تحريض الوسيطة-طلائي التحولات في خلايا الورم اللحمي
Summary
نقدم هنا طريقة زراعة الخلايا لإحداث التحولات الوسيطة الظهارية (MET) في خلايا الورم اللحمي على أساس الجمع بين التعبير خارج الرحم من الرنا الميكروي 200 أفراد الأسرة وgrainyhead مثل 2 (GRHL2). هذا الأسلوب هو مناسبة لفهم أفضل للتأثير البيولوجي للاللدونة المظهري على عدوانية السرطان والعلاجات.
Abstract
تشير اللدونة المظهرية إلى ظاهرة في الخلايا التي تكتسب عابر الصفات من سلالة أخرى. خلال تطور سرطان، اللدونة المظهرية محركات الغزو ونشرها وورم خبيث. في الواقع، في حين أن معظم الدراسات من المرونة المظهرية كان في سياق سرطان المستمدة الظهارية، اتضح الأورام اللحمية، والتي هي الوسيطة في الأصل، كما تظهر ليونة المظهرية، مع مجموعة فرعية من الأورام اللحمية تمر الظاهرة التي تمثل mesenchymal- الانتقال الظهارية (MET). هنا، قمنا بتطوير طريقة تضم عائلة مير 200 وgrainyhead مثل 2 (GRHL2) لتقليد هذه الظاهرة MET-مثل لوحظ في ساركوما المريض SAMPLES.WE بالتتابع تعبير عن GRHL2 والأسرة مير-200 باستخدام ترنسدوكأيشن الخلية وترنسفكأيشن على التوالي ، من أجل فهم أفضل الأسس الجزيئية لهذه التحولات المظهرية في خلايا الورم اللحمي. أظهرت خلايا الورم اللحمي معربا عن مير-200S وGRHL2 تعزيز characterist الظهاريةICS في مورفولوجيا الخلايا الظهارية وتعديل والوسيطة المؤشرات الحيوية. الدراسات المستقبلية باستخدام هذه الطرق يمكن استخدامها لفهم أفضل للعواقب المظهرية العمليات MET تشبه على خلايا الورم اللحمي، مثل الهجرة والغزو والميل النقيلي، ومقاومة العلاج.
Introduction
تشير اللدونة المظهرية إلى انتقال عكسها بين الظواهر الخلوية، وينقسم عادة إلى نوعين، الظهارية إلى الوسيطة (EMT) التحولات والانتقالات الوسيطة إلى الظهارية (MET). هذا اللدونة المظهرية تلعب دورا هاما في العمليات العادية للالكائنات متعددة الخلايا، مثل التنمية والتئام الجروح 1؛ ومع ذلك، يمكن لهذه الممرات نفسها والبرامج التعبير الجيني يؤدي أيضا إلى مرض، مثل التليف (إعادة النظر في 2 و 3 و 4) والانبثاث سرطان (إعادة النظر في المراجع 5، 6، 7، 8). خلال ورم خبيث، على سبيل المثال، EMT يعطل قطبية الخلية، والتفاعلات خلية خلية، ويعزز غزو 9 و 10. معا، EMT المساهمةالصورة إلى حالة المظهرية التي تسهل نشر الخلايا السرطانية. وبالإضافة إلى ذلك، يؤدي EMT أيضا إلى مجموعة من التعديلات الأخرى المظهرية التي تدفع النمط الظاهري العدواني، بما في ذلك تحرير الخلايا السرطانية الأيض 6، وتطوير المقاومة للأدوية 11، 12، وزيادة الورم بدء قدرة 13 و 14 و استضافة التهرب المناعة 15.
اللدونة المظهرية وقد درست جيدا في تطور سرطان. ومع ذلك، الأورام اللحمية أيضا يحمل تكيفية النمط الظاهري. ومن المثير للاهتمام، يبدو كما لو كان بعض من نفس السائقين من المرونة المظهرية في سرطان تسهم أيضا في اللدونة ساركوما والعدوانية. على سبيل المثال، وقد ثبت تعميم الخلايا السرطانية (CTCs) من مرضى ساركوما للتعبير عن EpCAM، وهو بروتين سطح الخلية التي عادة ما يتم العثور على خلايا الظهارية (16). عديدوليا هو، صنفت 250 عينات ساركوما الأنسجة الرخوة كما الظهارية مثل أو الوسيطة مثل القائم على التعبير الجيني. وكان المرضى في التوقيع العلامات البيولوجية مثل الظهارية تشخيص أفضل من المرضى الذين يعانون من مثل الوسيطة العلامات البيولوجية توقيع 17. وهذا يتفق مع العديد من السرطانات، التي المرضى الذين يعانون من أكثر السرطانات مثل الظهارية لها نتائج أفضل مقارنة مع المرضى الذين يعانون من أكثر الأورام مثل الوسيطة 18.
في حين أن بعض الأورام اللحمية عرض المؤشرات الحيوية ومسارات التعبير الجيني بما يتفق مع MET، الأسس الجزيئية لهذه اللدونة المظهرية لا تزال غير مفهومة. لدراسة الآليات والسائقين من MET في ساركوما وضعنا نموذجا للتحريض MET باستخدام اثنين من العوامل الظهارية محددة، والرنا الميكروي (مير) -200 الأسرة وgrainyhead مثل 2 (GRHL2). مير-200S أسرة مكونة من الرنا الصغيرة غير الترميز التي تنظم التعبير الجيني عن طريق الربط إلى 'UTRs 3 من MESSENالالماني RNA ومنع ترجمتها إلى البروتين. وتتكون الأسرة مير 200 من مجموعتين فرعيتين – واحدة تحتوي على 141 مير ومير-200A، والآخر بما في ذلك مير 200B، 200C مير، ومير 429. يتم إثراء أفراد العائلة مير 200 في الأنسجة الظهارية، ويرتبط فقدان مير-200S مع الانبثاث في سرطان 19. وdownregulated الأسرة مير-200 أيضا في الأورام اللحمية الأنسجة اللينة مقارنة مع الأنسجة الطبيعية 20. على غرار مير-200S، GRHL2 هو المنظم الرئيسي الذي هو مهم للتنمية الظهارية 21. عامل GRHL2 النسخ يعمل بطريقتين لupregulate الجينات الظهارية، مثل E-كادهيرين: 1) في الخلايا الظهارية، GRHL2 يقمع مباشرة المنظم الرئيسي EMT، ZEB1 22؛ و2) GRHL2 ينشط مباشرة النسخ من الجينات الظهارية 23. وقد أظهرت تحقيقاتنا السابقة التي التعبير المشترك لمير-200S وGRHL2 في خلايا الورم اللحميالحث على MET تشبه النمط الظاهري (24). هنا، نقدم بروتوكول مفصلة لإنشاء نموذج في المختبر من MET الاستقراء في خلايا الورم اللحمي استخدام التعبير خارج الرحم من مير-200S وGRHL2.
Protocol
Representative Results
Discussion
الأورام اللحمية هي سرطانات نادرة، ولكن شديدة العدوانية من النسب الوسيطة. وعلى الرغم من نسبهم الوسيطة، تظهر مجموعة فرعية من الأورام اللحمية للخضوع لعملية انتقال المظهري إلى حالة أكثر مثل الظهارية. هذا التبديل MET تشبه له أهمية النذير، والمرضى الذين يعانون من أكثر الأ?…
Disclosures
The authors have nothing to disclose.
Acknowledgements
يعترف JAS بدعم من معهد ديوك السرطان، وجامعة ديوك التناسلي البولي مختبر علم الأورام، وقسم جراحة العظام جامعة دوق. وأيد HL من قبل مؤسسة العلوم الوطنية (NSF) مركز الفيزياء البيولوجية النظرية (NSF PHY-1427654) وNSF DMS-1361411، ونتيجة لCPRIT (الوقاية من السرطان ومعهد بحوث تكساس) الباحث في مركز أبحاث السرطان في ولاية تكساس في جامعة رايس. وأيد KEW من قبل المعاهد الوطنية للصحة F32 CA192630 MKJ واستفاد HL من مناقشات مفيدة مع ماري C فارش-كارسون، JN Onuchic، سمير M هاناش، كينيث J بيينتا، ودونالد S. كوفي.
Materials
| Countess automated counter | Life technologies | AMQAX1000 | |
| Countess cell counting chamber slides | Invitrogen | C10283 | |
| SimpliAmp Thermal Cycler | Thermo Fisher | A24811 | |
| Odyssey Fc | LI-COR Inc | ||
| ViiA7 Real Time PCR System | Thermo Fisher | 4453536 | |
| PCR microplate | Corning | 321-29-051 | |
| KAPA SYBR Fast Universal qPCR Kit | KAPA Biosystems | KK4602 | |
| Starting Block (PBS) Blocking Buffer | Thermo Fisher | 37538 | BSA-based blocking buffer |
| Agarose General Purpose LE | Genesee Scientific | 20-102 | |
| 10X Tris/Glycine/SDS Buffer | Bio-Rad Laboratories Inc | 161-0732 | Running buffer |
| 10X Tris/Glycine Buffer | Bio-Rad Laboratories Inc | 161-0734 | Transfer buffer |
| RIPA Buffer | Sigma Life Sciences | SLBG8489 | |
| Amersham Protran 0.45 μm nitrocellulose | GE Healthcare Lifesciences | 10600012 | |
| Quick-RNA MiniPrep Kit | Genesee Scientific | 11-358 | |
| Laemmli Sample Buffer (4X) | Bio-Rad Laboratories Inc | 1610747 | |
| Mini Trans-Blot Cell | Bio-Rad Laboratories Inc | 1703930 | |
| Mini-Protean Tetra Cell | Bio-Rad Laboratories Inc | 1658005EDU | |
| DPBS | Life technologies | 14190-144 | |
| 0.05% Trypsin-EDTA | Life technologies | 11995-065 | |
| DMEM | Life technologies | 11995-065 | |
| Lipofectamine RNAi Max | Thermo Fisher | 13778150 | |
| Lipofectamine 2000 Ragents | Thermo Fisher | 11668019 | |
| Penicillin Streptomycin | Life technologies | 15140-122 | |
| miRVana miRNA mimic negative control #1 | Thermo Fisher | 4464058 | neg miRNA |
| hsa-miR-200 mirVana miRNA mimic | Thermo Fisher | 4464066 | miR200A |
| has-miR-200 mirVana miRNA mimic | Thermo Fisher | 4404066 | miR200B |
| has-miR-200 mirVana miRNA mimic | Thermo Fisher | 4404066 | miR200C |
| Opti-MEM | Life technologies | 11088-021 | serum-free media |
| anti-Ecadherin antibody | BD Bioscience | 610182 | |
| anti-beta actin | Santa Cruz Biotechnology | sc-69879 | |
| anti-EpCam | Ab Serotec | MCA18706 | |
| anti-ZO1 | Invitrogen | 402200 | |
| IRDye 800W | LI-COR Inc | 925-32210 | |
| IRDye 680 | LI-COR Inc | 926-32223 | |
| anti-mouse AlexaFluor 647 | Thermo Fisher | A211241 | |
| anti-rabbit AlexaFluor 647 | Thermo Fisher | ab150075 | |
| Halt Protease and Phosphatesse Inhibitor | Thermo Fisher | 1861281 | |
| Precision Plus Protein Dual Color | Bio-Rad Laboratories Inc | 161-0374 | |
| Partec CellTrics | Sysmex | 04-004-2326 | 30 μm filter for flow |
| GAPDH-F | IDT | AGCCACATCGCTCAGACAC | |
| GAPDH-R | IDT | GCCCAATACGACCAAATCC | |
| Ecadherin-F | IDT | TGGAGGAATTCTTGCTTTGC | |
| Ecadherin-R | IDT | CGCTCTCCTCCGAAGAAAC | |
| ZEB1-F | IDT | GCATACAGAACCCAACTTGAACGTC | |
| ZEB1-R | IDT | CGATTACACCCAGACTGC | |
| NOTCH-F | IDT | GGCAATCCGAGGACTATGAG | |
| NOTCH-R | IDT | CTCAGAACGCACTCGTTGAT | |
| nitro blue tetrazolium | Sigma | N5514 | |
| hexadimethrine bromide | Sigma | H9268 | polybrene |
| 3 mL syringe | BD Bioscience | 309657 | |
| Sterile syringe filter | VWR | 28145-505 | |
| 5mL polypropylene round-bottom tube | 352063 | flow cytometry tubes | |
| High-Capacity cDNA Reverse Transcription Kit | Thermo Fisher | 4368814 | reverse transcription kit |
| 4% paraformaldyhyde | Santa Cruz Biotechnology | sc-281612 | |
| Triton-X100 | Sigma | 93443 | |
| bovine serum albumin | Sigma | A7906 |
References
- Weber, C. E., Li, N. Y., Wai, P. Y., Kuo, P. C. Epithelial-mesenchymal transition, TGF-beta, and osteopontin in wound healing and tissue remodeling after injury. J Burn Care Res. 33 (3), 311-318 (2012).
- Galichon, P., Finianos, S., Hertig, A. EMT-MET in renal disease: should we curb our enthusiasm. Cancer Lett. 341 (1), 24-29 (2013).
- Carew, R. M., Wang, B., Kantharidis, P. The role of EMT in renal fibrosis. Cell Tissue Res. 347 (1), 103-116 (2012).
- Willis, B. C., Borok, Z. TGF-beta-induced EMT: mechanisms and implications for fibrotic lung disease. Am J Physiol Lung Cell Mol Physiol. 293 (3), L525-L534 (2007).
- Ye, X., Weinberg, R. A. Epithelial-Mesenchymal Plasticity: A Central Regulator of Cancer Progression. Trends Cell Biol. 25 (11), 675-686 (2015).
- Li, L., Li, W. Epithelial-mesenchymal transition in human cancer: comprehensive reprogramming of metabolism, epigenetics, and differentiation. Pharmacol Ther. 150, 33-46 (2015).
- Tsai, J. H., Yang, J. Epithelial-mesenchymal plasticity in carcinoma metastasis. Genes Dev. 27 (20), 2192-2206 (2013).
- Bitting, R. L., Schaeffer, D., Somarelli, J. A., Garcia-Blanco, M. A., Armstrong, A. J. The role of epithelial plasticity in prostate cancer dissemination and treatment resistance. Cancer Metastasis Rev. 33 (2-3), 441-468 (2014).
- Schaeffer, D., Somarelli, J. A., Hanna, G., Palmer, G. M., Garcia-Blanco, M. A. Cellular Migration and Invasion Uncoupled: Increased Migration Is Not an Inexorable Consequence of Epithelial-to-Mesenchymal Transition. Mol Cell Biol. 34 (18), 3486-3499 (2014).
- Mathow, D., et al. Zeb1 affects epithelial cell adhesion by diverting glycosphingolipid metabolism. EMBO Rep. 16 (3), 321-331 (2015).
- Ware, K. E., et al. A mechanism of resistance to gefitinib mediated by cellular reprogramming and the acquisition of an FGF2-FGFR1 autocrine growth loop. Oncogenesis. 2, e39 (2013).
- Yauch, R. L., et al. Epithelial versus mesenchymal phenotype determines in vitro sensitivity and predicts clinical activity of erlotinib in lung cancer patients. Clin Cancer Res. 11 (24 Pt 1), 8686-8698 (2005).
- Jolly, M. K., et al. Towards elucidating the connection between epithelial-mesenchymal transitions and stemness. J R Soc Interface. 11 (101), 20140962 (2014).
- Mani, S. A., et al. The epithelial-mesenchymal transition generates cells with properties of stem cells. Cell. 133 (4), 704-715 (2008).
- Chen, L., et al. Metastasis is regulated via microRNA-200/ZEB1 axis control of tumour cell PD-L1 expression and intratumoral immunosuppression. Nat Commun. 5, 5241 (2014).
- Nicolazzo, C., Gradilone, A. Significance of circulating tumor cells in soft tissue sarcoma. Anal Cell Pathol (Amst). , 697395 (2015).
- Somarelli, J. A., et al. Mesenchymal-epithelial transition in sarcomas is controlled by the combinatorial expression of miR-200s and GRHL2. Mol Cell Biol. , (2016).
- Bae, Y. K., Choi, J. E., Kang, S. H., Lee, S. J. Epithelial-Mesenchymal Transition Phenotype Is Associated with Clinicopathological Factors That Indicate Aggressive Biological Behavior and Poor Clinical Outcomes in Invasive Breast Cancer. J Breast Cancer. 18 (3), 256-263 (2015).
- Humphries, B., Yang, C. The microRNA-200 family: small molecules with novel roles in cancer development, progression and therapy. Oncotarget. 6 (9), 6472-6498 (2015).
- Renner, M., et al. MicroRNA profiling of primary high-grade soft tissue sarcomas. Genes Chromosomes Cancer. 51 (11), 982-996 (2012).
- Petrof, G., et al. Mutations in GRHL2 result in an autosomal-recessive ectodermal Dysplasia syndrome. Am J Hum Genet. 95 (3), 308-314 (2014).
- Werner, S., et al. Dual roles of the transcription factor grainyhead-like 2 (GRHL2) in breast cancer. J Biol Chem. 288 (32), 22993-23008 (2013).
- Werth, M., et al. The transcription factor grainyhead-like 2 regulates the molecular composition of the epithelial apical junctional complex. Development. 137 (22), 3835-3845 (2010).
- Somarelli, J. A., et al. Mesenchymal-Epithelial Transition in Sarcomas Is Controlled by the Combinatorial Expression of MicroRNA 200s and GRHL2. Mol Cell Biol. 36 (19), 2503-2513 (2016).
- Varma, S., et al. The transcription factors Grainyhead-like 2 and NK2-homeobox 1 form a regulatory loop that coordinates lung epithelial cell morphogenesis and differentiation. J Biol Chem. 287 (44), 37282-37295 (2012).
- Pruitt, S. C., Mielnicki, L. M., Stewart, C. C. Analysis of fluorescent protein expressing cells by flow cytometry. Methods Mol Biol. 263, 239-258 (2004).
- Zhao, Z., et al. A high-content morphological screen identifies novel microRNAs that regulate neuroblastoma cell differentiation. Oncotarget. 5 (9), 2499-2512 (2014).
- Borowicz, S., et al. The soft agar colony formation assay. J Vis Exp. (92), e51998 (2014).
- Yang, J., et al. Integrated proteomics and genomics analysis reveals a novel mesenchymal to epithelial reverting transition in leiomyosarcoma through regulation of slug. Mol Cell Proteomics. 9 (11), 2405-2413 (2010).
- Alba-Castellon, L., et al. Snail1 expression is required for sarcomagenesis. Neoplasia. 16 (5), 413-421 (2014).
- Takaishi, M., Tarutani, M., Takeda, J., Sano, S. Mesenchymal to Epithelial Transition Induced by Reprogramming Factors Attenuates the Malignancy of Cancer Cells. PLoS One. 11 (6), e0156904 (2016).
