Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Developmental Biology

تحريض الوسيطة-طلائي التحولات في خلايا الورم اللحمي

doi: 10.3791/55520 Published: April 7, 2017

ERRATUM NOTICE

Summary

نقدم هنا طريقة زراعة الخلايا لإحداث التحولات الوسيطة الظهارية (MET) في خلايا الورم اللحمي على أساس الجمع بين التعبير خارج الرحم من الرنا الميكروي 200 أفراد الأسرة وgrainyhead مثل 2 (GRHL2). هذا الأسلوب هو مناسبة لفهم أفضل للتأثير البيولوجي للاللدونة المظهري على عدوانية السرطان والعلاجات.

Abstract

تشير اللدونة المظهرية إلى ظاهرة في الخلايا التي تكتسب عابر الصفات من سلالة أخرى. خلال تطور سرطان، اللدونة المظهرية محركات الغزو ونشرها وورم خبيث. في الواقع، في حين أن معظم الدراسات من المرونة المظهرية كان في سياق سرطان المستمدة الظهارية، اتضح الأورام اللحمية، والتي هي الوسيطة في الأصل، كما تظهر ليونة المظهرية، مع مجموعة فرعية من الأورام اللحمية تمر الظاهرة التي تمثل mesenchymal- الانتقال الظهارية (MET). هنا، قمنا بتطوير طريقة تضم عائلة مير 200 وgrainyhead مثل 2 (GRHL2) لتقليد هذه الظاهرة MET-مثل لوحظ في ساركوما المريض SAMPLES.WE بالتتابع تعبير عن GRHL2 والأسرة مير-200 باستخدام ترنسدوكأيشن الخلية وترنسفكأيشن على التوالي ، من أجل فهم أفضل الأسس الجزيئية لهذه التحولات المظهرية في خلايا الورم اللحمي. أظهرت خلايا الورم اللحمي معربا عن مير-200S وGRHL2 تعزيز characterist الظهاريةICS في مورفولوجيا الخلايا الظهارية وتعديل والوسيطة المؤشرات الحيوية. الدراسات المستقبلية باستخدام هذه الطرق يمكن استخدامها لفهم أفضل للعواقب المظهرية العمليات MET تشبه على خلايا الورم اللحمي، مثل الهجرة والغزو والميل النقيلي، ومقاومة العلاج.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

تشير اللدونة المظهرية إلى انتقال عكسها بين الظواهر الخلوية، وينقسم عادة إلى نوعين، الظهارية إلى الوسيطة (EMT) التحولات والانتقالات الوسيطة إلى الظهارية (MET). هذا اللدونة المظهرية تلعب دورا هاما في العمليات العادية للالكائنات متعددة الخلايا، مثل التنمية والتئام الجروح ومع ذلك، يمكن لهذه الممرات نفسها والبرامج التعبير الجيني يؤدي أيضا إلى مرض، مثل التليف (إعادة النظر في 2 و 3 و 4) والانبثاث سرطان (إعادة النظر في المراجع 8). خلال ورم خبيث، على سبيل المثال، EMT يعطل قطبية الخلية، والتفاعلات خلية خلية، ويعزز غزو 9 و 10. معا، EMT المساهمةالصورة إلى حالة المظهرية التي تسهل نشر الخلايا السرطانية. وبالإضافة إلى ذلك، يؤدي EMT أيضا إلى مجموعة من التعديلات الأخرى المظهرية التي تدفع النمط الظاهري العدواني، بما في ذلك تحرير الخلايا السرطانية الأيض وتطوير المقاومة للأدوية 11، 12، وزيادة الورم بدء قدرة 13 و 14 و استضافة التهرب المناعة 15.

اللدونة المظهرية وقد درست جيدا في تطور سرطان. ومع ذلك، الأورام اللحمية أيضا يحمل تكيفية النمط الظاهري. ومن المثير للاهتمام، يبدو كما لو كان بعض من نفس السائقين من المرونة المظهرية في سرطان تسهم أيضا في اللدونة ساركوما والعدوانية. على سبيل المثال، وقد ثبت تعميم الخلايا السرطانية (CTCs) من مرضى ساركوما للتعبير عن EpCAM، وهو بروتين سطح الخلية التي عادة ما يتم العثور على خلايا الظهارية (16). عديدوليا هو، صنفت 250 عينات ساركوما الأنسجة الرخوة كما الظهارية مثل أو الوسيطة مثل القائم على التعبير الجيني. وكان المرضى في التوقيع العلامات البيولوجية مثل الظهارية تشخيص أفضل من المرضى الذين يعانون من مثل الوسيطة العلامات البيولوجية توقيع 17. وهذا يتفق مع العديد من السرطانات، التي المرضى الذين يعانون من أكثر السرطانات مثل الظهارية لها نتائج أفضل مقارنة مع المرضى الذين يعانون من أكثر الأورام مثل الوسيطة 18.

في حين أن بعض الأورام اللحمية عرض المؤشرات الحيوية ومسارات التعبير الجيني بما يتفق مع MET، الأسس الجزيئية لهذه اللدونة المظهرية لا تزال غير مفهومة. لدراسة الآليات والسائقين من MET في ساركوما وضعنا نموذجا للتحريض MET باستخدام اثنين من العوامل الظهارية محددة، والرنا الميكروي (مير) -200 الأسرة وgrainyhead مثل 2 (GRHL2). مير-200S أسرة مكونة من الرنا الصغيرة غير الترميز التي تنظم التعبير الجيني عن طريق الربط إلى 'UTRs 3 من MESSENالالماني RNA ومنع ترجمتها إلى البروتين. وتتكون الأسرة مير 200 من مجموعتين فرعيتين - واحدة تحتوي على 141 مير ومير-200A، والآخر بما في ذلك مير 200B، 200C مير، ومير 429. يتم إثراء أفراد العائلة مير 200 في الأنسجة الظهارية، ويرتبط فقدان مير-200S مع الانبثاث في سرطان 19. وdownregulated الأسرة مير-200 أيضا في الأورام اللحمية الأنسجة اللينة مقارنة مع الأنسجة الطبيعية 20. على غرار مير-200S، GRHL2 هو المنظم الرئيسي الذي هو مهم للتنمية الظهارية 21. عامل GRHL2 النسخ يعمل بطريقتين لupregulate الجينات الظهارية، مثل E-كادهيرين: 1) في الخلايا الظهارية، GRHL2 يقمع مباشرة المنظم الرئيسي EMT، ZEB1 22؛ و2) GRHL2 ينشط مباشرة النسخ من الجينات الظهارية 23. وقد أظهرت تحقيقاتنا السابقة التي التعبير المشترك لمير-200S وGRHL2 في خلايا الورم اللحميالحث على MET تشبه النمط الظاهري (24). هنا، نقدم بروتوكول مفصلة لإنشاء نموذج في المختبر من MET الاستقراء في خلايا الورم اللحمي استخدام التعبير خارج الرحم من مير-200S وGRHL2.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. إعداد الكواشف

  1. إعداد DMEM للثقافة الخلية وذلك بإضافة 50 مل من مصل الجنين البقري (FBS) و 5 مل من البنسلين ستربتومايسين (5000 U / مل) إلى 500 مل من DMEM. هذه الوسيلة يمكن تخزينها في 4 درجة مئوية لمدة تصل إلى ستة أشهر.
  2. إعادة تعليق الاشعال مجفف بالتجميد في nuclease خالية من المياه إلى تركيز النهائي من 10 ميكرومتر. متجر الاشعال إعادة وقف التنفيذ في -20 ° C.
  3. إعداد الترسيب المناعي الشعاعي فحص (RIPA) العازلة (150 ملي مول كلوريد الصوديوم، و 0.5٪ deoxycholate الصوديوم، 0.1٪ SDS، 50 ملي تريس، ودرجة الحموضة 8.0). تكملة مع الكوكتيل مثبط البروتياز قبل الاستخدام والحفاظ عازلة على الجليد عند استعمال الهاتف. تخزينها في 4 ° C.
  4. إعداد 10 ملغ / مل polybrene (بروميد hexadimethrine) في تصفية المياه وحقنة لتعقيم باستخدام فلتر polyethersulfone 0.45 ميكرون. حل يمكن تخزينها في 4 درجة مئوية لمدة تصل إلى ستة أشهر.
  5. يعد حل 1 ملغ / مل عمل نيترو كلوريد نتروبلو الأزرق عن طريق إذابة 10 ملغ في 10 مل من برنامج تلفزيوني. تخزينها في 4 ° C.

2. Lentiviral تنبيغ من GRHL2

اليوم 1

  1. لوحة 3 × 10 5 خلايا HEK293T لكل بئر من لوحة 6 جيدا في 2 مل من DMEM تستكمل. تحديد الخلايا باستخدام عداد الخلية الآلي. وينبغي أن تكون خلايا 40-60٪ متموجة بعد الثقافة بين عشية وضحاها في 37 درجة مئوية مع 5٪ CO 2.

يوم 2

  1. تمييع 2 ميكروغرام من ناقلات فارغة (pCMV-UBC-EGFP) أو 2 ميكروغرام من pCMV-GRHL2-UBC-EGFP 24 و 25 في 200 ميكرولتر من وسائل الإعلام الحرة المصل جنبا إلى جنب مع 1.8 ميكروغرام من pΔ8.9 و 0.2 ميكروغرام من pCMV-VSV البلازميدات المساعد -G. في أنبوب منفصل، وتمييع 4 ميكرولتر من كاشف ترنسفكأيشن في دهون 200 ميكرولتر من وسائل الإعلام الحرة المصل في ترنسفكأيشن (8 ميكرولتر في 400 ميكرولتر لعينتين). إضافة 200 ميكرولتر من كاشف ترنسفكأيشن المزيج على كل حل البلازميد واحتضان لمدة 20 دقيقة في درجة حرارة الغرفة.
  2. خلال incubaنشوئها، وغسل خلايا HEK293T عن طريق إزالة المتوسط ​​عن طريق الشفط والشطف الخلايا مع 1 مل من برنامج تلفزيوني. استبدال برنامج تلفزيوني مع 800 ميكرولتر من وسائل الإعلام الحرة المصل. بعد 20 دقيقة، إضافة 200 ميكرولتر من كاشف ترنسفكأيشن: خليط البلازميد من الخطوة 2.2 قطرة قطرة إلى كل بئر واحتضان الخلايا لمدة 2 ساعة عند 37 درجة مئوية في 5٪ CO 2.
  3. إزالة بعناية المتوسطة ترنسفكأيشن بواسطة الشفط واستبدالها مع 2 مل من DMEM تستكمل. عودة إلى الخلايا الحاضنة للثقافة بين عشية وضحاها.
    ملاحظة: خلايا HEK293T هي ملتصقة فضفاضة. يجب إجراء استبدال وسائل الإعلام مع الحذر للحد من إزالة الخلايا من قاع الطبق أو قارورة.

يوم 3

  1. تحديث وسائل الإعلام على خلايا HEK293T transfected ولوحة 3 × 10 5 خلايا RD لكل بئر من لوحة 6 جيدا في 2 مل من DMEM تستكمل. خلايا الثقافة بين عشية وضحاها. خلايا RD هي المتاحة تجاريا خط الخلية العضلية المخططة البشري.

يوم 4

  • جمع وسائل الاعلام الفيروسي من الخلايا HEK293T. ماصة وسائل الاعلام DMEM من الخلايا HEK293T والمكان إلى جديد 15 مل المخروطية. استبدال بعناية مع وسائل الاعلام DMEM جديدة وخلايا مكان HEK293T مرة أخرى في حاضنة لليوم التالي.
  • إضافة 2 ميكرولتر من 10 ملغ / مل polybrene لكل مليلتر من وسائل الاعلام الفيروسية إلى قسمين جديدة أنابيب مخروطية 50 مل (واحد لترنسفكأيشن ناقلات فارغة وآخر للترنسفكأيشن GRHL2). حقنة تصفية وسائل الاعلام الفيروسية عن طريق إزالة المكبس من حقنة مل 3 وإرفاق مرشح 0.45 ميكرون polyethersulfone إلى الحافة.
    1. إضافة وسائل الإعلام الفيروسية التي تم جمعها في الخطوة 2.6 في برميل من الحقنة، والغطس وسائل الاعلام في أنابيب مخروطية 50 مل جديدة تحتوي على polybrene. إزالة وسائل الاعلام من الخلايا RD بواسطة الشفط وإضافة تصفية وسائل الاعلام الفيروسي لخلايا RD.
  • يوم 5

    1. يمكن التخلص منها كرر يوم 4. خلايا HEK293T بعد أن تم جمع وسائل الإعلام الفيروسية.

    يوم 7

    1. غسل الخلايا RD مع 1 مل من برنامج تلفزيوني وإضافة 200 ميكرولتر من التربسين 0.05٪ لكل بئر. احتضان عند 37 درجة مئوية لمدة 5 دقائق، إضافة 2 مل من وسائل الإعلام تستكمل، ونقل تعليق خلية إلى جديد 15 مل المخروطية. خلايا الطرد المركزي في 250 x ج لمدة 5 دقائق في درجة حرارة الغرفة وسائل الإعلام نضح. Resuspend في 1 مل من DMEM (تستكمل مع 5٪ FBS و 1٪ البنسلين ستربتومايسين).
      ملاحظة: استخدام نسبة أعلى من FBS قد يسبب انسداد خلال التدفق الخلوي
      1. خلايا مرشح للالتدفق الخلوي. استخدام ماصة لتطبيق مل RD تعليق خلية 1 من خلال مرشح 30 ميكرون في التدفق الخلوي أنابيب وأنابيب مكان على الجليد.
      2. نوع EGFP + الخلايا 26 إلى 1.5 مل أنابيب microcentrifuge تحتوي على 0.5 مل من DMEM تستكمل مع 10٪ FBS و 1٪ البنسلين ستربتومايسين ومكان على الجليد. لوحة EGFP + فرز الخلايا في مجموعه 1 مل من DMEM تستكمل في بئر واحدة من لوحة ال 12 جيدا ووضعه في الحاضنة للثقافة.
        ؛ ملاحظة: العائد من EGFP + الخلايا من التدفق الخلوي بعد هذا ترنسدوكأيشن هو منخفضة عادة (50،000-100،000 الخلايا). قد تحتاج إلى مثقف لمدة 10 خلايا - 14 أيام قبل الانتقال إلى الخطوة 3.

    3. عكسي ترنسفكأيشن من مير-200S

    1. إعداد 50 ميكرومتر مخزونات مير 200 يقلد باستخدام nuclease خالية H 2 O. الأسهم قسامة ومخزن في -20 ° C إلى تجنب تكرار دورات تجميد / الذوبان.
    2. إضافة 3 ميكرولتر من كل 50 ميكرومتر مير 200 تقليد (مير-200A، مير 200B، ومير 200C) إلى 300 ميكرولتر من وسائل الإعلام الحرة المصل أو 9 ميكرولتر من 50 ميكرومتر ميرنا السيطرة السلبية لوسائل الاعلام المصل خالية 300 ميكرولتر.
    3. إضافة 6 ميكرولتر من سيرنا محددة ترنسفكأيشن الكاشف إلى 600 ميكرولتر من وسائل الإعلام الحرة المصل وتقسيم 300 ميكرولتر من هذا الخليط في أنبوبين، واحدة لكل اثنين من الخلطات مير من الخطوة 3.2. الجمع بين 300 ميكرولتر من كل خليط مير من الخطوة 3.2 مع مزيج من 300 ميكرولتر من كاشف ترنسفكأيشن. احتضان لمدة 20 دقيقة في الشركة المصرية للاتصالات الغرفةmperature.
    4. في حين تفرخ، وإعداد تعليق خلية من خلايا 600،000 EGFP + RD معربا عن EV أو GRHL2 إنشاؤها في القسم 2 في 2.4 مل (250 خلية / ميكرولتر) من وسائل الإعلام خالية من المصل لكل معاملة.
    5. في 24 لوحة جيدا، إضافة 100 ميكرولتر لكل بئر من مير 200 مزيج أو خليط تحكم سلبي من الخطوة 3.3 إلى ست آبار، ثم قم بإضافة 400 ميكرولتر من كل تعليق خلية في ثلاثة آبار من كل مزيج مير.
    6. احتضان الخلايا عند 37 درجة مئوية في 5٪ CO 2 بين عشية وضحاها وتغيير وسائل الإعلام إلى أن تستكمل تماما DMEM في اليوم التالي. جمع الخلايا في وقت لاحق 2 أيام للتحليل باستخدام العازلة المناسبة (انظر أدناه). الوقت الفاصل بين التصوير من خلايا الورم اللحمي RD تمر MET متاح كمادة تكميلية. صورة كل بئر كل ح 2 مع هدف 10X باستخدام الآلي الخلية الحية تصوير 27.

    استخراج 4. RNA، النسخ العكسي، وQPCR

    1. استخراج RNA وفقا لتعليمات الشركة الصانعة باستخدام RNA قياسيعدة استخراج 24. ويمكن تخزين الحمض النووي الريبي المستخرج في -80 ° C.
    2. قياس تركيز الحمض النووي الريبي. ذوبان الجليد والعمل مع RNA على الجليد. لقياس تركيزات RNA، وقياس امتصاص الأشعة فوق البنفسجية في 260 نانومتر مع معمل لوحة القارئ وفقا لبروتوكول الشركة المصنعة. تمييع جميع العينات إلى أدنى تركيز مع nuclease خالية من المياه.
    3. أداء النسخ العكسي من إجمالي RNA إلى DNA مكملة (كدنا]). الجمع بين ما لا يقل عن 100 نانوغرام من الحمض النووي الريبي مجموع العازلة مع PCR، مزيج dNTP (100 ملم)، الاشعال مسدوس عشوائية، عكس الناسخ وnuclease خالية من المياه في 20 ميكرولتر حجم رد الفعل (24). تشغيل دورات RT وفقا لبروتوكول تصنيع. [كدنا يمكن تخزين على المدى الطويل عند درجة حرارة -20 درجة مئوية.
    4. تمييع 20 التفاعلات ميكرولتر إلى 100 ميكرولتر مع 80 ميكرولتر من nuclease خالية H 2 O.
    5. مزيج 5 ميكرولتر من القائم على مضان الإقحام صبغ مزيج الرئيسي 2X QPCR، 0.06 ميكرولتر من كل التمهيدي 10 ميكرومتر، وهيالثانية 2 ميكرولتر من المخفف رد فعل RT لكل عينة.
    6. تشغيل QPCR وفقا لبروتوكول الشركة المصنعة لمزيج الرئيسي القائم على مضان.
    7. تحديد كميات النسبية للمرنا من دلتا طريقة CT وتطبيع لGAPDH. رسم التعبير مرنا يعني من مكررات البيولوجية ± الانحراف المعياري لكل مجموعة العلاج.
      ملاحظة: يجب اتخاذ احتياطات خاصة عند العمل مع RNA لتجنب الاتصال مع RNases، مثل استخدام المواد البلاستيكية والمواد الكيميائية ريبونوكلياز خالية. ينبغي أن يعامل المعدات غير القابل للتصرف قبل استخدامها لإزالة RNases.

    5. المناعي تلطيخ

    1. الخطوة التالية 3.6، ووسائل الإعلام نضح بواسطة الشفط من خلايا RD في شكل 24-جيدا.
    2. إصلاح الخلايا بإضافة 500 ميكرولتر من بارافورمالدهيد 4٪ (PFA) لكل بئر واحتضان لمدة 15 دقيقة في درجة حرارة الغرفة (RT). بعد التثبيت، وخلايا مكان في الفوسفات مخزنة المالحة (PBS) وتخزينها في 4 درجات مئوية خلال الليل إذا لزم الأمر.
    3. Permeabilizeالخلايا بإضافة 500 ميكرولتر من برنامج تلفزيوني + 0.2٪ تريتون-X100 واحتضان 30 دقيقة في RT. بواسطة الشفط، وإزالة العازلة permeabilization ويغسل ثلاث مرات مع برنامج تلفزيوني.
    4. كتلة في 500 ميكرولتر من 5٪ ألبومين المصل البقري (BSA) / PBS واحتضان الخلايا لمدة 30 دقيقة في RT. ويمكن تخزين الخلايا في 4 درجات مئوية خلال الليل إذا لزم الأمر.
    5. إعداد تخفيف الأجسام المضادة الأولية. ماصة 200 ميكرولتر من 5٪ BSA / PBS لكل بئر في مخروطي 15 مل (12 بئرا = 2.4 مل) وإضافة 1 ميكرولتر من الأجسام المضادة الأولية لكل مليلتر من 5٪ BSA / PBS اللازمة. إزالة عازلة تمنع عن طريق الشفط والاستغناء عن 200 ميكرولتر من الأجسام المضادة الأولية المخفف إلى كل بئر.
      1. احتضان الخلايا في 1: 1000 المخفف الأجسام المضادة الأولية في 5٪ BSA / برنامج تلفزيوني لمدة 1 ساعة عند RT أو بين عشية وضحاها في 4 درجات مئوية. بعد مرور فترة الحضانة، وغسل خلايا مرتين مع برنامج تلفزيوني.
    6. إعداد التخفيف الضد الثانوية في نفس الحجم من 5٪ BSA / PBS على النحو الوارد أعلاه. إضافة الضد الثانوية بعيدة الحمراء صبغ مترافق باستخدام التخفيف 1: 2000. إضافة بالإضافة إلى ذلك1 ميكروغرام / مل من هويشت صبغ لهذا المزيج. إزالة برنامج تلفزيوني وإضافة 200 ميكرولتر من المزيج إلى كل بئر.
      1. في احتضان RT لمدة 1 ساعة في الظلام. يغسل 3 مرات مع برنامج تلفزيوني، وترك الخلايا في برنامج تلفزيوني، وحماية الخلايا من الضوء باستخدام رقائق. ويمكن تخزين الخلايا في 4 ° C إذا لزم الأمر.
    7. خلايا الصورة في 400X مجموع التكبير على مجهر epifluorescence مقلوب مع الطول الموجي الإثارة 594-650 نانومتر.

    6. الغربية التنشيف

    1. غسل الخلايا من 3.6 مرتين مع الثلج الباردة PBS. على الجليد، والخلايا ليز مع 50 ميكرولتر من 1X RIPA المخزن المؤقت تستكمل مع 1X كوكتيل مثبط البروتياز.
    2. لست] صخرة في 4 درجات مئوية لمدة 15 دقيقة، وجمع لست] إلى أنابيب 1.5 مل، وأجهزة الطرد المركزي بسرعة عالية (20000 x ج) لمدة 5 دقائق لتوضيح العينات. لست] خلية يمكن تخزين على المدى الطويل في -80 ° C إذا لزم الأمر.
    3. قياس البروتين الكلي باستخدام مقايسة برادفورد وقسامة مبلغ مساو من البروتين في الجديدة 1.5 مل أنابيب microcentrifuge. برينز العينات إلى حجم مساو باستخدام العازلة RIPA والعازلة تحميل 3X Laemmli تستكمل مع 2-المركابتويثانول.
    4. احتضان العينات في 1X Laemmli العازلة تحميل عينة لمدة 5 دقائق في درجة حرارة 95 درجة مئوية، وتشغيل SDS-PAGE باستخدام 4-12٪ تريس، جليكاين هلام في 200 V لمدة 45 دقيقة. مبلغ يتراوح البروتين تحميل اعتمادا على خط الخلية. في بعض الحالات، هناك حاجة إلى 50-100 ميكروغرام من البروتين الكلي للكشف عن كادهيرين E في خطوط الخلايا الوسيطة.
    5. نقل البروتينات على غشاء النيتروسليلوز لمدة 2 ساعة عند 50 V في المخزن نقل 1X تريس جليكاين.
    6. غشاء كتلة لمدة 1 ساعة في درجة حرارة الغرفة أو بين عشية وضحاها في 4 درجات مئوية في منطقة عازلة تمنع مقرها BSA.
    7. تمييع الأجسام المضادة الأولية في 1: 1000 التركيز في 5 مل من العازلة حظر، إضافة التخفيف على الغشاء، واحتضان مع هزاز لطيف لمدة 1 ساعة في درجة حرارة الغرفة أو بين عشية وضحاها في 4 درجات مئوية. غسل غشاء 3 مرات في برنامج تلفزيوني مع 0.05٪ توين-20.
    8. احتضان الأغشية لمدة 1 ساعة على RT مع الأشعة تحت الحمراء secondar يقترن الفلورسنتذ الأجسام المضادة في 1: 20000 التخفيف في عرقلة العازلة على النحو الوارد أعلاه.
    9. غسل غشاء مرتين في برنامج تلفزيوني مع 0.05٪ توين 20 ثم مرة واحدة في برنامج تلفزيوني.
    10. صورة غشاء باستخدام معيار الكشف عن مضان الأشعة تحت الحمراء.

    7. فحوصات النمو المستقل مرسى

    ملاحظة: للحصول على لينة بروتوكول فحص أجار مفصل، انظر 28.

    1. دافئ معقم وسائل الإعلام 2X DMEM إلى 42 درجة مئوية في حمام الماء الساخن. خلال هذا الوقت، الحرارة قبل تعقيمها 1٪ الاغاروز في الميكروويف لمدة 3 دقائق. الميكروويف لمدة 30 ثانية إضافية في وقت حسب الحاجة أو حتى ذاب تماما. نقل الاغاروز إلى 42 ° C حمام الماء.
    2. وضع أنبوب مخروطي 50 مل في دورق مع 42 ° C المياه في غطاء العقيمة وتخلط 1٪ الاغاروز وسائل الإعلام 2X DMEM في 1: المحاسبة نسبة 1 مقابل 1.5 مل من خليط لكل بئر في لوحة 6 جيدا. نستعد دائما خارج DMEM / الاغاروز لحساب الخطأ pipetting لوتجنب الفقاعات.
    3. يضاف خليط لجوانب من البئر، وضمان عدم وجود فقاعات تشكل واسمحوا الوقوف لمدة 30 دقيقة في RT.
    4. في حين أن الطبقة السفلية وبدمج وإعداد كل مجموعة من الخلايا RD transfected في الخطوة 3 بواسطة الشفط وسائل الإعلام وغسل مرة واحدة مع 1 مل PBS. نضح PBS وإضافة 0.2 مل من 0.05٪ التربسين واحتضان عند 37 درجة مئوية لمدة 5 دقائق.
    5. تحييد التربسين في 0.8 مل من وسائل الإعلام والخلايا يسحن لتشكيل تعليق وحيد الخلية. نقل تعليق خلية إلى أنبوب مخروطي 15 مل.
    6. عد الخلايا وحساب حجم تعليق الخلية المطلوبة ل10000 خلايا لكل بئر.
    7. تسخين 0.6٪ الاغاروز في الميكروويف لمدة 3 دقائق تليها 30 ثانية في كل مرة حتى ذاب تماما. نقل الاغاروز إلى 42 ° C حمام الماء.
    8. وضع أنبوب مخروطي 50 مل في دورق مع 42 ° C المياه في غطاء العقيمة. خلط 0.6٪ الاغاروز وتعليق خلية المخفف في نسبة 1: 1 لإعداد 1.5 مل من خليط لكل بئر في لوحة 6 جيدا. دائما إعداد تعليق خلية إضافية / الاغاروز مزيج لحساب الخطأ pipetting لولتجنب الفقاعات.
      ملاحظة: من المهم للعمل في 42 ° C هنا. إذا كانت درجة الحرارة منخفضة جدا الخليط سوف يصلب قبل الطلاء، وسوف درجات حرارة أعلى من 42 درجة مئوية يؤثر على بقاء الخلية.
    9. مزيج جيد من قبل الطحن خلايا عدة مرات ويضاف خليط الخلية إلى الآبار، وضمان أي شكل فقاعات، والسماح ترسيخ لمدة 20 دقيقة في RT.
    10. إضافة 2 مل من وسائل الإعلام تستكمل إلى كل بئر ونقل لوحات الحاضنة.
      1. تغيير وسائل الإعلام مرة واحدة في الأسبوع لمدة 3-4 أسابيع أو حتى شكل مستعمرات متعددة الخلايا. كن حذرا لتجنب لمس آغار عند إزالة وسائل الإعلام التي تطلع فراغ. بدلا من ذلك، استخدم P1000 لإزالة الطبقة العليا السائلة وسائل الإعلام.
      2. وصمة عار لوحات أجار لينة وذلك بإضافة 200 ميكرولتر من محلول كلوريد نيترو الأزرق نتروبلو (1 ملغ / مل في برنامج تلفزيوني)، واحتضان لوحة بين عشية وضحاها في 37 ° C. استبدال وسائل الإعلام في اليوم التالي مع PBS للتصوير.
      3. آبار الصورة في 40X التكبير الكلي على مجهر مقلوب.
      4. إجراء تحليل على يماغيج لمنطقة مستعمرة والعدد. مؤامرة تعني عدد مستعمرة مكررات البيولوجية ± الانحراف المعياري.

    Subscription Required. Please recommend JoVE to your librarian.

    Representative Results

    or Start trial to access full content. Learn more about your institution’s access to JoVE content here

    مخطط لتحريض MET في خلايا الورم اللحمي

    ويرد الجدول الزمني العام لتحريض التغييرات MET تشبه في خلايا الورم اللحمي في الشكل 1. يبدأ البروتوكول من قبل transducing GRHL2 (الشكل 1A)، تليها ترنسفكأيشن من عائلة مير 200 (الشكل 1B). كان GRHL2 أو مير 200 أفراد الأسرة غير قادرة على التأثير على مظهر الخلايا RD عندما أعرب وحدها، ولكن التعبير خارج الرحم من GRHL2 ومير-200S معا النتائج في التغيرات المورفولوجية مثل الظهارية في الخلايا RD. خلايا الانتقال من شكل على شكل مغزل لمظهر أكثر تنوعا مع زيادة الاتصال خلية خلية (الشكل 1C).

    تحريض التغييرات MET تشبه في خلايا الورم اللحمي

    التغيير الصرفي في الخلايا RD على GRHL2 ومير-200الإفراط في التعبير رافقه upregulation من الظهارية علامة E-كادهيرين (الشكل 2A). إضافة مير-200S upregulated E-كادهيرين وحدها، ولكن الجمع بين مير-200S وGRHL2 overexpression تعزيز تآزر E-كادهيرين التعبير (الشكل 2A، ليس تسجيل نطاق). وبالإضافة إلى ذلك، كانت هناك زيادة في تقاطعات خلية خلية من جزيئات الالتصاق الظهاري، EpCAM وTJP1، السهام البيضاء (المعروف أيضا باسم النطيقة زونا 1، ZO-1) (الشكل 2B).

    الحث الأرصاد يقلل من قدرة تشكيل مستعمرة من خلايا الورم اللحمي

    ورافق Upregulation من البروتينات الظهارية التي كتبها downregulation جينات الوسيطة Zeb1 وNotch1 (الشكل 3A)، والتي تعرف أهداف لمير-200. تخفيض تحريض MET نمو مستقل مرسى الخلايا RD مقاسا عدد مستعمرة (الشكل 3B). هذا غرووث ويعزى تثبيط من قبل مير-200S وحدها. كما overexpression من GRHL2 أدى إلى زيادة في نمو مستقل مرسى (الشكل 3). وهذا يتفق مع التقارير السابقة التي تبين التعبير GRHL2 يدفع النمو المستقل مرسى 22.

    شكل 1
    الشكل 1: الجدول الزمني للتحريض MET مع GRHL2 الإفراط في التعبير ومير 200 ترنسفكأيشن. (A) الجدول الزمني للخارج الرحم الإفراط في التعبير عن GRHL2 في الخلايا المستهدفة. (B) الجدول الزمني للMET تحريض عبر ترنسفكأيشن العكسي من أفراد الأسرة مير 200 في الخلايا المستهدفة. (C) GRHL2 ومير 200 الإفراط في التعبير أدت إلى تغييرات في التشكل من الخلايا المستهدفة بما يتفق مع MET. شريط مقياس = 75 ميكرومتر الرجاء انقر هنالعرض نسخة أكبر من هذا الرقم.

    الشكل 2
    الشكل 2: وبالتزامن الإفراط في التعبير عن GRHL2 ومير-200S أدى إلى MET في الخلايا الهدف. أدى (A) التعبير عن مير-200S إلى ارتفاع التعبير عن كادهيرين E بينما أنتجت التعبير مجتمعة GRHL2 ومير-200S تأثير متناغم على التعبير E-كادهيرين في كل من مرنا (القيم يعني ± الانحراف المعياري) ومستويات البروتين. (B) التعبير جنبا إلى جنب من GRHL2 ومير-200S أدى إلى زيادة تعبير عن EpCAM وTJP1 في الاتصالات خلية خلية (السهام). شريط مقياس = 20 ميكرومتر. * يشير ف <0.05 تحليلها باستخدام ANOVA مع الرقم تم بعد خاصة correction.This توكي لتعديل من إشارة 24. الجمعية الأمريكية © حقوق التأليف والنشر لعلم الأحياء الدقيقة، الجزيئية بيولوجيا الخلية، وحجم 36، العدد 19، 2503-2513، 2016. الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم.

    الشكل (3)
    الشكل (3): التعبير عن مير-200S يقمع الوسيطة علامات ويقلل النمو مرسى مستقل في خلايا الورم اللحمي. مستعمل تعبير عن مير-200S لكن ليس GRHL2 Zeb1 وNotch1 مرنا التعبير (القيم يعني ± الانحراف المعياري) - (A) أكثر. (B) الإفراط في التعبير عن مير-200S لكن ليس GRHL2 المقاومة anoikis تثبيط الخلايا في الورم اللحمي. وتظهر الصور التمثيلية للمستعمرات الملون (مقياس بار = 200 ميكرون) والكمي لعدد مستعمرة (القيم يعني ± الانحراف المعياري). * يشير ف <0.05 تحليلها باستخدام ANOVA مع الرقم بعد خاصة correction.This توكي قد تم تعديلها من صeference 24. جميع الحقوق محفوظة © الجمعية الأمريكية لعلم الأحياء الدقيقة، الجزيئية بيولوجيا الخلية، وحجم 36، العدد 19، 2503-2513، 2016. يرجى النقر هنا لمشاهدة نسخة أكبر من هذا الرقم.

    الشكل (3)
    فيديو التكميلي: خلايا RD معربا عن ناقلات فارغة وmiRNAs سيطرة سلبية. تم تجميع ملفات الفيديو من الصور من الخلايا RD transfected مع ناقلات فارغة وmiRNAs السيطرة السلبية المكتسبة كل ساعتين باستخدام التصوير الخلية الحية الآلي. الرجاء انقر هنا لمشاهدة هذا الفيديو. (انقر بزر الماوس الأيمن للتحميل.)

    الشكل (3) />
    تكميلية فيديو 2: خلايا RD يعرب GRHL2-EGFP وmiRNAs تحكم السلبية. تم تجميع ملفات الفيديو من الصور من الخلايا RD transfected مع GRHL2-EGFP وmiRNAs السيطرة السلبية المكتسبة كل ساعتين باستخدام التصوير الخلية الحية الآلي. الرجاء انقر هنا لمشاهدة هذا الفيديو. (انقر بزر الماوس الأيمن للتحميل.)

    الشكل (3)
    تكميلية فيديو 3: خلايا RD التعبير عن ناقلات الخالي وmiR200 miRNAs. تم تجميع ملفات الفيديو من الصور من الخلايا RD transfected مع ناقلات فارغة وmiR200 miRNAs حصلت كل ساعتين باستخدام التصوير الخلية الحية الآلي. الرجاء انقر هنا لمشاهدة هذا الفيديو. (انقر بزر الماوس الأيمن للتحميل.)

    الإقليم الشمالي "FO: المحافظة على together.within الصفحات =" 1 "> الشكل (3)
    تكميلية الفيديو 4: خلايا RD يعرب GRHL2-EGFP وmiR200 miRNAs. حصلت جمعت من صور لخلايا RD transfected مع GRHL2-EGFP وmiR200 miRNAs فيديو كل ساعتين باستخدام التصوير الخلية الحية الآلي. الرجاء انقر هنا لمشاهدة هذا الفيديو. (انقر بزر الماوس الأيمن للتحميل.)

    Subscription Required. Please recommend JoVE to your librarian.

    Discussion

    or Start trial to access full content. Learn more about your institution’s access to JoVE content here

    الأورام اللحمية هي سرطانات نادرة، ولكن شديدة العدوانية من النسب الوسيطة. وعلى الرغم من نسبهم الوسيطة، تظهر مجموعة فرعية من الأورام اللحمية للخضوع لعملية انتقال المظهري إلى حالة أكثر مثل الظهارية. هذا التبديل MET تشبه له أهمية النذير، والمرضى الذين يعانون من أكثر الأورام الظهارية مثل أقل عدوانية 24. وعلى الرغم من أهميتها السريرية، هناك عدد قليل من الدراسات التي تتناول الآليات الجزيئية يقود هذه التحولات المظهرية في الأورام اللحمية.

    لدراسة التحولات MET تشبه في خلايا الورم اللحمي، وقد وضعنا نموذجا MET-الاستقراء من خلال الجمع بين التعبير من العوامل الظهارية GRHL2 والأسرة مير-200. هذا الأسلوب يدفع بسرعة خلايا الورم اللحمي لتصبح أكثر الظهارية مثل مقاسا تغييرات في الشكل والتعبير الجيني. باستخدام هذا البروتوكول للحث على MET في خلايا الورم اللحمي يسهل دراسة تأثير هذه التحولات على الظواهر التي تدفع ساركوما العدوان، هذاكما الهجرة والغزو وانتشارها ومقاومة الموت وكيف أن كل هذه التغييرات في علم الأحياء يمكن أن تؤثر على مقاومة المخدرات.

    في سياق سرطان المستمدة الظهارية والتعبير عن عامل الوسيطة واحد غالبا ما يكون كافيا للحث على EMT 14. ومع ذلك، في هذا النموذج المشتق من ساركوما من MET التعبير عن عاملين الظهارية، GRHL2 ومير-200S، مطلوبة. ومن المثير للاهتمام، وكان مير-200S وحده له تأثير أقوى على معظم المؤشرات الحيوية للMET من GRHL2، في حين كان GRHL2 قادرة على تنشيط الجينات بقوة الظهارية إلا في وجود القمع أساس مير 200 من repressors الجينات الظهارية، مثل ZEB1 24. ومن الممكن أن يكون لبعض أنواع الخلايا الوسيطة الجينات الظهارية يجب أن تكون كل من دي قمع (على سبيل المثال عن طريق مير-200S) وتنشيط (على سبيل المثال عن طريق GRHL2) لدفع MET.

    لقد شهدنا تفاوت في مستويات التعبير GRHL2 عبر سل مختلفةخطوط لتر. للتغلب على هذا، استخدمنا التعبير البلازميد GRHL2 أن تعرب عن EGFP 25 لترتيب النتائج بحسب التدفق الخلوي خلايا إيجابية EGFP قبل التجارب. ومن الأهمية بمكان أيضا لصحة وظائف مير-200S وGRHL2 في أنواع مختلفة من الخلايا. وينظر EMT كطيف على أساس التعبير عن الظهارية والجينات المرتبطة الوسيطة، التي يمكن أن يكون الاختلاف تعتمد على السياق على أساس خط الخلية، نوع السرطان، والعلاج، الخ لذلك، قمنا بتحليل خمس الجينات التي ينظمها مير-200 أو GRHL2 ل مراعاة التغييرات التي تعتمد على السياق الخلية. تحذير آخر من هذا الاختبار هو الاعتماد على ترنسفكأيشن عابر مير-200S لMET الاستقراء. وهكذا، يمكن أن التجارب على المدى الطويل تصبح مكلفة ومعقدة عندما تصبح متعددة تكرار تعداء اللازم. هذا يمكن التغلب عليها باستخدام البلازميدات التعبير مير-200.

    وأفادت دراسات أخرى أيضا أدلة على MET في الأورام اللحمية. على سبيل المثال، لوحظ MET في مجموعة فرعية من leiomyosaوارتبط rcomas ومع بقاء أفضل للمرضى. ميكانيكيا، يانغ وآخرون. وجدت أن في ساركومة عضلية ملساء خط الخلية تثبيط سبيكة مع سيرنا كانت كافية للحث على MET مثل التغيرات 29. وبالمثل، ونضوب بعد عامل الوسيطة آخر، الحلزون، في الخلايا الجذعية الوسيطة خفض تشكيل ساركوما في الفئران 30. وهكذا، يبدو واضحا من الأدب أن هناك مسارات متعددة إلى النمط الظاهري MET مثل، والتي قد تختلف من نوع من الخلايا. في حين أن هذا ليس هو السبيل الوحيد للحث على MET، وقد استخدمنا لدينا وسيلة للحث على MET في نوعين فرعيين ساركوما، بما في ذلك العضلية المخططة (خلايا RD) وعظمية (143B الخلايا). في المستقبل، سيكون من المثير للاهتمام أن مقارنة هذه أساليب مختلفة في مجموعة واسعة من خلايا الورم اللحمي. على سبيل المثال، لا بعض الأنواع الفرعية ساركوما لها تغيرات وراثية أو جينية الأساسية التي تجعلها أكثر أو أقل عرضة للMET تحريض؟

    تحديد تأثير METعلى مجموعة متنوعة من مخرجات البيولوجية في خلايا الأورام اللحمية يمكن توفير فهم أفضل لماذا المرضى الذين يعانون من أكثر الأورام اللحمية مثل الظهارية لديهم تحسن أحوال الطقس. وبالإضافة إلى ذلك، فهم تأثير العلاج على قيادة التحولات المظهرية بين الدول من شأنه تعميق التفاهم البيولوجي لدينا وإعلام على الاستجابة للعلاجات الحالية لدى مرضى ساركوما.

    Subscription Required. Please recommend JoVE to your librarian.

    Disclosures

    الكتاب ليس لديهم ما يكشف.

    Acknowledgments

    يعترف JAS بدعم من معهد ديوك السرطان، وجامعة ديوك التناسلي البولي مختبر علم الأورام، وقسم جراحة العظام جامعة دوق. وأيد HL من قبل مؤسسة العلوم الوطنية (NSF) مركز الفيزياء البيولوجية النظرية (NSF PHY-1427654) وNSF DMS-1361411، ونتيجة لCPRIT (الوقاية من السرطان ومعهد بحوث تكساس) الباحث في مركز أبحاث السرطان في ولاية تكساس في جامعة رايس. وأيد KEW من قبل المعاهد الوطنية للصحة F32 CA192630 MKJ واستفاد HL من مناقشات مفيدة مع ماري C فارش-كارسون، JN Onuchic، سمير M هاناش، كينيث J بيينتا، ودونالد S. كوفي.

    Materials

    Name Company Catalog Number Comments
    Countess automated counter Life technologies AMQAX1000
    Countess cell counting chamber slides Invitrogen C10283
    SimpliAmp Thermal Cycler Thermo Fisher A24811
    Odyssey Fc LI-COR Inc
    ViiA7 Real Time PCR System Thermo Fisher 4453536
    PCR microplate Corning 321-29-051
    KAPA SYBR Fast Universal qPCR Kit KAPA Biosystems KK4602
    Starting Block (PBS) Blocking Buffer Thermo Fisher 37538 BSA-based blocking buffer
    Agarose General Purpose LE Genesee Scientific 20-102
    10x Tris/Glycine/SDS Buffer Bio-Rad Laboratories Inc 161-0732 Running buffer
    10x Tris/Glycine Buffer Bio-Rad Laboratories Inc 161-0734 Transfer buffer
    RIPA Buffer Sigma Life Sciences SLBG8489
    Amersham Protran 0.45 μm nitrocellulose GE Healthcare Lifesciences 10600012
    Quick-RNA MiniPrep Kit Genesee Scientific 11-358
    Laemmli Sample Buffer (4X) Bio-Rad Laboratories Inc 1610747
    Mini Trans-Blot Cell Bio-Rad Laboratories Inc 1703930
    Mini-Protean Tetra Cell Bio-Rad Laboratories Inc 1658005EDU
    DPBS Life technologies 14190-144
    0.05% Trypsin-EDTA Life technologies 11995-065
    DMEM Life technologies 11995-065
    Lipofectamine RNAi Max Thermo Fisher 13778150
    Lipofectamine 2000 Ragents Thermo Fisher 11668019
    Penicillin Streptomycin Life technologies 15140-122
    miRVana miRNA mimic negative control #1 Thermo Fisher 4464058 neg miRNA
    hsa-miR-200 mirVana miRNA mimic Thermo Fisher 4464066 miR200A
    has-miR-200 mirVana miRNA mimic Thermo Fisher 4404066 miR200B
    has-miR-200 mirVana miRNA mimic Thermo Fisher 4404066 miR200C
    Opti-MEM Life technologies 11088-021 serum-free media
    anti-Ecadherin antibody BD Bioscience 610182
    anti-beta actin Santa Cruz Biotechnology sc-69879
    anti-EpCam Ab Serotec MCA18706
    anti-ZO1 Invitrogen 402200
    IRDye 800W LI-COR Inc 925-32210
    IRDye 680 LI-COR Inc 926-32223
    anti-mouse AlexaFluor 647 Thermo Fisher A211241
    anti-rabbit AlexaFluor 647 Thermo Fisher ab150075
    Halt Protease and Phosphatesse Inhibitor Thermo Fisher 1861281
    Precision Plus Protein Dual Color Bio-Rad Laboratories Inc 161-0374
    Partec CellTrics Sysmex 04-004-2326 30 μm filter for flow
    GAPDH-F IDT AGCCACATCGCTCAGACAC
    GAPDH-R IDT GCCCAATACGACCAAATCC
    Ecadherin-F IDT TGGAGGAATTCTTGCTTTGC
    Ecadherin-R IDT CGCTCTCCTCCGAAGAAAC
    ZEB1-F IDT GCATACAGAACCCAACTTGAACGTC
    ZEB1-R IDT CGATTACACCCAGACTGC
    NOTCH-F IDT GGCAATCCGAGGACTATGAG
    NOTCH-R IDT CTCAGAACGCACTCGTTGAT
    nitro blue tetrazolium  Sigma N5514
    hexadimethrine bromide Sigma H9268 polybrene
    3 mL syringe BD Bioscience 309657
    Sterile syringe filter VWR 28145-505
    5mL polypropylene round-bottom tube 352063 flow cytometry tubes
    High-Capacity cDNA Reverse Transcription Kit Thermo Fisher 4368814 reverse transcription kit
    4% paraformaldyhyde Santa Cruz Biotechnology sc-281612
    Triton-X100 Sigma 93443
    bovine serum albumin Sigma A7906

    DOWNLOAD MATERIALS LIST

    References

    1. Weber, C. E., Li, N. Y., Wai, P. Y., Kuo, P. C. Epithelial-mesenchymal transition, TGF-beta, and osteopontin in wound healing and tissue remodeling after injury. J Burn Care Res. 33, (3), 311-318 (2012).
    2. Galichon, P., Finianos, S., Hertig, A. EMT-MET in renal disease: should we curb our enthusiasm. Cancer Lett. 341, (1), 24-29 (2013).
    3. Carew, R. M., Wang, B., Kantharidis, P. The role of EMT in renal fibrosis. Cell Tissue Res. 347, (1), 103-116 (2012).
    4. Willis, B. C., Borok, Z. TGF-beta-induced EMT: mechanisms and implications for fibrotic lung disease. Am J Physiol Lung Cell Mol Physiol. 293, (3), L525-L534 (2007).
    5. Ye, X., Weinberg, R. A. Epithelial-Mesenchymal Plasticity: A Central Regulator of Cancer Progression. Trends Cell Biol. 25, (11), 675-686 (2015).
    6. Li, L., Li, W. Epithelial-mesenchymal transition in human cancer: comprehensive reprogramming of metabolism, epigenetics, and differentiation. Pharmacol Ther. 150, 33-46 (2015).
    7. Tsai, J. H., Yang, J. Epithelial-mesenchymal plasticity in carcinoma metastasis. Genes Dev. 27, (20), 2192-2206 (2013).
    8. Bitting, R. L., Schaeffer, D., Somarelli, J. A., Garcia-Blanco, M. A., Armstrong, A. J. The role of epithelial plasticity in prostate cancer dissemination and treatment resistance. Cancer Metastasis Rev. 33, (2-3), 441-468 (2014).
    9. Schaeffer, D., Somarelli, J. A., Hanna, G., Palmer, G. M., Garcia-Blanco, M. A. Cellular Migration and Invasion Uncoupled: Increased Migration Is Not an Inexorable Consequence of Epithelial-to-Mesenchymal Transition. Mol Cell Biol. 34, (18), 3486-3499 (2014).
    10. Mathow, D., et al. Zeb1 affects epithelial cell adhesion by diverting glycosphingolipid metabolism. EMBO Rep. 16, (3), 321-331 (2015).
    11. Ware, K. E., et al. A mechanism of resistance to gefitinib mediated by cellular reprogramming and the acquisition of an FGF2-FGFR1 autocrine growth loop. Oncogenesis. 2, e39 (2013).
    12. Yauch, R. L., et al. Epithelial versus mesenchymal phenotype determines in vitro sensitivity and predicts clinical activity of erlotinib in lung cancer patients. Clin Cancer Res. 11, (24 Pt 1), 8686-8698 (2005).
    13. Jolly, M. K., et al. Towards elucidating the connection between epithelial-mesenchymal transitions and stemness. J R Soc Interface. 11, (101), 20140962 (2014).
    14. Mani, S. A., et al. The epithelial-mesenchymal transition generates cells with properties of stem cells. Cell. 133, (4), 704-715 (2008).
    15. Chen, L., et al. Metastasis is regulated via microRNA-200/ZEB1 axis control of tumour cell PD-L1 expression and intratumoral immunosuppression. Nat Commun. 5, 5241 (2014).
    16. Nicolazzo, C., Gradilone, A. Significance of circulating tumor cells in soft tissue sarcoma. Anal Cell Pathol (Amst). 697395 (2015).
    17. Somarelli, J. A., et al. Mesenchymal-epithelial transition in sarcomas is controlled by the combinatorial expression of miR-200s and GRHL2. Mol Cell Biol. (2016).
    18. Bae, Y. K., Choi, J. E., Kang, S. H., Lee, S. J. Epithelial-Mesenchymal Transition Phenotype Is Associated with Clinicopathological Factors That Indicate Aggressive Biological Behavior and Poor Clinical Outcomes in Invasive Breast Cancer. J Breast Cancer. 18, (3), 256-263 (2015).
    19. Humphries, B., Yang, C. The microRNA-200 family: small molecules with novel roles in cancer development, progression and therapy. Oncotarget. 6, (9), 6472-6498 (2015).
    20. Renner, M., et al. MicroRNA profiling of primary high-grade soft tissue sarcomas. Genes Chromosomes Cancer. 51, (11), 982-996 (2012).
    21. Petrof, G., et al. Mutations in GRHL2 result in an autosomal-recessive ectodermal Dysplasia syndrome. Am J Hum Genet. 95, (3), 308-314 (2014).
    22. Werner, S., et al. Dual roles of the transcription factor grainyhead-like 2 (GRHL2) in breast cancer. J Biol Chem. 288, (32), 22993-23008 (2013).
    23. Werth, M., et al. The transcription factor grainyhead-like 2 regulates the molecular composition of the epithelial apical junctional complex. Development. 137, (22), 3835-3845 (2010).
    24. Somarelli, J. A., et al. Mesenchymal-Epithelial Transition in Sarcomas Is Controlled by the Combinatorial Expression of MicroRNA 200s and GRHL2. Mol Cell Biol. 36, (19), 2503-2513 (2016).
    25. Varma, S., et al. The transcription factors Grainyhead-like 2 and NK2-homeobox 1 form a regulatory loop that coordinates lung epithelial cell morphogenesis and differentiation. J Biol Chem. 287, (44), 37282-37295 (2012).
    26. Pruitt, S. C., Mielnicki, L. M., Stewart, C. C. Analysis of fluorescent protein expressing cells by flow cytometry. Methods Mol Biol. 263, 239-258 (2004).
    27. Zhao, Z., et al. A high-content morphological screen identifies novel microRNAs that regulate neuroblastoma cell differentiation. Oncotarget. 5, (9), 2499-2512 (2014).
    28. Borowicz, S., et al. The soft agar colony formation assay. J Vis Exp. (92), e51998 (2014).
    29. Yang, J., et al. Integrated proteomics and genomics analysis reveals a novel mesenchymal to epithelial reverting transition in leiomyosarcoma through regulation of slug. Mol Cell Proteomics. 9, (11), 2405-2413 (2010).
    30. Alba-Castellon, L., et al. Snail1 expression is required for sarcomagenesis. Neoplasia. 16, (5), 413-421 (2014).
    31. Takaishi, M., Tarutani, M., Takeda, J., Sano, S. Mesenchymal to Epithelial Transition Induced by Reprogramming Factors Attenuates the Malignancy of Cancer Cells. PLoS One. 11, (6), e0156904 (2016).

    Erratum

    Formal Correction: Erratum: Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells
    Posted by JoVE Editors on 07/03/2018. Citeable Link.

    An erratum was issued for: Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells. An author name was updated.

    One of the authors' names was corrected from:

    Shenghan Xu

    to:

    Shengnan Xu

    تحريض الوسيطة-طلائي التحولات في خلايا الورم اللحمي
    Play Video
    PDF DOI DOWNLOAD MATERIALS LIST

    Cite this Article

    Ware, K. E., Gilja, S., Xu, S., Shetler, S., Jolly, M. K., Wang, X., Bartholf Dewitt, S., Hish, A. J., Jordan, S., Eward, W., Levine, H., Armstrong, A. J., Somarelli, J. A. Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells. J. Vis. Exp. (122), e55520, doi:10.3791/55520 (2017).More

    Ware, K. E., Gilja, S., Xu, S., Shetler, S., Jolly, M. K., Wang, X., Bartholf Dewitt, S., Hish, A. J., Jordan, S., Eward, W., Levine, H., Armstrong, A. J., Somarelli, J. A. Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells. J. Vis. Exp. (122), e55520, doi:10.3791/55520 (2017).

    Less
    Copy Citation Download Citation Reprints and Permissions
    View Video

    Get cutting-edge science videos from JoVE sent straight to your inbox every month.

    Waiting X
    simple hit counter