Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Genetics

Atomic Force Microscopy Undersökningar av DNA-lesionsigenkänning i Nucleotide Excision Repair

doi: 10.3791/55501 Published: May 24, 2017
* These authors contributed equally

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Atomkraftsmikroskopi (AFM) är en kraftfull teknik för analys av protein-DNA-interaktionerna 1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 . Det kräver endast låga mängder provmaterial för att direkt visualisera heterogena prover med en upplösning på den enda molekylnivån. Heterogenitet kan härledas från olika konformationella eller oligomera tillstånd i ett protein. I synnerhet kan proteinkomplex i samband med protein-DNA-prover visa olika stökiometrier och / eller konformationer inducerade genom DNA-bindning i allmänhet eller bindande till en specifik målplats inom DNA. Heterogena prover kan också innehålla två (eller flera) olika typer av proteiner och olika proteinkomplexFormer ( t.ex. bestående av endast en typ av protein kontra heteromera komplex) kan interagera annorlunda med DNA. De studier som diskuteras här utnyttjar AFM-avbildning i luft på statiska, torkade prover av DNA-reparationsproteiner bundna till långa (~ 900 baspar, bp) DNA-fragment som innehåller en lesion, vilket representerar ett mål för dessa proteiner. Den höga molekylära upplösningen av AFM möjliggör distinktionen mellan olika typer av proteinkomplex och att bestämma bindningspositionerna för proteinerna på DNA-fragmenten. Viktigt är att lesionerna införs i DNA-substraten vid väldefinierade positioner. Eftersom läget för lesionsstället i DNA är känt, ger distributionerna av proteiner bundna på DNA inblick i (olika) lesionsigenkänningsegenskaper hos (olika) proteinkomplexen, t.ex. hur väl de känner igen en viss typ av lesion (jämfört med Till icke-skadat DNA) 2 , 3 , , 5 , 6 . Deras positioner på DNA möjliggör också skillnaden mellan proteinkomplex bundna specifikt vid lesionerna och komplexen som är bundna ospecifikt på annat håll på DNA. Separat karakterisering av dessa olika komplexa typer (komplex bundna specifikt vid lesionen mot icke-specifika komplex) kan avslöja potentiella konformationsförändringar i de komplex som induceras vid identifiering av målplatsen.

DNA-reparationsproteinerna som är inriktade på här är helikaser som är ansvariga för lesionsigenkänning i nukleotidutjämningsreparationen (NER) -vägen. I bakterier uppnås NER genom proteinerna UvrA, UvrB och UvrC. UvrA är ansvarig för initial lesionsavkänning i ett UvaA 2 / UvrB 2 DNA-scanningskomplex. Vid lesionsverifiering av UvrB omvandlas detta komplex till monomeriskt UvrB bunden vid lesionsstället och detta specifika komplex kan sedan rekrytera pRokaryot NER-endonukleas UvrC. UvrC excises en kort (12-13 nt) sträckning av enkelsträngad DNA (ssDNA) innehållande lesionen. Den saknade sträckan fylles sedan av DNA-polymeras. Slutligen förseglar DNA-ligas den nyligen syntetiserade sträckan med det ursprungliga DNA 9 , 10 . I eukaryoter ingår de flesta proteinerna i NER-kaskaden i det stora multimeriska transkriptionsfaktorn IIH (TFIIH) -komplexet. Efter inledande lesionsavkänning via det trimera CEN2-XPC-HR23B-komplexet rekryteras TFIIH till DNA-målplatsen. När XPD inom komplexet verifierar närvaron av en NER-målskada, rekryteras de eukaryota NER-endonukleaserna XPG och XPF för att excisera en kort (24-32 nt) sträckning av ssDNA som innehåller lesionen 9 , 10 . Här studerades specifikt helikaserna UvrB och XPD från respektive prokaryotiska och eukaryota NER. Dessa helikaser kräver en oparad region iDNA (en DNA-bubbla) för att gänga på en av de två DNA-enskilda strängarna och därefter translokera längs denna sträng som drivs genom ATP-hydrolys. Förutom DNA-lesionerna infördes en DNA-bubbla i substraten som fungerar som laddningsställe för proteinerna.

Förfarandet för framställning av specifika lesions-DNA-substrat har beskrivits tidigare 11 . Det kräver en cirkulär DNA-konstruktion (plasmid) med två nära åtskilda restriktionsställen för en nickas. I samband med denna studie användes plasmiden pUC19N (2729 bp) (skapad av S. Wilsons laboratorium, NIEHS). Denna plasmid innehåller tre nära åtskilda restriktionsställen för nickas Nt.BstNBI som ramar en 48 nukleotid (nt) sträckning. Efter inkubering med nickaset kan sträckan av ssDNA mellan dessa ställen avlägsnas och ersättas med en oligonukleotid innehållande vilken som helst målsärdrag. Efter varje steg testas fullständig enzymatisk digestion via agarosgelelektrofores. Nicked-cirkulärt DNA kan särskiljas på grund av dess lägre elektroforetiska rörlighet jämfört med den ursprungliga supercoilerade plasmiden. Gappning av DNA: n och ersättning av den avlägsna sträckningen med den specifika substratoligonukleotiden kan utvärderas via digestion med ett restriktionsenzym som inciserar substratet uteslutande inom området mellan nicks. Linearisering av den cirkulära plasmiden av enzymet kommer således att undertryckas för det gapped-DNA och återställes efter införandet av den specifika oligonukleotiden. Slutligen medger två endonukleasrestriktionsställen (idealiskt enkla skärare) genereringen av ett linjärt DNA-substrat med längd som önskat och med den specifika målplatsen i en definierad position såväl som en DNA-bubbla på avstånd från lesionen antingen i 5 'Eller 3' riktning.

Erkännande av lesionerna med NER-helikaser kan undersökas via AFM-bildbehandling. Stallad DNA-translokation av helikaserna vid tHans lesionsplats är synlig som en topp i proteinpositionsfördelningen på DNA och indikerar lesionsigenkänning. Eftersom DNA-translokation av dessa helikaser är vidare riktningsvis, med 5'-till-3'-polaritet indikerar beroendet av lesionsigenkänning på läget för laddningsstället (DNA-bubblan uppströms eller nedströms från lesionen) också huruvida lesionen är företrädesvis igenkänd På den translokerade eller på motsatta, icke-translokerade ssDNA-strängen 5 , 9 . I de följande avsnitten kommer de använda metoderna att introduceras och stora fynd från dessa experiment kommer att diskuteras kortfattat. Betydande, analogt med det exemplifierande arbetet med DNA-reparation som visas här, kan AFM-imaging appliceras på studien av olika DNA-interaktionssystem, såsom DNA-replikation eller transkription 8 , 12 , 13 , 14

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Provberedning

  1. Framställning av DNA-substrat 11
    1. Generering av ett ssDNA gap i plasmiden
      1. Helt smälta ett prov av plasmiden (här: modifierad pUC19, pUC19N) i ett reaktionsrör med ett lämpligt nickas (här: Nt.BstNBI) följt av enzymvärmeinaktivering, med användning av betingelser enligt tillverkarens protokoll (se figur 1 för en schematisk presentation). Börja med ~ 50 μl och ~ 500 nM plasmid för ett tillräckligt utbyte.
      2. Verifiera plasmid nicking med agarosgelelektrofores på utspädda prover (~ 20 nM) 15 . Använd handskar för skydd mot det DNA-bindande färgämnet som används för DNA-visualisering.
        OBS: Olika elektroforetiska mobiliteter möjliggör distinktion mellan nicked (avslappnad) och supercoiled cirkulär plasmid DNA ( Figur 1 ).
      3. Ta bort den sneda ssDNA-sträckan (mellan nick-platserna) från plasmiden medInkubation med ett 10-faldigt överskott av den komplementära oligonukleotiden (oligonukleotid 1 i tabell 1 ), skakning vid 300 varv per minut under 30 minuter nära oligonukleotidens smälttemperatur (här: 68 ° C för pUC19N) i ett värmeblock ).
      4. Separera den gapped plasmiden från de mindre DNA-fragmenten med användning av ett 50 kDa molekylviktskärde (MWCO) filter genom centrifugering i 10 min vid 10 000 xg i en bordscentrifug ( Figur 1 ). För att extrahera det koncentrerade DNA från filtret, invertera filtret och sätt in i ett nytt 1,5 ml reaktionsrör. Centrifugera i 3 min vid 1000 x g.
      5. Fyll det resulterande koncentrerade DNA-provet till 500 | il med avjoniserat, filtrerat vatten, tillsätt ytterligare 5-faldigt överskott av komplementär oligonukleotid och upprepa steg 1.1.1.3 och 1.1.1.4 minst 3 gånger.
      6. Test för fullständig gappning av DNA genom inkubering med ett lämpligt restriktionsenzym (här: XhoI eller BglII) under användning av conditiOns enligt tillverkarens beskrivning. Använd utspädda (nicked versus gapped) DNA-prover (~ 20 nM). Kör en agarosgelelektrofores för att särskilja mellan linjäriserad plasmid (innehållande inget ssDNA-gap) och icke-skårat DNA (gapped DNA) med användning av nicked-DNA som positiv kontroll (inkludera en DNA-stege för referens, Figur 1 ). Bära handskar.
    2. Återfyllning av gapet med modifierade ssDNA-oligonukleotider
      1. Anneal gapped plasmiden via inkubering med ett 25-faldigt överskott av en 5'-fosforylerad oligonukleotid som innehåller valfri specifikt målställe (er), inkubering vid ~ 45 ° C i 4 timmar ( Figur 1 ). Använd här 48 nt ssDNA som innehåller en lesion, antingen en fluoresceinadducerad tymin eller en cyklobutanpyrimidindimer (CPD), och dessutom en kort (8 nt) icke-komplementär sekvens för framställning av DNA-bubblor (se tabell 1 ).
      2. Kovalent koppla den glödgade insatsen till plasmiden genom inkubaTion med T4 DNA ligas över natten vid rumstemperatur enligt tillverkarens protokoll ( Figur 1 ). För denna reaktion, tillsätt ATP innehållande koncentrerad buffertlagerlösning för att ge lämpliga buffertbetingelser för ligasen ( t ex använd UvrB-reaktionsbuffert: 50 mM Tris-HCl pH 7,5, 10 mM MgCl2, 50 mM KCl, 5 mM DTT, 1 mM ATP).
      3. Test för införandet av den specifika oligonukleotiden i den gapped plasmiden genom uppslutning av utspädda prov med ett lämpligt restriktionsenzym (samma som i 1.1.1.6) enligt tillverkarens protokoll följt av en agarosgelelektrofores (som i 1.1.1.6, Figur 1 ).
    3. Framställning av linjärt DNA-substrat
      1. Digestera det modifierade plasmid-DNA med restriktionsenzymer (idealiskt med en enda restriktionsplats i plasmiden) med användning av betingelser som rekommenderats av tillverkaren ( Figur 1 ). Detta steg producerar linjära fragment innehållerAnge den infogade modifieringen vid en bestämd position. Använd här SspI- och BspQI-skärning vid positionerna 613 och 255 bp uppströms respektive nedströms för insatsen, vilket resulterar i ett 916 bp DNA-fragment som innehåller den specifika lesionsplatsen vid ~ 30% av DNA-längden.
        OBS: För AFM-imaging-experiment som beskrivits här är DNA-fragment med längder mellan ~ 200 bp och ~ 2000 bp lämpliga substrat.
      2. Isolera målfragmentet via agarosgelelektrofores och gelutvinning med användning av ett kommersiellt kit. Använd handskar för skydd.
      3. Eventuellt klippa agarosgel med en skalpell för att separera DNA-stegen och utspädda provbanor (första två banor) från banorna som innehåller det koncentrerade DNA som ska renas. Utsätt bara geldelen med de första två banorna för UV-bestrålning genom att placera endast den här delen av gelén på ett UV-bord.
        1. Klipp ut bandet som motsvarar det önskade fragmentet med en skalpell. Förena de båda geldelarna (från UV-flikenle). Använd positionen för det utskurna bandet från det utspädda provet som orientering för positionen för bandet av det önskade DNA-substratet. Redogöra för högre koncentration genom att skära ut något bredare skivor än för den utspädda kontrollen.
          ANMÄRKNING: Eftersom härigenom undersöktes erkännande av UV-lesioner infördes förekomsten av ytterligare UV-skador via UV-bestrålning försiktigt i DNA-substratet med detta tillvägagångssätt.
      4. Beräkna DNA-koncentrationen c från absorptionen vid 260 nm mätt med en UV-Vis-spektrofotometer med användning av Lambert-Beers lag med en dubbelsträngad DNA (dsDNA) genomsnittlig molär extinktionskoefficient på ε 260nm ~ 6.700 M - 1 cm - 1 per bp:
        Ekvation
        Där L är banlängden (mätkammarlängd, typiskt 1 cm).
    </ Li>
  2. Uttryck och rening av proteiner
    1. Rekombinant uttrycka UvrB i E. coli och rena proteinet via standardkitin-pärlaaffinitet 15 och storleksuttagskromatografi 15 såsom tidigare beskrivits 16 .
      OBS: UvrB- genen från Bacillus caldotenax hade klonats i pTYB1-vektorn.
    2. Express XPD i E. coli och rena proteinet via standard nickel IDA-affinitet 15 och storleksuttagningskromatografi 15 följt av anjonbytarkromatografi 15 , såsom tidigare beskrivits 17 .
      OBS: Genen för Chaetomium thermophilum Xeroderma pigmentosum- grupp D-proteinet (XPD) hade klonats i pBADM11-vektorn. C. thermophilum p44 var en snäll present från Caroline Kiskers laboratorium, uttryckt och puriFied som beskrivet 17 .

2. AFM Experiment

  1. Provberedning
    1. Eventuellt förinkubera DNA-substratet vid 65 ° C under 10 min i ett värmeblock för att avlägsna potentiella mikrosaltkristaller som kan ha bildats under lagring i kylskåpet.
    2. Förbered reaktionsbuffert (er) vid en 10-faldig koncentration (10x buffertar).
      OBS: XPD-reaktionsbuffert vid 1x koncentration innehöll 20 mM Tris-HCl pH 7,5, 10 mM KCl, 5 mM MgCl2, 1 mM TCEP, 2 mM ATP; 1 x UvrB-reaktionsbuffert innehöll 50 mM Tris-HCl pH 7,5, 50 mM KCl, 10 mM MgCl2, 5 mM DTT och 1 mM ATP.
    3. Förinkubera proteiner vid en högre koncentration i lämpliga inkubationsbetingelser för att förbättra komplexbildning. Förspäd en liten volym ( t.ex. 1 μl) av de enskilda proteinerna i 1x proteinreaktionsbuffert till önskad koncentration och blanda små volymer ( t ex 1 μl) av tHan individuella proteinlösningar i ett 0,5 ml reaktionsrör.
      1. Placera röret i ett värmeblock för inkubationstemperaturer högre än rumstemperatur. Välj ett koncentrationsförhållande beroende på det förväntade komplexa stökiometrin, antingen ekvimolära eller motsvarande koncentrationer. Inkubera här 1 μl XPD (20 μM i 1 x XPD-reaktionsbuffert) och 1 μL p44 (20 μM i 1x XPD-reaktionsbuffert) vid 10 μM vardera under 10 minuter vid 37 ° C.
    4. Inkubera prov vid lämpliga protein- och DNA-koncentrationer i proteinreaktionsbuffert i ett 0,5 ml reaktionsrör. Använd här 500 nM UvrB eller 1 uM XPD + 1 uM p44 och 100 nM DNA. Pipettera små volymer för att spara material, t ex 0,25-0,5 μl protein (förspätt till en 10-faldig inkubationskoncentration) och DNA i en total volym av 2,5-5 μl 1x proteinreaktionsbuffert. Här inkubera i 30 minuter vid 37 ° C i ett värmeblock. Snurra ner i reaktionsröret kort (~ 1 s) i en bordscentrifugE för att säkerställa blandning av små volymer.
  2. Prov deponering
    1. Förbered ett glimmerunderlag: Skär ca 1 x 1 cm 2 glimmer från större remsor med en skalpell. Avlägsna de övre skikten i det flerskiktiga glimmerminne med hjälp av tejp för att avslöja en ren, platt och atomiskt slät substratyta.
      OBS: Glimmerdelen kan återanvändas för flera experiment genom att avlägsna ytterligare skikt (er).
    2. Förbered AFM-deponeringsbufferten med avjoniserat, filtrerat vatten, t ex 25 mM HEPES pH 7,5, 25 mM Na-acetat, 10 mM Mg-acetat. Filtrera genom ett 0,02 μm sprutfilter.
      OBS: Divalenta katjoner i avsättningsbufferten tjänar till att kelatera de negativt laddade DNA-molekylerna till glimmerytan, vilken också är negativt laddad vid neutralt pH. Om den relativt höga Mg2 + -jonkoncentrationen i deponeringsbufferten utgör ett problem för ett visst protein-DNA-system, alternativt,Glimmerytan kan förfyllas med aminogrupper med användning av silatranbaserad kemi för att tillhandahålla positiva ytbelastningar för förankring 18 . Provavsättning kan sedan utföras i en buffert som innehåller inga eller endast låga mängder av tvåvärda katjoner.
    3. Späd provet (se 2.1) för omedelbar avsättning på glimmer i avsättningsbuffert. Deponera en liten volym (här: 20 μL).
      OBS: Utspädningsfaktorer beror på provkoncentrationen. Här utspädda prov 50-100x. Som tumregel resulterar ~ 1 nM DNA i en bra yta täckning för ~ 1000 bp.
    4. Skölj omedelbart sköljet tre till fyra gånger med några milliliter filtrerat, avjoniserat vatten, avlägsna överskottsvätska och torka i en mild kväveflöde. Hela processen från provavsättning till torkade prov kan utföras inom mindre än 30 s.
    5. Fixa glastyget på en mikroskopglas genom att använda tejp vid kanterna.
      OBS: Olika AFM-system har dAktuella krav för att fästa provet till scenen. Andra AFM har magnetiska steg, och glimmerbitarna är fastsatta på magnetskivor, t.ex. med termiskt lim. Detaljer om AFM-systemet som används här finns i Materialtabellen.
  3. AFM-bildbehandling
    1. Placera provet (se 2.2.5) centralt på AFM-scenen och fixera mikroskopglaset på scenen med magnetiska dynor.
    2. Sätt in AFM-spetsen i spetshållaren. Använd cantilevers med en skarp (<10 nm) AFM sond som är lämplig för oscillerande, intermittent kontaktlägesimaging i luft. Använd AFM-sonder, till exempel, som anges i materialet . Här (beror på AFM), fixa spetsen i hållaren under en klämma genom att dra åt klämskruven (fingertäthet). Sätt in spetshållaren i AFM-mäthuvudet. Håll huvudet på ryggen för detta steg.
    3. Placera AFM-mäthuvudet ovanpå provet. Detaljer beror på AFM-modellen. Här mAke säker på att huvudet står stabilt med sina ben inuti scenen. Se till att glimmern befinner sig på scenen där AFM-spetsen kommer att sväva direkt ovanför den. Mikrometerskruvarna på höger om scenen möjliggör fin positionering av provet.
    4. Justera AFM-lasern på baksidan av cantilever för optimal signalstyrka från den positionskänsliga fotodetektorn på vilken lasern reflekteras. Detaljer beror på AFM-modellen.
      1. Här vrider du hjulen på höger sida och baksidan av AFM-mäthuvudet för att justera AFM-laserens x- och y-positioner för att rikta den centralt på änden av cantilever. Titta på reflektionssignalen i AFM-videofönstret (om tillgängligt, här: tryck på kamerans ikon och välj inmatning: Svideo).
      2. När du väl är placerad, optimerar du detektorens sumsignal (Sum in Sum och Deflection Meter-fönstret i AFM-mjukvaran) genom att finjustera laserpositionen med de två hjulen (stanna i slutet av cantilever, summan signaJag beror på AFM och cantilever-typen, här: sikta på summa> 5).
    5. Noll skillnadssignalen från detektorens upptill och nedre diodor (här: Deflektionssignal i Sum och Deflection Meter-fönstret) genom att rikta AFM-laserreflektionen på detektorcentralen (här: vrid hjulet på vänster sida av AFM-mätningen huvud).
      OBS: Avvikelser från nollpunkten indikerar därefter avböjningen av cantileveret på grund av ytinteraktioner, som översätts till höjdinformation av AFM.
    6. Bestäm den cantilever resonansfrekvensen med en frekvens som implementeras i AFM-mjukvaran (här: Kommandotillstånd i huvudpanel / Tune-fönster). Välj en amplitud som motsvarar 1 V-ingången för piezoen som driver cantileveroscillationen. Ställ oscillationsfrekvensen till något (5%) lägre än resonansfrekvensen och noll oscillationsfasen.
    7. Närma spetsen till provytan med den råa ingreppsmodulenE (här: kommando Koppla in i huvudpanelfönstret) tills skyddsinställningen (börvärdet) nås. Använd ~ 2% skärning av fri nivå oscillationsamplitud som börvärde (här anger du Set Point 980 mV i huvudpanelen).
    8. Sätt in AFM-spetsen med provytan genom att sänka börvärdet med hjälp av AFM-mjukvaran. Syfte för avstötningsläge med cantileveroscillationsfasen (fas i summa och avböjningsmätare) precis under fria nivåfasen (före ingrepp, här typiskt ~ 70). Använd här typiska slutliga inställningspunkter i storleksordningen 70-80% av fri nivåamplitud (1 V).
    9. Innan du söker, välj signalerna för inspelning i huvudkanalpanelen. Välj höjd (Ht) och amplitud (Am).
    10. Börja provsökning (här: kommandot Skanna i huvudfönstret). Använd en skanningshastighet på t.ex. 2,5 μm / s (kommando Scanhastighet i huvudpanelen) till bildytor på 4 μm x 4 μm eller 8 μm x 8 μm (skriv in Scanstorlek i huvudrutanL) med pixelupplösningar av 2 088 eller 4 096 (Skanningspunkter och scanningslinjer i huvudpanelen).
    11. Spara bildfilen (kommandot Spara bild i huvudpanelen) utan anpassningsändringar (välj Ingen i Master Channel Panel / Save Plane Fit).
    12. För vidare analys, bearbeta den sparade bilden. Ladda bilden (kommando Bläddra sparade data i AFM-analysmenyn). Öppna modifieringspanelen (tryck på M i bildens övre del). Applicera en planfit i x- och y-dimensioner till höjdbilden (förlängning HtR) (kommando XY i Planefit-fönstret i Ändra panel, välj Planeringsorder 3). Placera sedan bilden (kommandot Flatten i flattenfönstret i Ändra panel) och välj Flatten Order 3.
    13. Exportera bilden som en TIFF-fil (tryck på Kommandon i översta delen av bilden, välj TIFF Export 2x motsvarande 2,048 pixel upplösning) för vidare analys.

3. AFM-analys

  1. Proteinkomplexvolym
    1. pre-Välj relevanta protein-DNA-komplex genom direkt visuell inspektion av bilderna i AFM-mjukvaran, med hjälp av ett lämpligt färgschema för att maximera olika utseenden av olika storlekskomplex (se olika färger och storlekar av olika komplex i Figur 2 , här: färgschema SeaLandAndFire in AFMsoftware). För XPD-prover inkluderade möjliga komplex XPD / p44-DNA , liksom XPD-DNA och p44-DNA, med tydligt olika storlekar på grund av de relativt stora molekylmassorna av XPD (~ 95 kDa) och p44 (~ 40 kDa) .
    2. Mät volymerna av individuella proteintoppar på DNA för att verifiera komplextypen. Detta kan uppnås med olika bildprogram (här: AFM-programmets sektionsverktyg).
      1. Mät höjden (h) och diameteren (d) av protein toppsektionerna med sektionsfönstermarkörerna. Mät diameteren nära partikelns botten.
      2. Bestäm volymen (V) på ärtenKs genom att använda enkla matematiska modeller, t.ex. genom att använda följande formel, som bygger på en sfärisk kapsmodell:
        Ekvation
    3. Översätt uppmätta volymer till en approximativ molekylmassa i molekylen.
      1. Initialt kalibrera AFM-systemet för volym till molekylvikt (MW) -omvandling med användning av ett område av proteiner med känd molekylvikt (här: totalt 12 experiment med mellan 25 och 851 datapunkter vardera utfördes på 5 olika proteiner i monomera dimeriska , Trimera eller tetramera tillstånd) 4 , 19 , 20 . Deponerings- och bildproteiner (som beskrivits ovan, i 2.2 och 2.3) och mäta deras volymer som beskrivits ovan (3.1.2). Plotta volymerna över deras kända molekylvikter. Den resulterande grafen kommer att visa ett linjärt förhållande mellan V och MW, ekvationen för vilken kan erhållas avEn linje som passar till data. För det AFM-system som användes här erhölls följande förhållande 19 :
        Ekvation
        OBS! Detta steg behöver inte upprepas före varje mätning, men görs endast en gång. Volymen till MW-kalibrering kan appliceras på bilder som erhållits under liknande bildningsförhållanden med användning av AFM-sonder med svagt varierande diametrar.
      2. Basera på deras uppmätta volymer (3.1.2) och V-till-MW-kalibreringen (3.1.3.1), bestämma ungefärliga MW av proteinkomplexen 20 , som ger information om dess molekylinnehåll. T.ex. för XPD / p44-prover, ~ 50 kDa, ~ 100 kDa och ~ 140 kDa erhölls, i överensstämmelse med p44-DNA-komplex (eller toppar orsakade av enbart DNA-överbyggnad), XPD-bara toppar och respektive XPD / p44-toppar .
  2. Proteinkomplexa positioner på DNA
    1. Bestäm DNAFragmentlängder.
      1. Spåra DNA-fragmenten i AFM-bilderna, t.ex. med frihandsledningsfunktionen för en lämplig bildanalysprogramvara (se till exempel materialtabell) och mäta längden på linjen.
        OBS: Undanta DNA-aggregat såväl som fragment som avskurits av bildmarginalerna.
      2. Pappa och plotta DNA-längderna från hela experimentet i ett histogram, med hjälp av lämplig dataanalys och grafisk programvara ( t.ex. se tabell över material ).
      3. Anpassa längdfördelningarna med en Gaussisk kurva i dataanalysen och grafikprogrammet för att bestämma längden på DNA-fragmenten. För att veta positionen för den införda DNA-målsiten (se 1.1), innefattar endast DNA-fragment med rätt längd inom två standardavvikelser från Gauss-kurvens centrum (y = y 0 + z exp (-2 (xx c ) 2 / w 2 ), där z är en normfaktor och x c och w är mitten ochFullständig maximal halva bredden av Gauss) i ytterligare analyser.
        OBS: DNA-längden i mitten av Gauss-kurvan måste vara nära den teoretiska längden av DNA-fragmentet (beräknat med användning av 0,34 nm / bp). Längder på upp till 10% kortare än det teoretiska värdet är typiska och är sannolikt orsakade av AFM-upplösningsgränser.
    2. Bestäm positioner av proteintoppar på DNA-substrat.
      1. Mät avståndet från proteintopparna från den närmare DNA-fragmentänden, såsom beskrivs i 3.2.1.1 och dela med den totala DNA-längden för erhållande av avstånd i enheter i fraktion av DNA-längd.
      2. Pappa och plotta de uppmätta avstånden i ett histogram med hjälp av en lämplig dataanalys och grafisk programvara (se t ex bild 3 ). Som en tumregel väljer du en binstorlek som ger ungefär √n fack för n datapunkter.
        OBS! Eftersom DNA-ändar inte kan särskiljas här, endast plottas till en fraktion av DNA-längd 0,5 (centrum för DNA-fragmenade). Eftersom DNA-bindning inte är fokus för studien, utesluter DNA-ändar från analyserna genom att börja lägga in positionsdata något efter position 0 ( t.ex. här: binning från en DNA-längd fraktion av 0,02).
    3. Bestäm målspecifika mål från proteinkomplexa positionfördelningar.
      1. Anpassa maximala (förbättrade bindningsförhållandena) i positionsfördelningen med en Gauss-kurva som i 3.2.1.3 men fotas på bakgrundsbindans höjd (se Figur 3 ).
      2. Beräkna specificiteten S för den specifika platsen mot den icke-specifika DNA-bakgrunden (proteinmolekyler bundna till icke-specifika DNA-ställen) med följande formel 21
        Ekvation
        En sp : Antal specifika komplex (område under den gaussiska kurvan)
        En nsp : Antal icke-specifika komplex (område av bakgrunden, 0 ); Den fraktion av DNA-längden som omfattas här är 0,48 för ett histogram som börjar vid 0,02 DNA-längd)
        N: antal möjliga DNA-bindningsställen (här: N = 914 exklusive DNA-ändar)
  3. DNA-böjningsvinklar
    1. Använd vinkelverktyget i en lämplig bildanalysprogramvara, mäta vinkeln p mellan två linjer placerade centralt längs DNA-ryggraden och centrera vid proteintoppen (se t.ex. insats i Figur 4 ). Mät vinklarna för ett statistiskt relevant antal protein-DNA-komplex (> 50, helst> 100) 2 , 3 , 5 .
      OBS: DNA-böjningsvinkeln definieras som 180 ° -P2 , 3 , 5 .
    2. Använda data analys och grafik programvara(Se tabell över material) producerar ett böjvinkeldistributionshistogram genom att binda DNA-böjningsvinklarna.
    3. Montera böjningsvinkelfördelningen med en Gauss-kurva. Om mer än ett maximum är uppenbart i fördelningen, välj flera topp Gauss-passform. Den eller de gaussiska kurvens (e) centrum (er) ger (s) den genomsnittliga böjvinkeln för den specifika arten.
    4. Om ett skifte i böjningsvinkeln (er) (maxima av Gaussisk passform (er)) är uppenbart för fördelningar, t.ex. av olika proteinvarianter eller olika proteinkomplexa arter, applicera en student t-test för att utvärdera signifikansnivån för förändringar.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Att skilja mellan olika komplexa typer baserat på proteinkomplexvolymer

Helikasaktiviteten hos det prokaryota NER-helikaset UvrB stimuleras genom DNA-bindning 22 , 23 . UvrB kräver en opparad region i DNA-en (en DNA-bubbla) för att korrekt laddas på en av de två enskilda ssDNA-strängarna. In vivo tillhandahålls denna DNA-struktur genom DNA-interaktioner genom ett annat protein i NER-kaskaden; I in vitro- experiment kan bubblan introduceras artificiellt i dsDNA-fragment i närhet av en målskada. Protein-protein-interaktioner förbättrar också DNA-bindning med UvrB 9 . När en gång UvrB laddas på DNA, verkar dess aktivitet emellertid inte bero på proteinko-faktorer 9 . I kontrast kräver det eukaryota NER-helikaset XPD interaktionPå med proteinet p44, vilket liknar XPD, ingår i multi-subunit-transkriptionsfaktor IIH (TFIIH) -komplexet in vivo , för aktivering av dess helicasaktivitet, men denna interaktion påverkar inte XPD-bindning till DNA 17 . XPD ensam förväntas ladda på DNA vid en DNA-bubbla, men inte translokera till lesionen (i frånvaro av dess helicasaktiverande ko-faktor). XPD utan p44 bör därför inte kunna interagera med och identifiera lesionen när den laddas på avstånd från lesionsplatsen. Inkubationer av XPD med p44 i närvaro av lesionsinnehållande DNA-substrat resulterar i en blandning av XPD- eller XPD / p44-DNA-komplex (och möjligen en mindre art av p44 ensam bunden till DNA). För att separat analysera lesionsigenkänning av XPD / p44 och XPD kan dessa olika komplexa typer särskiljas baserat på deras volymer i AFM-bilder ( Figur 2 ) 9 , såsom beskrivs i protokoll 3.1 ovan. AFM-system kan kalibreras med ett antal pRoteiner med känd molekylvikt för att avslöja ett linjärt förhållande mellan AFM-volymen och den approximativa molekylmassan hos ett protein (komplex) 20 , vilket möjliggör en tolkning av de uppmätta volymerna. Bindande positioner på DNA kunde sålunda bestämmas separat för helikas inaktiv monomer XPD (~ 95 kDa, i överensstämmelse med typen av 100 nm 3 klass 2 i figur 2 ) och för helikas-aktiva XPD / p44-komplex (~ 135 kDa, ~ 150 nm 3 klass 3-arter), baserat på deras olika AFM-volymer.

Lesionsigenkänningsbestämning från proteinbindningspositioner på DNA

Här användes långa (916 bp) DNA-substrat som innehöll en lesion vid ~ 30% av DNA-längden. Kontroll över den exakta positionen av lesionen i DNA-substratet gör det möjligt att skilja mellan specifika (lesionsbundna, 30% av DNA-längden) och ickeSpecifika (lesionssökning) komplex beroende på deras positioner på DNA. Två olika lesioner valdes, vilka är mål för NER; DNA-substrat innehöll antingen en fluorescein (F) -addukt eller en cyklobutanpyrimidindimer (CPD). Förutom läsplatsen innehöll DNA en icke-parade region (8 nt DNA-bubbla) som fungerade som laddningsplats för helikaserna. Denna laddningsplats var belägen på ett avstånd av 26 nt (för F-innehållande DNA-substrat) eller 23 nt (för CPD-innehållande substrat) antingen 5 'eller 3' från lesionen (se tabell 1 ). Lesionsigenkänning leder till stallad DNA-translokation av helicaserna UvrB och XPD vid målplatsen, uppenbar i AFM-proteinpositionsfördelningen på DNA som en topp vid läget av lesionen. Skadorna och bubbelpositionerna i dessa substrat kan inte i sig särskiljas inom upplösningsgränserna för AFM-avbildning (<10 nm avstånd). Emellertid är fraktionen av specifika komplex som representerar aMontering av molekyler som stallades vid lesionen och indikerar lesionsigenkänning, berodde starkt på huruvida lesionen placerades 3 'eller 5' från bubblan ( figur 3 ) 9 .

Från fraktionen av komplex på den specifika platsen (området under den gaussiska passningstoppen mot området för den icke-specifikt bundna bakgrunden) beräknades specificiteten S av UvrB och XPD för de två undersökta lesionstyperna (se protokoll 3.2 ovan). För UvrB resulterade laddning 5 'från lesionspositionen i högre specificiteter (SB , F5 ~ 200 och SB, CPD5 ~ 400) än laddning 3' från lesionen ( SB , F3 och SB, CPD3 ~ 100) för Båda lesionstyperna. För XPD skedde komplex som innehöll endast XPD (klass 2 i figur 2 ) och komplex innehållande XPD samt det helicasaktiverande ko-faktorproteinet p44 (klass 3 i figur 2 ) som beskrivsIbed i föregående avsnitt. Klass 2-proteintoppar (endast XPD, helikasinaktiv) lokaliserades inte företrädesvis vid lesionsställen oberoende av huruvida de laddades 5 'eller 3' och oberoende av lesionstypen (data ej visade). Däremot visade positionfördelningarna för XPD / p44 (klass 3) komplex förbättrad bindning vid F-lesioner för att ladda 5'från lesionen (S XPD / p44, F5 ~ 300 kontra S XPD / p44, F3 ~ 100) men vid CPD Lesioner för laddning 3 'från lesionen (S XPD / p44, CPD3 ~ 600 kontra S XPD / p44, CPD5 ~ 100, Figur 3 ). Eftersom UvrB och XPD är 5'-till-3'-helikaser, ger dessa data information om huruvida komplex uppstår genom interaktioner med lesionen inom ssDNA-strängen som de translokerar på (den translokerade strängen för att ladda 5 'från lesionen), Eller inom den motsatta, icke-translokerade strängen (för laddning 3 'från lesionen). Konceptet visas schematiskt i

Undersökande konformationsförändringar vid identifiering av lesioner av XPD

Mätning av böjningen införd i DNA vid platsen för bundna komplex från AFM-bilder (se protokoll 3.3 ovan) kan avslöja viktig information om komplexa konformationsförändringar. DNA-böjningsvinklar mättes för archaeal XPD 5 , vilket inte kräver proteinkompaktfaktorinteraktion för helicasaktivitet. I dessa studier var en fluorescein-lesion lokaliserad direcTly i sammanhanget med en DNA-bubbla för ökad proteinbelastning vid lesionen, vid ~ 30% av DNA-fragmentlängden. Figur 4 visar Gaussiska passar till DNA-böjningsvinkelfördelningar erhållna för proteinkomplex vid icke-specifika (icke-skadade) DNA-positioner och vid ~ 30% DNA-längd, i överensstämmelse med XPD bunden vid fluoresceindosionens position (specifika komplex). Uppgifterna visar en genomsnittlig böjningsvinkel på ~ 50 ° för icke-specifika komplex mot ~ 65 ° för specifika komplex. Denna DNA-böjningsvinkelskift var beroende av närvaron av ATP eller ATP-signaler, vilket indikerar att ATP (re) -bindande men inte hydrolys var nödvändig för konformationella omarrangemang 5 .

Figur 1
Figur 1: Framställning av DNA-substrat. Ett ssDNA-gap införs i cirkulärt plasmid-DNA genom att nicka plasmiden (här med nickasN.BstNBI) vid cloSeparerade platser och avlägsnande av den slutna ssDNA-sträckningen via centrifugfiltrering efter värmedestabilisering i närvaro av ett överskott av komplementär oligonukleotid. En specifik oligonukleotid som innehåller det önskade särdraget kan sedan anneas och ligeras i gapområdet. Slutligen resulterar digerering med restriktionsenzymer (här med SspI och BspQI) i ett linjärt DNA-substrat med målfunktionen vid en exakt känd position (här vid 30% av DNA-fragmentets längd). Kontrollanalyser möjliggör testning av de enskilda stegen (visad nedan) via agarosgelelektrofores (svart pil indikerar 3000 bp). Nicking kan testas med den förändrade elektroforetiska rörligheten hos det nicked, avslappnade cirkulära DNA (kontroll nicking, lane 2) jämfört med supercoiled plasmiden (lane 1). Komplett gapping av DNA såväl som efterföljande införande av den specifika oligo kan testas genom digestion med ett restriktionsenzym som skär i gapområdet (här: XhoI, iBanor 2, 4 och 6) så att en brist på DNA-snitt indikerar gapbildning (banor 1,2 nicked DNA, banor 3,4 gapped DNA) och återstallat snitt indikerar införande av den specifika oligo (banor 5,6) . Det slutliga linjära substratet som innehåller den specifika egenskapen kan renas från gelén efter agarosgelelektrofores och testas för homogenitet och renhet via AFM-bildbehandling. Vänligen klicka här för att se en större version av denna figur.

Figur 2
Figur 2: Att skilja olika komplexa typer från deras AFM-volymer. ( A ) AFM-bild av XPD / p44-DNA (grå pil) och XPD-DNA (svart pil) komplex. ( B ) Exempel på tre olika typer av DNA-bundna komplex, tolkade som p44 eller enbart DNA-överbyggnad (klass 1),XPD (klass 2, svart ram) och XPD / p44 (klass 3, grå ram) komplex baserat på deras AFM-volymer (visas till höger). Vänligen klicka här för att se en större version av denna figur.

Figur 3
Figur 3: Olika lesionsigenkänningsstrategier för prokaryota och eukaryota NER-helikaser. Lärningsigenkänningskompetent DNA-translokalisering av NER-helicaserna UvrB och XPD (i komplex med dess helicasaktiverande ko-faktor p44) kräver laddning av proteinerna i en icke-parade DNA-region (DNA-bubbla). Proteinerna rör sig därefter i 5'-till-3'-riktning längs ssDNA-strängen på vilken de laddades. Anerkänning av en DNA-skada (här: CPD) genom helikaserna antingen på den translokerade strängen (för laddning vid 5'-bubblan) eller på den motsatta, icke-translokerade strängen (foR laddning vid 3'-bubblan) resulterar i stallad DNA-translokation. I positionsfördelningarna uppvisar detta som en topp (Gaussisk passform), vilket indikerar förbättrad bindning vid lesionspositionen (vid ~ 30% av DNA-längden för DNA-substrat som visas här). Det prokaryota NER-helikaset UvrB och dess eukaryotiska motsvarighet XPD visar olika strategier för CPD-lesionigenkänning som indikerar olika DNA-strandpreferenser. Specifikt känns CPD-lesioner på den translokerade strängen av UvrB, men företrädesvis på den motsatta, icke-translokerade strängen av XPD. Figur modifierad från referens 9 . Vänligen klicka här för att se en större version av denna figur.

Figur 4
Figur 4: Konformationella förändringar i XPD-DNA-komplex efter lesionsidentifiering. Fördelningarna av DNA-böjningsvinklar inducerad av XPD indikerar konformationsförändringar i protein-DNA-komplexen vid en fluorescein-lesion. Dessa konformationella omläggningar var beroende av närvaron av ATP (B) eller ATP-signaler (C). ( A ) I frånvaro av ATP är icke-specifika böjningsvinklar (grå) och böjningsvinklar vid lesionsstället (specifika böjningsvinklar, svarta) likformiga och passar med en Gaussisk kurva med centrum vid ~ 50 °. ( B , C ) I närvaro av ATP eller ATP-signaler visar den specifika böjvinkelfördelningen (svart) ett signifikant skift (P = 2,5 x 10 -7 ) till en genomsnittlig böjvinkel på ~ 65 °. Detta DNA som böjer vid lesionsstället var oberoende av typen av lesion (CPD eller fluoresceinaddukt) eller närvaron eller frånvaron av en DNA-bubbla 5 . Figur reproducerades från referens 5 . Inlägget i (C) visar hur böjningsvinklar (180 ° -p) bestämdes.Ecsource.jove.com/files/ftp_upload/55501/55501fig4large.jpg "target =" _ blank "> Vänligen klicka här för att se en större version av denna figur.

siffra sekvens beskrivning
1 GGTCGACTCTAGAGGATCAGATCT
GGTACCTCTAGACTCGAGGCATGC
botten
2 / Phos / GCATGCCTCGTCAAATCTGGT
ACCAGATCTGATCCTCTAGAGTCGFCC
F / 5 'bubbla
3 / Phos / GCAFGCCTCGAGTCTAGAGGT
ACCAGATCTCTAAAGTAAGAGTCGACC
F / 3 'bubbla
4 / Phos / GCATGCCTCGTCAAATCTGGT
ACCAGATCTGATCCTCTAGAT-TCGACC
CPD / 5'bubble
5 / Fosfat / GCATGCT-TCGAGTCTAGAGGT
ACCAGATCTCTAAAGTAAGAGTCGACC
CPD / 3'bubble
6 / Phos / GCA TGCCTCGAGTCTAGACTCF
TTCCATCTGATCCTCTAGAGTCGACC
F / bubbla

Tabell 1: DNA-oligonukleotider för DNA-substratframställning. Alla oligonukleotider är 48 nt långa och övre strängar (oligonukleotider 2-6) erhölls fosforylerade vid deras 5'-ände för ligering in i det gapped-DNA (se protokoll 1.1). F = fluoresceinadducerad tymin, TT = cyklobutanpyrimidin (tymin) dimer (CPD), icke komplementära regioner (DNA-bubbelbildande regioner) är understrukna. F innehållande oligonukleotider erhölls från Integrated DNA Technologies (IDT), CPD innehållande oligonukleotider tillhandahölls vänligen av Thomas Carells laboratorium (Ludwig-Maximilian University Munich, Germany).

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

AFM statistiska analyser av bindningspositioner av proteiner på långa DNA-fragment som innehåller specifika målställen kan avslöja intressanta detaljer om de specifika strategier som används av proteinet för att känna igen dessa platser 2 , 3 , 4 , 5 , 6 . För att tolka de resulterande positionsfördelningarna måste positionerna för målen i DNA vara exakt kända. Detta uppnås genom att införa specifika ställen vid väldefinierade sekvenspositioner i cirkulärt plasmid-DNA och skära ut ett fragment av DNA innefattande denna specifika plats med användning av restriktionsenzymteknik. I AFM-bildanalyser av proteinbindningspositioner kan endast DNA-fragment med korrekta längder (i överensstämmelse med full längd av det utskurna fragmentet) inkluderas, eftersom endast för dessa är positionen för målplatsen känd. Det är värt nejVilket innebär att framställningsförfarandet beskrivet här resulterar i linjära DNA-substrat med två oskiljbara fragmentändar. Positionfördelningar kan följaktligen endast mätas och plottas från 0 x DNA-längd (proteiner bundna vid DNA-fragmentets ändar) till 0,5 x DNA-längd (proteiner bundna i centrum av fragment). För målpositioner som inte ligger exakt i mitten av substratet innehåller dessa fördelningar alltid en liten bakgrund av proteiner som är icke-specifikt bundna på samma avstånd från den andra DNA-änden. Om man däremot monterar en Gaussisk kurva på fördelningen som ligger på den genomsnittliga bakgrundshöjden (icke-specifikt bundna proteiner, Figur 3 ) står de för dessa komplex. Alternativt kan en av DNA-ändarna märkas, exempelvis med små volympunkter från sekundärstruktur som bildar ssDNA-överhäng 24 . Typiska upplösningsgränser för dessa positionsanalyser ligger i intervallet 100-faldig preferens av målet siTe över ospecifik platsbindning. Dessutom utgör DNA-fragmentets slut inte icke-specifika dsDNA-ställen, men representerar istället dsDNA-pauser. DNA-reparationsproteiner binder ofta till dessa destabiliserade fragmentändar, förutom de sträng-internt införda specifika målplatserna. DNA-bindning kan avslöjas genom AFM-analyser och kan ge viktig information om proteinets funktion. Om DNA-bindning inte är intressant, kan dessa positioner enkelt utelämnas från positionsfördelningarna genom att starta diagrammen vid en position> 0 ( t ex 0,02 DNA-längder).

En av de särskilda fördelarna och i själva verket den definierande gemensamma egenskapen med enkla molekyltekniker är upplösningen av individuella, olika tillstånd närvarande i ett prov, som kan ha väldigt olika egenskaper och aktiviteter. Även i fall där de särskilda arterna av intresse endast kan vara sällsynta i ett prov, tillåter dessa metoder sålundaSeparat fokus på denna art vars bidrag skulle dvärgas i en ensemble-mätning. För proteinprover möjliggör exempelvis AFM-imaging direkt skillnad mellan olika typer av proteinkomplex baserat på komplex volym, om storleken på de enskilda proteinerna skiljer sig tillräckligt (typiska upplösningsgränser är omkring 20 kDa) 1 , 4 , 6 , 7 , 9 , 12 . AFM-system kan kalibreras för att möjliggöra översättning av de uppmätta volymerna i proteinmolekylvikt (Protokoll 3.1.3.1) 4 , 8 , 19 , 20 . Alternativt har proteinstandarder med kända storlekar använts som en direkt referens i bilderna 1 , 6 . ISystem fokuserat på här kunde bindningspositioner på DNA således separat bestämmas för helikasinaktiv monomer XPD och för helikas-aktiva heterodimera XPD / p44-komplex. Preferensbindning till en lesionsplats vid en väldefinierad position i DNA-indikerat DNA-lesionsigenkänning av ett proteinkomplex. Eftersom proteinbelastning och lesionsställen var separerade i rymden var DNA-translokation en nödvändig förutsättning för lesionsigenkänning i de DNA-substrat som användes här. Endast de heterodimera XPD / p44-komplexen kunde DNA-translokation ( Figur 3 ), i överensstämmelse med resultaten från helicasaktivitetsanalyser 9 . AFM-volymanalys kan följaktligen ge viktig information om differentiella aktiviteter i olika proteinkomplexa former.

Lesionsinteraktion och igenkänning av det helikas-aktiva XPD / p44-komplexet resulterade i förbättrad bindning vid målplatsen på grund av fördröjning av helikas-translokation ( Figur 3 figur 3 ) indikerar detta resultat att enzymet detekterar fluorescein företrädesvis på den translokerade strängen men CPD företrädesvis på den motsatta, icke-translokerade strängen. Det prokaryota NER-helikaset UvrB, däremot, kännetecknade företrädesvis både fluorescein- och CPD-lesioner vid laddning 5 'från lesionen, dvs på den translokerade strängen ( Figur 3 ). Dessa särskiljande skillnader i deras lesionsigenkänningsegenskaper kan förstås av de olika strukturella egenskaperna hos de två helikaserna. UvrB interagerar med potentiella mål iN DNA: n via aminosyrarester på insidan av en p-hårnålfunktion i enzymet bakom vilket den translokerade strängen sannolikt tråks 16 , 25 . XPD, å andra sidan, värmer en liten pore i närheten av ett järn svavel (FeS) kluster 26 . Den translokerade DNA-strängen tränger troligen genom denna por 26 . Bulkier lesioner såsom fluorescein kan stoppa helikas-translokation via interaktioner med rester inom denna pore, medan mindre skrymmande CPD-lesioner lättare kan identifieras genom interaktioner med FeS-klustret. I det prokaryota systemet antas två molekyler UvrB vara involverade i målsökning i ett hetertetrameriskt UvrA2-UvrB2-komplex, i vilket var och en av de två UvrB-monomererna kan undersöka en annan DNA-sträng 27 . XPD i eukaryot NER finns sannolikt som en enda kopia iTFIIH-lesionigenkänningskomplex. Flexibilitet i lesionsinteraktionsmetoder för det eukaryotiska enzymet kan därför krävas för att möjliggöra igenkänning av det extremt stora målsätningsspektret hos NER-reparationssystemet.

Eftersom specifika (målplatsbundna) och icke-specifika komplex kan särskiljas i AFM-bilder baserat på deras positioner på DNA, kan dessa olika komplexa typer analyseras separat och jämföras. Single-molekyl-AFM är en av väldigt få tillvägagångssätt som ger tillgång till strukturella egenskaper hos proteinkomplex bundna icke-specifikt till DNA på grund av deras ofta övergående eller varierande natur. Här visualiserades och anpassades konformationsförändringar vid målplatsigenkänning och karakteriserades i arkeal XPD baserat på den böjning som infördes i DNA genom enzymet. AFM-data avslöjade ett litet men distinkt, signifikant skift i DNA-böjningsvinklar för XPD bunden vid en lesionsplats kontra XPD bunden till icke-specifikt DNA 5 . konformaFörändringar i de DNA-bundna proteinerna vid identifiering av målplatsen leder sannolikt till rekrytering av NER-endonukleaser (XPG och XPF i eukaryot NER) som utför excision av en kort sträckning av ssDNA som innehåller lesionen. Intressant, krävde detta skift och därmed konformationell omarrangemang bindning av ATP till enzymet (men inte hydrolys). Ett liknande tillvägagångssätt för ATP-återbinding vid identifiering av målplats och efterföljande rekrytering av UvrC-endonukleas har rapporterats för UvrB i prokaryot NER 28 , 29 .

Sammanfattningsvis har AFM singelmolekylbildning visat subtila skillnader i målsäteigenkänning av prokaryota och eukaryota NER-helikaser. När en målläsning har identifierats av enzymerna delar de en liknande strategi att rekrytera NER-endonukleaser via ATP-bindningsinducerade konformationsreorganiseringar selektivt vid lesionen. Tekniken för AFM i comBination med noggrann DNA-substratdesign för att efterlikna väsentliga egenskaper hos det undersökta systemet kan följaktligen ge insikt i målplatsinteraktioner av inte bara DNA-reparation utan DNA-bindande proteinsystem i allmänhet. Strukturell information om både specifika och icke-specifika komplex med lösningar i låg nanometerområdet (på molekylär nivå, begränsad av AFM-sonden) kan bidra avsevärt till förståelsen av de involverade mekanismerna.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna har ingenting att avslöja.

Acknowledgments

PUC19N, CPD-innehållande oligonukleotider och p44 tillhandahölls vänligen av Samuel Wilson, Korbinian Heil och Thomas Carell, respektive Gudrun Michels och Caroline Kisker. Detta arbete stöddes av bidrag från Deutsche Forschungsgemeinschaft (DFG) FZ82 och TE-671/4 till IT.

Materials

Name Company Catalog Number Comments
Molecular Force Probe (MFP) 3D Asylum Research N/A atomic force microscope (AFM)
Precision 390 DELL N/A computer
ThermoMixer and 1.5 mL block Eppendorf 5382000015 heat block for DNA preparation
Rotilabo Block-Heater H 250 & blocks for 0.5 mL tubes Carl Roth GmbH Y264.1 & Y267.1 heat block for protein-DNA incubations
Mini-Sub Cell GT Bio-Rad Laboratories GmbH 1704467 electrophoresis chamber with gel caster and power supply
Power Pac Basic Bio-Rad Laboratories GmbH 1645050 electrophoresis power supply
Centifuge 5415 D with rotor Eppendorf 2262120-3 table centrifuge
Ultra-Lum electronic UV transillumonator MEB-15 Ultralum 900-1322-02 UV irradiation table
NanoDrop ND-1000 VWR International / PEQLAB Biotechnologie GmbH N/A UV spectrophotometer
TKAX-CAD with 0.2 μm capsule filter Unity Lab Services N/A water deionization and filter unit
Name Company Catalog number Comments
Software
MFP software on Igor Pro Asylum Research N/A AFM software
ImageJ (open source Java image processing) NIH Image N/A Image analysis software
Excel (Microsoft Office) Microsoft Corporation N/A data analysis software
Origin9 / Origin2016 OriginLab Corporation N/A statistical data analysis and graphing software
Name Company Catalog number Comments
Material
OMCL-AC240TS Olympus OMCL-AC240TS AFM cantilevers
grade V-5 muscovite SPI Supplies 1805 mica sheets
Amicon Ultra 0.5 mL 50k Ultracell Millipore Ireland Ltd. UFC505096 centrifuge filters
NucleoSpin Extract II   Macherey-Nagel GmbH 740 609.250 Agarose gel extraction kit
Rotilabo cellulose paper type 111A Carl Roth GmbH AP59.1 AFM deposition blotting paper
Anatop 25 (0.02 μm) Whatman GmbH 6809-2102 syringe filter
SSpI, BspQI New England Biolabs (NEB) R0132, R0712 restriction enzymes for DNA substrate preparation
XhoI, BglII R0146, R0144 restriction enzymes for DNA preparation controls
nicking restriction enzyme Nt.BstNBI New England Biolabs (NEB) R0607 nickase
T4 DNA ligase New England Biolabs (NEB) M0202S Ligase
Tris, HEPES Carl Roth GmbH 4855, 9105 buffer chemicals
NaCl, MgCl2, KCl, MgAcetate Carl Roth GmbH 3957, HN03, HN02, P026 salt chemicals
NaAc Sigma-Aldrich Chemie GmbH 32318 salt chemicals
DTT, TCEP, EDTA 6908, HN95, 8040 chemicals/reagents
agarose, acetic acid, HCl Carl Roth GmbH 2267, 3738, K025 reagents
ATP Carl Roth GmbH K054 nucleotides
oligonucleotide #1 in Table 1 Biomers custom complementary DNA oligonucleotide
oligonucleotides #2, #3, and #6 in Table 1 Integrated DNA Technologies (IDT) custom fluorescein containing oligonucleotides
oligonucleotides #4  and #5 in Table 1 private (available from e.g. TriLink or GlenResearch) CPD containing oligonucleotides
SafeSeal reaction tube 0.5 mL and 1.5 mL Sarstedt 72.704 and 72.706 incubation tubes
GeneRuler 1 kb Thermo Scientific SM0311 DNA ladder
6x concentrate gel loading dye purple New England Biolabs (NEB) 51406 DNA loading dye
Midori Green  Nippon Genetics Europe GmbH 999MG28055 DNA stain

DOWNLOAD MATERIALS LIST

References

  1. Janicijevic, A., Ristic, D., Wyman, C. The molecular machines of DNA repair: scanning force microscopy analysis of their architecture. J. Microsc. 212, (3), 264-272 (2003).
  2. Wang, H., et al. DNA bending and unbending by MutS govern mismatch recognition and specificity. Proc. Natl. Acad. Sci. USA. 100, (25), 14822-14827 (2003).
  3. Tessmer, I., et al. Mechanism of MutS searching for DNA mismatches and signaling repair. J. Biol. Chem. 283, (52), 36646-36654 (2008).
  4. Wagner, K., Moolenaar, G., van Noort, J., Goosen, N. Single-molecule analysis reveals two separate DNA-binding domains in the Escherichia coli UvrA dimer. Nucleic Acids Res. 37, (6), 1962-1972 (2009).
  5. Buechner, C. N., et al. Strand-specific recognition of DNA damages by XPD provides insights into nucleotide excision repair substrate versatility. J Biol. Chem. 289, (6), 3613-3624 (2014).
  6. Van der Linden, E., Sanchez, H., Kinoshita, E., Kanaar, R., Wyman, C. RAD50 and NBS1 form a stable complex functional in DNA binding and tethering. Nucleic Acids Res. 37, (5), 1580-1588 (2009).
  7. Fuentes-Perez, M. E., Dillingham, M., Moreno-Herrero, F. AFM volumetric methods for the characterization of proteins and nucleic acids. Methods. 60, 113-121 (2013).
  8. Shlyakhtenko, L. S., Lushnikov, A. Y., Miyagi, A., Lyubchenko, Y. L. Specificity of binding of single-stranded DNA-binding protein to its target. Biochemistry. 51, 1500-1509 (2012).
  9. Wirth, N., et al. Conservation and Divergence in Nucleotide Excision Repair Lesion Recognition. J. Biol. Chem. 291, (36), 18932-18946 (2016).
  10. Kuper, J., Kisker, C. Damage recognition in nucleotide excision DNA repair. Curr. Opin. Struct. Biol. 22, 88-93 (2012).
  11. Buechner, C. N., Tessmer, I. DNA substrate preparation for atomic force microscopy studies of protein-DNA interactions. J. Mol. Recognit. 26, (12), 605-617 (2013).
  12. Sun, Z., Tan, H. Y., Bianco, P. R., Lyubchenko, Y. L. Remodeling of RecG Helicase at the DNA Replication Fork by SSB Protein. Sci. Rep. 5, 9625 (2015).
  13. Billingsley, D. J., Bonass, W. A., Crampton, N., Kirkham, J., Thomson, N. H. Single-molecule studies of DNA transcription using atomic force microscopy. Phys. Biol. 9, (2), 021001 (2012).
  14. Maurer, S., Fritz, J., Muskhelishvili, G., Travers, A. RNA polymerase and an activator form discrete subcomplexes in a transcription initiation complex. EMBO J. 25, (16), 3784-3790 (2006).
  15. Sambrook, J. Molecular Cloning: A Laboratory Manual. 1, 4th ed, Cold Spring Harbor Laboratory Press. Cold Spring Harbor, NY. (2012).
  16. Theis, K., Chen, P. J., Skorvaga, M., Van Houten, B., Kisker, C. Crystal structure of UvrB, a DNA helicase adapted for nucleotide excision repair. EMBO J. 18, (24), 6899-6907 (1999).
  17. Kuper, J., et al. In TFIIH, XPD helicase is exclusively devoted to DNA repair. PLoS Biol. 12, (9), e1001954 (2014).
  18. Shlyakhtenko, L. S., et al. Silatrane-based surface chemistry for immobilization of DNA, protein-DNA complexes and other biological materials. Ultramicroscopy. 97, 279-287 (2003).
  19. Roth, H. M., et al. XPB helicase regulates DNA incision by the Thermoplasma acidophilum endonuclease Bax1. DNA Repair. 11, (3), 286-293 (2012).
  20. Ratcliff, G. C., Erie, D. A. A Novel Single-Molecule Study to Determine Protein-Protein Association Constants. J. Am. Chem. Soc. 123, (24), 5632-5635 (2001).
  21. Yang, Y., Sass, L. E., Du, C., Hsieh, P., Erie, D. A. Determination of protein-DNA binding constants and specificities from statistical analyses of single molecules: MutS-DNA interactions. Nucleic Acids Res. 33, (13), 4322-4334 (2005).
  22. Caron, P. R., Grossman, L. Involvement of a cryptic ATPase activity of UvrB and its proteolysis product, UvrB* in DNA repair. Nucleic Acids Res. 16, (22), 10891-10902 (1988).
  23. Wang, H., et al. UvrB domain 4, an autoinhibitory gate for regulation of DNA binding and ATPase activity. J. Biol. Chem. 281, (22), 15227-15237 (2006).
  24. Chammas, O., Billingsley, D. J., Bonass, W. A., Thomson, N. H. Single-stranded DNA loops as fiducial markers for exploring DNA-protein interactions in single molecule imaging. Methods. 60, (2), 122-130 (2013).
  25. Truglio, J. J., et al. Structural basis for DNA recognition and processing by UvrB. Nat. Struct. Mol. Biol. 13, (4), 360-364 (2006).
  26. Kuper, J., Wolski, S. C., Michels, G., Kisker, C. Functional and structural studies of the nucleotide excision repair helicase XPD suggest a polarity for DNA translocation. EMBO J. 31, (2), 494-502 (2012).
  27. Verhoeven, E. E., Wyman, C., Moolenaar, G. F., Goosen, N. The presence of two UvrB subunits in the UvrAB complex ensures damage detection in both DNA strands. EMBO J. 21, (15), 4196-4205 (2002).
  28. Verhoeven, E. E., Wyman, C., Moolenaar, G. F., Hoeijmakers, J. H., Goosen, N. Architecture of nucleotide excision repair complexes: DNA is wrapped by UvrB before and after damage recognition. EMBO J. 20, (3), 601-611 (2001).
  29. Moolenaar, G. F., et al. The Role of ATP Binding and Hydrolysis by UvrB during Nucleotide Excision Repair. J. Biol. Chem. 275, 8044-8050 (2000).
Atomic Force Microscopy Undersökningar av DNA-lesionsigenkänning i Nucleotide Excision Repair
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Gross, J., Wirth, N., Tessmer, I. Atomic Force Microscopy Investigations of DNA Lesion Recognition in Nucleotide Excision Repair. J. Vis. Exp. (123), e55501, doi:10.3791/55501 (2017).More

Gross, J., Wirth, N., Tessmer, I. Atomic Force Microscopy Investigations of DNA Lesion Recognition in Nucleotide Excision Repair. J. Vis. Exp. (123), e55501, doi:10.3791/55501 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter