, S. Advances in Botanical Research. Francis, M. M. 70, Academic Press. 109-142 (2014).
  12. Spanu, P. D., et al. Genome expansion and gene loss in powdery mildew fungi reveal tradeoffs in extreme parasitism. Science. 330, (6010), 1543-1546 (2010).
  13. Wicker, T., et al. The wheat powdery mildew genome shows the unique evolution of an obligate biotroph. Nat Genet. 45, (9), 1092 (2013).
  14. Jones, L., et al. Adaptive genomic structural variation in the grape powdery mildew pathogen, Erysiphe necator. BMC Genomics. 15, 1081 (2014).
  15. Thomma, B. P. H. J., et al. Mind the gap; seven reasons to close fragmented genome assemblies. Fungal Genet Biol. 90, 24-30 (2016).
  16. Parlange, F., et al. A major invasion of transposable elements accounts for the large size of the Blumeria graminis f.sp. tritici genome. Funct Integr Genomics. 11, 671-677 (2011).
  17. Faino, L., et al. Single-molecule real-time sequencing combined with optical mapping yields completely finished fungal genome. mBio. 6, (2015).
  18. Adam, L., et al. Comparison of Erysiphe cichoracearum and E. cruciferarum and a survey of 360 Arabidopsis thaliana accessions for resistance to these two powdery mildew pathogens. Mol Plant Microbe In. 12, (12), 1031-1043 (1999).
  19. Bourras, S., et al. Multiple avirulence loci and allele-specific effector recognition control the PM3 race-specific resistance of wheat to powdery mildew. Plant Cell. 27, (10), 2991-3012 (2015).
  20. Joint Genome Institute DNA sample submission guidelines. http://1ofdmq2n8tc36m6i46scovo2e.wpengine.netdna-cdn.com/wp-content/uploads/2016/04/DNA-Preparation-Requirements-1.pdf (2016).
  21. Chovatia, M., Sharma, A. Genomic DNA sample QC version 4.0. http://1ofdmq2n8tc36m6i46scovo2e.wpengine.netdna-cdn.com/wp-content/uploads/2013/11/Genomic-DNA-Sample-QC.pdf (2014).
  22. Daum, C. iTag sample amplification QC version 1.3. http://1ofdmq2n8tc36m6i46scovo2e.wpengine.netdna-cdn.com/wp-content/uploads/2016/04/iTag-Sample-Amplification-QC-v1.3.pdf (2016).
  23. Plant genotyping II: SNP technology. Henry, R. J. CABI. Oxfordshire, UK. (2008).
  24. Healey, A., Furtado, A., Cooper, T., Henry, R. J. Protocol: a simple method for extracting next-generation sequencing quality genomic DNA from recalcitrant plant species. Plant Methods. 10, (21), (2014).
  25. Fang, G., Hammar, S., Grumet, R. A quick and inexpensive method for removing polysaccharides from plant genomic DNA. Biotechniques. 13, (1), 52-54 (1992).
  26. Jordon-Thaden, I. E., Chanderbali, A. S., Gitzendanner, M. A., Soltis, D. E. Modified CTAB and TRIzol protocols improve RNA extraction from chemically complex Embryophyta. Appl Plant Sci. 3, (5), 1400105 (2015).
  27. Murray, M. G., Thompson, W. F. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res. 8, (19), 4321-4325 (1980).
  28. Greco, M., Sáez, C. A., Brown, M. T., Bitonti, M. B. A simple and effective method for high quality co-extraction of genomic DNA and total RNA from low biomass Ectocarpus siliculosus, the model brown alga. PLoS One. 9, (5), e96470 (2014).
  29. Wilson, I. W., Schiff, C. L., Hughes, D. E., Somerville, S. C. Quantitative trait loci analysis of powdery mildew disease resistance in the Arabidopsis thaliana accession Kashmir-1. Genetics. 158, (3), 1301-1309 (2001).
  30. User Manual: Pippin Pulse Electrophoresis Power Supply. Sage Science. http://www.sagescience.com/wp-content/uploads/2014/01/Pippin-Pulse-User-Manual-RevH.pdf (2008).
Rensing av High Molecular Weight Genomisk DNA fra meldugg for Long-Les Sekvense
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Feehan, J. M., Scheibel, K. E., Bourras, S., Underwood, W., Keller, B., Somerville, S. C. Purification of High Molecular Weight Genomic DNA from Powdery Mildew for Long-Read Sequencing. J. Vis. Exp. (121), e55463, doi:10.3791/55463 (2017).More

Feehan, J. M., Scheibel, K. E., Bourras, S., Underwood, W., Keller, B., Somerville, S. C. Purification of High Molecular Weight Genomic DNA from Powdery Mildew for Long-Read Sequencing. J. Vis. Exp. (121), e55463, doi:10.3791/55463 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter