Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Очистка ДНК с высоким молекулярным весом геномной от мучнистой росы для Long-Read Sequencing

doi: 10.3791/55463 Published: March 31, 2017
* These authors contributed equally

Abstract

Мучнистая роса грибы представляют собой группу экономически важных грибковых патогенов растений. Относительно мало известно о молекулярной биологии и генетике этих патогенов, отчасти из-за отсутствия хорошо развитых генетических и геномных ресурсов. Эти организмы имеют большие, повторяющиеся геном, которые сделали секвенирование генома и сборка запредельно трудно. Здесь мы описываем методы оценки сбора, экстракции, очистки и контроля качества с высокой молекулярной массой геномной ДНК от одного порошкообразных видов плесени, Golovinomyces cichoracearum. Протокол, описанный включает в себя механическое разрушение спор с последующей экстракции геномной ДНК оптимизировано фенол / хлороформ. Типичный выход составил 7 мкг ДНК на 150 мг конидий. Геномная ДНК, которая изолирована с помощью этой процедуры подходит для длительного чтения последовательности (то есть,> 48,5 т.п.н.). Качественные меры контроля, чтобы обеспечить размер, выход и чистоту геномной ДНК такжеописанный в этом методе. Секвенирование геномной ДНК качества, описанное здесь позволит для сборки и сравнения нескольких геномов мучнистой росы, что в своей очереди приведет к лучшему пониманию и улучшения контроля над этим сельскохозяйственным патогеном.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Мучнисторосяных представляют собой группу облигатных биотрофных грибковых патогены растений , которые, взятые вместе, являются основной причиной болезни растений во всем мире 1. Есть более 900 описанных видов мучнистой росы, которые таксономически сгруппированные в пять племен в семье Erisyphaceae 2. В связи как их экономическое значение, и интимные отношения они развиваются со своими хозяевами, мучнистая роса заболевания были предметом исследования для> 100 лет. После заражения, настоящая мучнистая роса вызывают резкие изменения в клеточной структуре, метаболизма и молекулярной биологии их хозяев, в пользу этого патогена. Тем не менее, изучение мучнисторосяных является особенно сложной задачей из - за их облигатным образ жизни, и рост гриба в чистой культуре до сих пор не было описано 3, 4, 5,"Xref"> 6, 7, 8. Надежная, стабильная генетическая трансформация мучнисторосяных также еще не была достигнута, хотя переходное преобразование было сообщено в некоторых видах 9, 10.

Последовательность и монтаж мучнистой росы геномов оказались трудными из-за ряд особенностей самого генома. Мучнистая роса геном крупный (120 - 180 МВРА) по отношению к другим грибковым геном, и состоят из 60 - 90% равномерно распределенных повторяющихся элементов 11. Эти элементы включают в себя не-длинные концевые повторы, а также неклассифицированные повторяющиеся элементы. Два formae speciales одного вида мучнистой росе, Blumeria graminis ф. зр. hordei и е. зр. tritici (BGH и Bgt, соответственно), а также мучнистая роса винограда Erysiphe Necator, у пчелп секвенирования и проект геномы для ряда других были завершены 12, 13, 14. Повторяющийся характер геномов сделал сборку трудным, и заполненный BGH геном был собран в 6,989 supercontigs с L50 2 Мб 12.

Несмотря на большое генома, то настоящая мучнистая роса , как представляется, небольшое количество белковых генов , кодирующих, с 5,845 и 6,540 генов предсказанных в BGH и БГТ, соответственно. Виртуализированное мучнистая роса также , кажется, не имеют , по крайней мере 99 основных генов, которые необходимы в других грибов, что согласуется с зависимостью грибов на их растения - хозяина для выживания 11, 12, 13, 14.

Повторяющиеся последовательности вблизи теломеры, центромеры, рибосомальной Р.Н.Ген , массивы и область , обогащенная мобильных элементы плохо собраны из коротких чтения стратегий секвенирования и часто недостаточно представлены в геноме сборках 15. Такие области , как полагает, ответственны за многие пробела , которые происходят в геномных последовательностях, и это относится к мучнисторосяным с их экстенсивным расширением повторяющихся элементов 16. Высококвалифицированный пластические участки генома часто встречается в таких повторяющихся областях 3. Они служат в качестве сайта хромосомных перестроек и часто кодируют гены под сильным селективным давлением, такие как гены, кодирующие эффекторные белки и гены, кодирующие ферменты вторичного метаболизма. Прогресс в одной молекуле давно прочитанных технологии секвенирования обеспечивает потенциальное решение для секвенирования через повторяющиеся области геномов 15. Например, Файно и др. (2015) обнаружил, что в том числе длинных последовательностей чтения технологии и оптический мapping позволили им производить последовательность генома разрыва менее двух штаммов грибковых растений патогенов Verticillium георгина, утроение доли повторяющихся последовательностей ДНК в геноме, увеличивая количество генных аннотаций (и сокращение числа частичного или отсутствуют ген аннотации ) и выявление перестроек генома 17.

Для того, чтобы использовать эти длинные читаемые технологии секвенирования, высокие концентрации высокого качества геномной ДНК, с минимальными размерами> 20 т.п.н., необходимо. Здесь мы опишем наши методы конидий сбора, очистки ДНК высокой молекулярной массы от конидий и наши оценки контроля качества с использованием мучнистой росы видов Golovinomyces cichoracearum , выращенные на огурце 18. Этот протокол основан на протоколе , разработанном в лаборатории группы В. Келлера (Университет Цюриха, Цюрих Швейцария) 13, 19и включает в себя несколько модификаций, которые привели к повышению урожайности ДНК и более высокую долю ДНК> 48,5 т.п.н. в размере. Протокол также включает в себя этапы контроля качества на основе рекомендаций департамента Соединенных Штатов энергетики Объединенного института генома 20, 21, 22.

Функция каждого реагента , включенный в буфере для лизиса, и обоснования для каждой стадии очистки, такой , как описана в Генри (2008) 23. Доступные опубликованные протоколы для изоляции с высокой молекулярной массой геномной ДНК из растений и микроорганизмов , тканей были также проведены консультации в ходе разработки этого протокола 24, 25, 26, 27, 28.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Приготовление грибного вещества,

  1. Рост к мучнистой росе
    1. Grow растений в ростовых камерах при следующих условиях: 22 ° C день температура, температуру 20 ° С ночью, 80% относительной влажности, 14-ч длина дня и интенсивность света 125 мкЕ / м 2 / с ( при условии , флуоресцентным освещением ).
    2. Infect растения огурца (Cucumis Sativa сорт Champion Буш) с штамма Golovinomyces cichoracearum UCSC1 , как описано 18, 29.
  2. Заготовка мучнистая роса Конидии
    1. Урожай конидия из зараженных растений в течение 7 - 10 дней после инокуляции с использованием небольшого вакуума с фильтром в линии (11 мкм), на котором конидия аккумулировать. Применяя мягкое давление, запустить вакуумную насадку по поверхности листа для сбора конидии.
      Примечание: Средняя урожайность Г. cichoracearum составляет 20 мг конидий из сильно инфаКТИД лист огурца примерно 130 см 2 в области.
    2. Кисть около 150 мг конидий (приблизительно 375 мкл объема, или конидии из 7-8 инфицированных огуречных листьев) из фильтра на лист чистой бумаги. Отсюда, передавать конидии в 2 мл криопробирки с двумя 5/32-дюймового диаметра, предварительно охлажденного (в жидком азоте) стальных мелющих шаров. Немедленно вернуть трубки в жидкий азот. Хранить пробирки при -80 ° С.
  3. Разламывают Конидии в шаровой мельнице
    1. Флэш заморозить алюминиевые пластины шаровой мельницы в жидком азоте. Нагрузка криопробирки в шаровой мельнице стойку. Энергично встряхнуть криопробирки с конидиями и стальными шарами в шаровой мельнице в течение 30 с при 30 циклах / с (при комнатной температуре). Немедленно замораживать криопробирки в жидком азоте.
      Примечание: Первоначально доступ образца конидий с помощью микроскопа при 100-кратном увеличении эффективности для разрыва клеточных стенок в процессе измельчения. Если необходимо, измельчить в течение дополнительных 1 - 2 раундов 30 с в течение 30 циклов / с, бешь сохранить количество раундов до минимума. Обычная оценка конидиальной поломки микроскопии на данном этапе не требуется, как только было созданы оптимальные условия.

2. геномной ДНК Очистка

  1. Конидии лизиса
    1. Работая быстро, чтобы избежать размораживания конидии, удалите стальные шарики из криопробирок с магнитом. Добавьте 700 мкл 65 ° C буфер для лизиса (Таблица 1) и вихрь 5 - 10 сек , пока суспензия не образуется.
    2. Добавьте 300 мкл предварительно нагретую (65 ° С) 5% (об / об) саркозил и осторожно перемешать инвертировать (1 инверсию за 3 секунды) пять раз. Инкубируйте пробирки в течение 30 мин при 65 ° С; инвертировать аккуратно 3 раза по 10, 20 и 30 мин. Использование широкого отверстия пипетки, передавать весь раствор к новым 2 мл микроцентрифужных трубки. На всех последующих этапах, перемешать, осторожно, медленно инверсию и перенос ДНК-содержащие растворы с широким отверстием наконечников пипеток.
  2. Экстракции ДНК I
    1. Добавить 1 объем хлораФорма: изоамиловый спирт (24: 1 об / об) к раствору для лизиса и осторожно инвертировать смешать пять раз. Инкубирую в течение 10 мин при комнатной температуре, осторожно переворачивая, чтобы смешать пять раз на полпути и снова в конце инкубации. Центрифуга при комнатной температуре в течение 15 мин при 14000 х г. Использование широкого отверстия пипетки, осторожно переносить водный слой к новым 2 мл микроцентрифужных трубки; избегать включения материала из интерфейса.
  3. ДНК Осаждение I
    1. Добавить 1 объем комнатной температуры 100% изопропанола (примерно 750 мкл) и аккуратно инвертировать смешать шесть раз. Центрифуга при комнатной температуре в течение 15 мин при 14000 х г. Осторожно удалите супернатант и выбросьте.
    2. Добавить 450 мкл предварительно охлажденной (-20 ° С) 70% этанола. Центрифуга в течение 5 мин при комнатной температуре при 14000 х г. Осторожно удалите супернатант и выбросьте. Центрифуга при 1000 мкг в течение 3 секунд, осторожно удалить супернатант с тонким наконечником пипетки и выбросить. Высушите гранулы в течение 15 мин добавлт при комнатной температуре. Не сушить дольше, чем 15 мин.
    3. Ресуспендируют осадок в 300 мкл ТЕ (10 мМ Трис-Cl, 1 мМ этилендиамин-тетра-уксусной кислоты, рН 8,0). Инкубируют в течение ночи при 4 ° С. Аккуратно вылить ресуспендирование остаточного материала, который не пошел в раствор.
  4. Для того, чтобы удалить загрязнения РНК, добавляют 10 мкл РНКазы А (10 мг / мл). Аккуратно инвертировать смешать три раза. Центрифуга при 1000 мкг в течение 3 сек. Инкубируют при 37 ° С в течение 2 ч.
  5. Экстракции ДНК II,
    1. Добавьте 300 мкл фенол: хлороформ: изоамиловый спирт (25: 24: 1 об / об) и осторожно инвертировать смешать пять раз. Инкубировать 10 мин при комнатной температуре, осторожно переворачивая, чтобы смешать пять раз на полпути и снова в конце инкубации. Центрифуга 15 мин при комнатной температуре при 14000 х г. Использование широкого отверстия пипетки, передача супернатантов в новую 1,5 мл микроцентрифужных трубки.
  6. ДНК Осадки II,
    1. Добавьте 0,01 объема 3 М ацетата натрия, рН 5,2 (approximatelу 3 мкл), осторожно инвертировать смешать пять раз. Добавьте 2,5 объема предварительно охлажденный (-20 ° C) 100% этанола (приблизительно 750 мкл). Аккуратно инвертировать смешать пять раз. Инкубируют в течение ночи при -20 ° С
    2. Центрифуга 30 мин при 4 ° С при 14000 х г. Осторожно удалите супернатант и выбросьте.
    3. Добавить 450 мкл предварительно охлажденной (-20 ° С) 70% этанола. Центрифуга в течение 5 мин при 4 ° С при 14000 х г. Осторожно удалите супернатант и выбросьте. Центрифуга при 1000 мкг в течение 3 сек. Осторожно удалите супернатант с тонким наконечником пипетки и выбросить.
    4. Высушите гранулы в течение 30-60 мин при комнатной температуре. Ресуспендируют осадок в 27,5 мкл ТЕ. Инкубируют в течение ночи при 4 ° С. Аккуратно вылить ресуспендирование остаточного материала, который не пошел в раствор.
    5. Аликвоты 2,5 мкл в 22,5 мкл ТЕ (конечный объем 25 мкл) в течение испытаний контроля качества (смотри ниже). Хранить образцы ДНК при 4 ° С до подачи для секвенирования. Для хранения долгосрочных, хранения образцовпри -80 ° C и свести к минимуму циклов замораживания-оттаивания, чтобы предотвратить срезание.
      Примечание: Будьте осторожны при пипетке на этом этапе, как с высокой молекулярной массой геномной ДНК может быть трудно пипетка должным образом, и это очень важно для того, чтобы «QC Алигота» является точным представлением геномной ДНК образца.

3. Контроль качества

  1. образец чистоты
    1. Используя ТЕ пустым, оценить чистоту образца ДНК путем загрузки 1 мкл QC Алиготе на малой громкости спектрофотометра. Запись A260 / A280 и A260 / A230 чтения. Чистый ДНК будет иметь соотношение А260 / А280 в соотношении примерно 1,8 и А260 / A230 между 1,8 и 2,2.
  2. Количественное геномной ДНК
    1. Выполнение количественной оценки аликвоты QC с использованием коммерческого набора для анализа двухцепочечной ДНК количественного в соответствии с инструкциями производителя.
  3. ДНК Качество I Оценка
    1. Нагрузка приблизительно 60 нг геномной ДНК иДНК лестницы на агарозном геле 0,7% в 1x TAE (40 мМ Трис, 20 мМ уксусной кислоты и 1 мМ ЭДТА, рН 8,0). Запуск аппарат геля при 70 В в течение 40 - 45 мин до геномных ДНК полос приблизительно 2 см от скважины и зоны разделения в лестницах очевидно. Эти условия могут должны быть скорректированы на основе имеющихся гель-электрофореза аппарата.
  4. ДНК оценки качества II
    1. Нагрузка приблизительно 60 нг геномной ДНК и высокой лестнице молекулярной массы ДНК (подходит для электрофореза в пульсирующем поле гель) на агарозном геле 1% в 0,5х TBE (44,5 мМ Трис, 44.5 мМ борной кислоты, 1 мМ ЭДТА, рН 8,3) и работать в 0.5x TBE буфере работает с использованием 5 - импульсного поля протокола гель-электрофореза 80 т.п.н. сигнала в течение 16 ч.
  5. Оценка бактериальные, грибковые и загрязняющим примесям растений
    1. Выполните полимеразной цепной реакции (ПЦР), чтобы усилить соответствующие внутренние транскрибируется распорки (ИТС) области рибосомных генов с использованием праймеров и условий амплификации спискаред в таблице 2. Нагрузка 10 мкл полученной реакции на геле.
      ПРИМЕЧАНИЕ: группа, представляющая мучнистой росой ITS область должна быть усиленную с грибной ИТС праймеры. ДНК из этого ампликона и любого ампликона, генерируемый с бактериальными, или праймерами растений должны быть секвенированы с целью определить происхождение загрязнения. Только мучнистая роса ИТС последовательность должна быть найдена в грибковой ампликоне.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Характерным примером 60ng очищенной геномной ДНК из G. cichoracearum на агарозном геле с помощью гель - электрофореза и с помощью электрофореза в пульсирующем поле гель показаны на фигурах 1 и 2, соответственно. Геномные препараты ДНК, которые проходят, незначительно прошедшие и не контроль качества представлены. Геномные ДНК препараты, которые полностью проходят контроль качества идеально подходят для секвенирования с использованием дальнего чтения генома секвенирования подходы. Препараты, которые незначительно проходят контроль качества являются приемлемыми, но препараты, которые полностью проходят, являются предпочтительными. Препараты, которые не контроль качества не являются приемлемыми для секвенирования генома подходов давно прочитанных.

Рисунок 1
Рисунок 1: Электрофорез в агарозном геле очищенной геномной ДНК. Дорожка 1: Дорожка 2: геномная ДНК , которые прошли контроль качества; Дорожка 3: геномная ДНК , который был рассмотрен маргинальным; и Lane 4: геномная ДНК , которая не удалась контроль качества. Приемлемые и маргинальные образцов геномной ДНК имеют одну полосу работает выше 20 т.п.н. с минимальным размытием в <20 т.п.н.. Геномные ДНК-образцы, которые не имеют контроля качества размазывание ниже 20 т.п.н., и могут включать в себя низкие фрагменты молекулярной массы приблизительно 100 пар оснований (*). Электрофорез в пульсирующем поле геля требуется провести различие между приемлемыми и маргинальными образцами ДНК. Этидий бромид был добавлен в гель до электрофореза для визуализации геномной ДНК. Образцы подвергали электрофорезу при 60 В в течение 50 мин. Гель изображается под действием УФ-света с использованием системы гель-документации.

фигура 2
фигура2: импульсно-полевой гель электрофорез (PFGE) очищенного мучнистой росе геномной ДНК. Дорожка 1: стандарты молекулярной массы, с самой высокой полосой на 48,5 т.п.н. , а самый низкий в 8,1 т.п.н.. Дорожки 2 и 5: стандарты молекулярной массы , показывающие полосы 20, 10, 7, 5, 4, 3, 2 и 1,5 т.п.н. (в нижней части изображения геля). Дорожка 3: маргинальный образец ДНК, с большинством ДНК между 20 и 48,5 т.п.н. в размере. Дорожка 4: приемлемый образец ДНК, причем большинство ДНК> 48,5 т.п.н. (*). Образцы пропускают при 75 V в течение 15 ч с использованием программы PFGE сигнала 5-80 т.п.н.. ДНК-окрашивания краситель был добавлен в геле после электрофореза и гель изображается под действием УФ-света с использованием системы гель-документации.

реактив Конечная концентрация
Калий Metabisulfite (K 2 S 2 O 5) 0,25 М
Трис-буфер, рН 7,5 0,2 М
Этилендиаминтетрауксусной кислоты (ЭДТА) 50 мМ
хлорид натрия (NaCl) 2 M
Cetyltrimethyl бромид (СТАВ) 2% об / об

Таблица 1: Получение буфера для лизиса. Довести до объема 5 мл с дН 2 O.

цель Грунтовка Имя Праймер Последовательность Тт (° С) Ожидаемый размер продукта (п.н.)
Грибковые ITS2 FW (ITS9) GAACGCAGCRAAIIGYGA 56-61.3 336
RV (ITS4) TCCTCCGCTTATTGATATGC 52,1
Бактериальная 16S В4 FW (515F) GTGCCAGCMGCCGCGGTAA 63.8-66.5 331
RV (805R) GGACTACHVGGGTWTCTAAT 46.9-53.8
Бактериальный 16S В4-В5 FW (515F-Y), GTGYCAGCMGCCGCGGTAA 60.8-66.5 450
RV (926R) CCGYCAATTYMTTTRAGTTT 43.9-53.8
Грибковые 18S В4 FW CCAGCASCYGCGGTAATTCC 58.7-61.5 431
Р.В. ACTTTCGTTCTTGATYRA 43.2-48.3
Cucumis Sativus PDS (LOC101204524) CsPDS F GTGAGTAAGGTTACCGTTTGGGGCTTATCCCAAT 63,8 750
CsPDS R GCGTGAGCTCGGTACTCTCATCCACTCTTGCAC 66,6

Таблица 2: Грунтовки для оценки загрязнения.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Для того чтобы получить чистую, высокую молекулярную массу геномной ДНК из облигатных биотрофных грибов мучнистой росы, модифицированная версия ранее описанные методов была разработана 30. Средний выход, используя этот оптимизированный протокол составляет 7 мкг ДНК на 150 мг конидий, удвоение выхода, полученный с предшествующим протоколом. Кроме того, средний размер увеличился с приблизительно 20 т.п.н. до более чем 48,5 т.п.н.. Этот протокол был оптимизирован в cucumber- системы cichoracearum Г.. Для того, чтобы получить лучшее качество и самую высокую чистоту ДНК в другой мучнистой росе или обязать биотрофных грибы, может потребоваться дополнительная модификация этого протокола. В дальнейшем, этот протокол может быть использован для получения высокой ДНК, молекулярная массы подходит для длительного чтения секвенирования ДНК из других облигатных биотрофных грибов, хотя дальнейшая модификация может потребоваться.

Балансировка высокий выход ДНК и высокой молекулярной массы добываемого ДНК вызывает озабоченностьв процессе оптимизации этого протокола. Шаги в том числе встряхивания были устранены, с тем чтобы свести к минимуму срезания ДНК, и были заменены осторожным перемешивание с помощью инверсии. Это изменение увеличило качество экстрагированной ДНК без существенного снижения выхода. Кроме того, удаление стальных шаров в начале стадий лизиса клеток значительно увеличился выход ДНК по сравнению с оставив шарики в растворе до конца стадии лизиса.

Нет Г. cichoracearum конидия не осталась нетронутой после процедуры в шаровой мельнице на стадии 1.3. Для получения хороших урожаев с высокой молекулярной массой геномной ДНК, очень важно, что грибковая клеточная стенка разрушается во время этого шага. Конидий целостность может быть оценена микроскопически, а также дополнительные измельчение в шаровой мельнице или альтернативные методы нарушения может потребоваться для других видов грибов.

Некоторые грибковые конидии, в частности Blumeria зр., Содержат пигменты , которые могут CONTaminate экстракции и очистки ДНК попытки. В этих случаях, мы рекомендуем , включающий стадию фильтрации ДНК , как указано в Bourras и соавт. (2015) протокол 19 и дополнительный этап стирки с TE после стадии фильтрации. Добавление стадии фильтрации привело к небольшому, но значительному увеличению деградации ДНК, и должны быть включены только в том случае чрезмерной пигментации остается после второй стадии осаждения ДНК. Эти пигменты, если это разрешено, чтобы оставаться в растворе, могут мешать последующим анализ качества и количество ДНК и потенциально могут мешать секвенирование реакций.

Этот протокол включает в себя как традиционный агарозном шаг гель-электрофореза и стадию гель-электрофореза в пульсирующем поле. Во-первых, первоначальная оценка доли ДНК, которая является> 20 т.п.н., и фракцию, которая работает как мазок на <20 т.п.н.. Для целей ниже по течению реакции секвенирования, требуемых для мучнистой милросы геном, фракция ДНК <20 т.п.н. должны быть минимальными (см рисунка 1, дорожка 2 по сравнению полосы 4). Оценка гель-электрофорез в пульсирующем поле обеспечивает более точную оценку размера, как ДНК> 20 т.п.н. может быть отделен от размера. ДНК> 48,5 т.п.н. желателен для использования в последующих реакциях секвенирования (рисунок 2, дорожка 4).

Грибковый материал, используемый в этих экспериментах, размножали в камерах роста и загрязнение было ограниченно использованием строгих протоколов изоляции и контроля персонала. Из - за этого, загрязнение с другими, не-мучнистой росой патогенами было минимальным, и секвенирование ИТСА области амплифицировало с использованием грибов-специфических праймеры выделяют только cichoracearum последовательность G.. Это не может быть в случае мучнисторосяных собранных из полевых участков или теплиц, не имеющих одни и те же элементы управления изоляции, и оценка загрязнения в этих КАСES будет иметь решающее значение для сборки высококачественных геномов из экстрагированной ДНК.

Не одна модификации различных протоколов изоляции грибковых ДНК была единственным важной. Скорее незначительные изменения на многих шагах, в результате относительно высоких урожаев высокой ДНК росы молекулярной массы мучнистой сообщили здесь.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
MM400 Ball Mill Retsch 20.745.0001 Or equivalent ball mill
2 mL tubes for ball milling Sarstedt  72.694.007
5/32" stainless steel milling balls OPS Diagnostics GBSS 165-5000-01
Microprocessor controlled 280 Series Water Bath Preset to 65 °C  Thermo Fisher Scientific 2825 Or equivalent water bath
Microprocessor controlled 280 Series Water Bath Preset to 37 °C Thermo Fisher Scientific 2825 Or equivalent water bath
Eppendorf 5417R refrigerated microcentrifuge Krakeler Scientific  38-022621807 Or equivalent microcentrifuge
Chlorform:IAA (24:1 v/v) Sigma-Aldrich  C0549 Hazardous in case of skin contact or inhalation. Wear nitrile gloves, protective eyewear, lab coat and work in chemical hood
Phenol:Chloroform:IAA
(25:24:1 v/v)
Thermo Fisher Scientific 15593031 Hazardous in case of skin contact or inhalation. Wear nitrile gloves, protective eyewear, lab coat and work in chemical hood
100% Isopropanol Sigma-Aldrich  W292907
100% Ethanol Sigma-Aldrich  34923 Chill to -20 °C prior use
Sodium Acetate Sigma-Aldrich  S2889
Rnase, Dnase-free (10 mg/mL) Thermo Fisher Scientific EN0531
Potassium metabisulfite Sigma-Aldrich  P2522
Sodium Lauryl Sacroinate Sigma-Aldrich  L9150
Tris base Sigma-Aldrich  10708976001
Ethylenediaminetetraacetic acid (EDTA) Sigma-Aldrich  EDS
Sodium chloride (NaCl) Sigma-Aldrich  S9888
Cetyltrimethyl ammonium bromide (CTAB) Sigma-Aldrich  H6269
Uvex by Honeywell Futura Goggles S345C, Uvextreme Staples 423263 Or equivalent eyewear
High Five COBALT nitrile gloves, LARGE Neta Scientific HFG-N193 Or equivalent gloves
GelRed Nucleic Acid Gel Stain 10,000x in water Biotium 41003
Ethidium Bromide 10 mg/mL Biotium 40042 Hazardous in case of skin contact. Wear nitrile gloves and protective eyewear
Agarose Ultrapure Bioreagent VWR International LLC JT4063
GeneRuler 1 kb Plus DNA Ladder Thermo Fisher Scientific FERSM1332
8 - 48 kb CHEF DNA size standards Bio-Rad 170-3707
Pippin Prep Life Technologies Corporation 4472172 Or equivalent pulse-field gel aparatus
Whatman qualitative filter paper, Grade 1 Sigma-Aldrich  WHA1001042 Or equivalent growth chamber
Percival Growth Chamber Percival AR66LXC9
NanoDrop 8000 UV-Vis Spectrophotometer Thermo Fisher Scientific ND-8000-GL Or equivalent spectrophotometer
Quant-iT PicoGreen dsDNA Assay Kit Thermo Fisher Scientific P11496
TAE Buffer (Tris-acetate-EDTA) (50x) Thermo Fisher Scientific B49 Dilute 1/50 with water before use (to 1x)
TE Buffer Thermo Fisher Scientific 12090015 
Tris-Borate-EDTA, 10x Solution (Electrophoresis) Thermo Fisher Scientific BP13334 Dilute 1/10 with water before use (to 1x)
Liquid Nitrogen Liquid nitrogen (-196 °C) is a freezing hazard. It will also expand rapidly upon warming and should not keep in a tightly closed container

DOWNLOAD MATERIALS LIST

References

  1. Agrios, G. N. Plant Pathology. 4th, Academic Press. (1969).
  2. Braun, U., Cook, R. T. Taxonomic manual of the Erysiphales (Powdery Mildews). CBS-KNAW Fungal Biodiversity Centre Utrecht. The Netherlands. (2012).
  3. Both, M., Csukai, M., Stumpf, M. P. H., Spanu, P. D. Gene expression profiles of Blumeria graminis indicate dynamic changes to primary metabolism during development of an obligate biotrophic pathogen. Plant Cell. 17, (7), 2107-2122 (2005).
  4. Glawe, D. A. The powdery mildews: A review of the world's most familiar (yet poorly known) plant pathogens. Annu Rev Phytopathol. 46, 27-51 (2008).
  5. Fabro, G., et al. Genome-wide expression profiling Arabidopsis at the stage of Golovinomyces cichoracearum haustorium formation. Plant Physiol. 146, (3), 1421-1439 (2008).
  6. Hückelhoven, R., Panstruga, R. Cell biology of the plant-powdery mildew interaction. Curr Opin Plant Biol. 14, (6), 738-746 (2011).
  7. Micali, C. O., Neumann, U., Grunewald, D., Panstruga, R., O'Connell, R. Biogenesis of a specialized plant-fungal interface during host cell internalization of Golovinomyces orontii haustoria. Cell Microbiol. 13, (2), 210-226 (2011).
  8. Chandran, D., Inada, N., Hather, G., Kleindt, C. K., Wildermuth, M. C. Laser microdissection of Arabidopsis cells at the powdery mildew infection site reveals site-specific processes and regulators. Proc Natl Acad Sci. 107, (1), 460-465 (2010).
  9. Spanu, P. D., Panstruga, R. Powdery mildew genomes in the crosshairs. New Phytol. 195, (1), 20-22 (2012).
  10. Vela-Corcía, D., Romero, D., Torés, J. A., De Vicente, A., Pérez-García, A. Transient transformation of Podosphaera xanthii by electroporation of conidia. BMC Microbiol. 15, (20), (2015).
  11. Hacquard, S. Advances in Botanical Research. Francis, M. M. 70, Academic Press. 109-142 (2014).
  12. Spanu, P. D., et al. Genome expansion and gene loss in powdery mildew fungi reveal tradeoffs in extreme parasitism. Science. 330, (6010), 1543-1546 (2010).
  13. Wicker, T., et al. The wheat powdery mildew genome shows the unique evolution of an obligate biotroph. Nat Genet. 45, (9), 1092 (2013).
  14. Jones, L., et al. Adaptive genomic structural variation in the grape powdery mildew pathogen, Erysiphe necator. BMC Genomics. 15, 1081 (2014).
  15. Thomma, B. P. H. J., et al. Mind the gap; seven reasons to close fragmented genome assemblies. Fungal Genet Biol. 90, 24-30 (2016).
  16. Parlange, F., et al. A major invasion of transposable elements accounts for the large size of the Blumeria graminis f.sp. tritici genome. Funct Integr Genomics. 11, 671-677 (2011).
  17. Faino, L., et al. Single-molecule real-time sequencing combined with optical mapping yields completely finished fungal genome. mBio. 6, (2015).
  18. Adam, L., et al. Comparison of Erysiphe cichoracearum and E. cruciferarum and a survey of 360 Arabidopsis thaliana accessions for resistance to these two powdery mildew pathogens. Mol Plant Microbe In. 12, (12), 1031-1043 (1999).
  19. Bourras, S., et al. Multiple avirulence loci and allele-specific effector recognition control the PM3 race-specific resistance of wheat to powdery mildew. Plant Cell. 27, (10), 2991-3012 (2015).
  20. Joint Genome Institute DNA sample submission guidelines. http://1ofdmq2n8tc36m6i46scovo2e.wpengine.netdna-cdn.com/wp-content/uploads/2016/04/DNA-Preparation-Requirements-1.pdf (2016).
  21. Chovatia, M., Sharma, A. Genomic DNA sample QC version 4.0. http://1ofdmq2n8tc36m6i46scovo2e.wpengine.netdna-cdn.com/wp-content/uploads/2013/11/Genomic-DNA-Sample-QC.pdf (2014).
  22. Daum, C. iTag sample amplification QC version 1.3. http://1ofdmq2n8tc36m6i46scovo2e.wpengine.netdna-cdn.com/wp-content/uploads/2016/04/iTag-Sample-Amplification-QC-v1.3.pdf (2016).
  23. Plant genotyping II: SNP technology. Henry, R. J. CABI. Oxfordshire, UK. (2008).
  24. Healey, A., Furtado, A., Cooper, T., Henry, R. J. Protocol: a simple method for extracting next-generation sequencing quality genomic DNA from recalcitrant plant species. Plant Methods. 10, (21), (2014).
  25. Fang, G., Hammar, S., Grumet, R. A quick and inexpensive method for removing polysaccharides from plant genomic DNA. Biotechniques. 13, (1), 52-54 (1992).
  26. Jordon-Thaden, I. E., Chanderbali, A. S., Gitzendanner, M. A., Soltis, D. E. Modified CTAB and TRIzol protocols improve RNA extraction from chemically complex Embryophyta. Appl Plant Sci. 3, (5), 1400105 (2015).
  27. Murray, M. G., Thompson, W. F. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res. 8, (19), 4321-4325 (1980).
  28. Greco, M., Sáez, C. A., Brown, M. T., Bitonti, M. B. A simple and effective method for high quality co-extraction of genomic DNA and total RNA from low biomass Ectocarpus siliculosus, the model brown alga. PLoS One. 9, (5), e96470 (2014).
  29. Wilson, I. W., Schiff, C. L., Hughes, D. E., Somerville, S. C. Quantitative trait loci analysis of powdery mildew disease resistance in the Arabidopsis thaliana accession Kashmir-1. Genetics. 158, (3), 1301-1309 (2001).
  30. User Manual: Pippin Pulse Electrophoresis Power Supply. Sage Science. http://www.sagescience.com/wp-content/uploads/2014/01/Pippin-Pulse-User-Manual-RevH.pdf (2008).
Очистка ДНК с высоким молекулярным весом геномной от мучнистой росы для Long-Read Sequencing
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Feehan, J. M., Scheibel, K. E., Bourras, S., Underwood, W., Keller, B., Somerville, S. C. Purification of High Molecular Weight Genomic DNA from Powdery Mildew for Long-Read Sequencing. J. Vis. Exp. (121), e55463, doi:10.3791/55463 (2017).More

Feehan, J. M., Scheibel, K. E., Bourras, S., Underwood, W., Keller, B., Somerville, S. C. Purification of High Molecular Weight Genomic DNA from Powdery Mildew for Long-Read Sequencing. J. Vis. Exp. (121), e55463, doi:10.3791/55463 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter