Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Developmental Biology

אינדוקציה של מעברי אפיתל- mesenchymal בתאי סרקומה

doi: 10.3791/55520 Published: April 7, 2017

ERRATUM NOTICE

Summary

אנו מציגים כאן שיטה תרבית תאים עבור גרימת מעברים-אפיתל mesenchymal (MET) בתאים סרקומה מבוסס על ביטוי אקטופי בשילוב של בני המשפחה microRNA-200 ו grainyhead דמוי 2 (GRHL2). שיטה זו מתאימה יותר להבנת ההשפעה הביולוגית של גמישות פנוטיפית על תוקפנות הסרטן וטיפולים.

Abstract

גמישות פנוטיפית מתייחסת לתופעה שבה תא להשיג זמני תכונות של שושלת אחרת. במהלך התקדמות קרצינומה, גמישות פנוטיפית שמניע הפלישה, הפצת גרורות. ואכן, בעוד רוב המחקרים של גמישות פנוטיפית כבר בהקשר של קרצינומות נגזרות האפיתל, מתברר סרקומות, אשר המזנכימה במקורו, גם להפגין גמישות פנוטיפית, עם תת-קבוצה של סרקומות עוברת תופעה דומה mesenchymal- מעבר אפיתל (MET). הנה, פיתחנו שיטה המרכיבות את המשפחה miR-200 ו grainyhead דמוי 2 (GRHL2) לחקות תופעה זו נתקלה דמוי שנצפתה החולה סרקומה samples.We ברצף להביע GRHL2 ומשפחת miR-200 באמצעות התמרה התא transfection, בהתאמה , כדי להבין את הבסיס המולקולרי טוב יותר של מעברים פנוטיפי אלה בתאי סרקומה. תאי סרקומה להביע miR-200s ו GRHL2 הפגינו characterist האפיתל משופרICS במורפולוגיה התא ושינוי של סמנים ביולוגיים אפיתל mesenchymal. מחקרים עתידיים באמצעות שיטות אלה ניתן להשתמש כדי להבין את ההשלכות פנוטיפי טוב יותר של תהליכים MET-כמו על תאי סרקומה, כגון הגירה, פלישה, נטייה גרורתי, והתנגדות טיפול.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

גמישות פנוטיפית מתייחסת מעבר הפיך בין פנוטיפים הסלולר, והוא מחולק בדרך כלל לשני סוגים, האפיתל אל המזנכימה (EMT) מעברים מעברי המזנכימה אל האפיתל (MET). גמישות פנוטיפית זה ממלא תפקיד חשוב בתהליכים נורמליים של יצורים רב-תאיים, כגון פיתוח ריפוי פצעים 1; עם זאת, מסלולים אותם ותוכניות ביטוי גנים יכולים גם לגרום למחלות, כגון סיסטיק (הנסקרת ב 2, 3, 4) וגרורות קרצינומה (הנסקרת ב אזכור 5, 6, 7, 8). במהלך גרורות, למשל, EMT משבש קוטביות בתא, תאי תאי אינטראקציות, ומקדמת פלישה 9, 10. יחד, EMT לתרוםהים למדינה פנוטיפי המאפשר הפצת תאים סרטניים. בנוסף, EMT גם מוביל שורה של שינויים פנוטיפי אחרים שמניעים פנוטיפ אגרסיבי, כולל הסרת הפיקוח של מטבוליזם תאי סרטן 6, התפתחות עמידות לתרופות 11, 12, יכולת גידול-ייזום מוגברת 13, 14 ו לארח התחמקות החיסון 15.

גמישות פנוטיפית נחקרה היטב להתקדמות קרצינומה; עם זאת, סרקומות גם להפגין גמישות פנוטיפית. מעניין, נראה כאילו חלק מאותם נהגים של גמישות פנוטיפית בקרצינומות גם לתרום פלסטיות סרקומה ואגרסיביות. למשל, בתאי הגידול במחזור (CTCs) מחולים סרקומה הוכחו להביע EpCAM, חלבון על פני התא שנמצא בדרך כלל ב- תאי האפיתל 16. Additionally, 250 דגימות סרקומה של רקמות רכות סווגו בתור אפיתל דמוי או המזנכימה דמוי מבוסס על ביטוי גנים. מטופלי החתימה ביומרקרים דמוי אפיתל היה פרוגנוזה טוב יותר מאשר חולה עם החתימה ביומרקרים דמוי המזנכימה 17. זה עולה בקנה אחד עם קרצינומה רב, בם חולה עם יותר קרצינומות דמויות אפיתל יש תוצאות טובות יותר בהשוואה לחולים עם גידולים המזנכימה דמוית יותר 18.

בעוד שחלק סרקומות להציג סמנים ביולוגיים ומסלולי ביטוי גנים עקביים עם MET, את הבסיס המולקולרי של גמישות פנוטיפית זה להישאר ממעטים להבין. כדי לחקור את המנגנונים ואת הנהגים של נפגשו סרקומה פיתחנו מודל של אינדוקציה MET באמצעות שני גורמים ספציפיים אפיתל, microRNA (Mir) -200 בני משפחה grainyhead דמוי 2 (GRHL2). מיר-200s הם משפחה של RNA ללא קידוד קטן המווסתים ביטוי גנים באמצעות קשירה 3' UTRs של messenger RNA ותרגום מניעה לתוך חלבון. משפחת miR-200 מורכבת משתי קבוצות משנה - אחד המכיל miR-141 לבין מיר-200a, והשני כולל miR-200B, miR-200C, ומיר-429. בני משפחת miR-200 מועשרים ברקמות האפיתל, ואת אובדן miR-200s קשורה גרורות קרצינומה 19. משפחת miR-200 הוא downregulated גם סרקומות של רקמות רכות לעומת הרקמות הבריאות 20. בדומה מיר-200s, GRHL2 הוא הרגולטור, כי הוא מפתח חשוב לפיתוח האפיתל 21. גורם שכפול GRHL2 פועל בשתי דרכים כדי upregulate גני האפיתל, כגון E-cadherin: 1) בתאי האפיתל, GRHL2 ישירות מדחיק את רגולטור EMT, ZEB1 22; ו 2) GRHL2 מפעיל תעתיק ישירות של גנים האפיתל 23. החקירות הקודמות שלנו הראו כי ביטוי משולב של miR-200s ו GRHL2 בתאי סרקומהגורם פנוטיפ MET-כמו 24. כאן, אנו מציגים פרוטוקול מפורט כדי ליצור מודל במבחנה של אינדוקציה נפגשו תאי סרקומה באמצעות ביטוי אקטופי של miR-200s ו GRHL2.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. הכנת ריאגנטים

  1. הכן DMEM עבור תרבית תאים על ידי הוספת 50 מ"ל של סרום שור העובר (FBS) ו 5 מ"ל של פניצילין, סטרפטומיצין (5000 U / mL) 500 מ"ל של DMEM. המדיום הזה יכול להיות מאוחסן על 4 מעלות צלזיוס למשך עד שישה חודשים.
  2. Resuspend פריימרים lyophilized במים nuclease ללא לריכוז סופי של 10 מיקרומטר. חנות מחדש מושעה פריימרים ב -20 מעלות צלזיוס.
  3. הכן assay radioimmunoprecipitation (ריפה) חיץ (150 מ"מ NaCl, deoxycholate נתרן 0.5%, 0.1% SDS, 50 מ"מ טריס, pH 8.0). מוסף עם מעכבי פרוטאז קוקטייל לפני השימוש ולשמור חיץ על הקרח כאשר בשימוש. חנות ב 4 מעלות צלזיוס.
  4. הכן 10 מ"ג / מ"ל ​​polybrene (ברומיד hexadimethrine) מסנן מים מזרק כדי לעקר באמצעות מסנן polyethersulfone 0.45 מיקרומטר. פתרון יכול להיות מאוחסן על 4 מעלות צלזיוס למשך עד שישה חודשים.
  5. הכן פתרון 1 מ"ג / מ"ל ​​עובד של כלוריד tetrazolium כחול ניטרו ידי המסת 10 מ"ג ב 10 מ"ל של PBS. חנות ב 4 מעלות צלזיוס.

2. התמרה lentiviral של GRHL2

יום 1

  1. פלייט 3 x 10 5 תאים HEK293T לכל גם צלחת 6-היטב 2 מ"ל של DMEM בתוספת. לכמת תאים באמצעות נגד תא אוטומטי. תאים צריכים להיות 40 - 60% ומחוברות לאחר תרבות לילה בשעה 37 ° C עם 5% CO 2.

יום 2

  1. לדלל 2 מיקרוגרם של וקטור ריק (pCMV-UBC-EGFP) או 2 מיקרוגרם של pCMV-GRHL2-UBC-EGFP 24, 25 ב 200 μL של סרום ללא מדיה יחד עם 1.8 מיקרוגרם של pΔ8.9 ו 0.2 מיקרוגרם של pCMV-VSV פלסמידים עוזר -G. בצינור נפרד, לדלל 4 μL של מגיב transfection השומנים מבוסס ב 200 μL של סרום ללא מדיה לכל transfection (8 μL ב 400 μL עבור שתי דגימות). הוספת 200 μL של תערובת מגיב transfection לכל פתרון פלסמיד דגירה במשך 20 דקות בטמפרטורת החדר.
  2. במהלך אינקובטוריםtion, לשטוף תאים HEK293T ידי הסרת בינוני על ידי שאיפה ואקום ושטיפה תאים עם 1 מ"ל של PBS. החלף את PBS עם 800 μL של סרום ללא מדיה. אחרי 20 דקות, להוסיף 200 μL של מגיב transfection: תערובת פלסמיד מן dropwise צעד 2.2 לכל היטב דגירה תאים עבור 2 שעות ב 37 מעלות צלזיוס ב 5% 2 CO.
  3. מוציאים בזהירות בינוני transfection ידי השאיפה ואקום ולהחליף עם 2 מ"ל של שיושלם DMEM. מחזירים את התאים החממה לתרבות לילה.
    הערה: תאי HEK293T הם חסיד רופף. החלפת מדיה חייבת להתבצע בזהירות כדי להגביל הסרת תאים מהעומק של המנה או בקבוק.

יום 3

  1. רענן התקשורת על תאים HEK293T טרנספקציה וצלחת 3 x 10 5 תאים RD לכל גם צלחת 6-היטב 2 מ"ל של DMEM בתוספת. תאי תרבות הלילה. תאי RD הם קו תא ראדומיוסרקומה אנושי, זמין מסחרי.

יום 4

  • אסוף תקשורת ויראלי מתאי HEK293T. פיפטה DMEM התקשורת מהתאים HEK293T ומקום לתוך חרוטי 15 מ"ל חדש. בזהירות להחליף עם DMEM תקשורת חדשה ותא המקום HEK293T בחזרה בחממה למחרת.
  • להוסיף 2 μL של 10 מ"ג / מ"ל ​​polybrene לכל מ"ל של התקשורת ויראלי לשני צינורות חרוטי חדש 50 מ"ל (אחד עבור transfection וקטור ריק אחר עבור transfection GRHL2). מזרק מסנן התקשורת ויראלי ידי הסרת הבוכנה של מזרק מ"ל 3 ולצרף מסנן 0.45 מיקרומטר polyethersulfone אל קצה.
    1. מוסיף את התקשורת ויראלי שנאספה בשלב 2.6 לתוך החבית של המזרק, לצלול לתוך תקשורת 50 צינורות החרוטים החדשים המ"ל המכילים polybrene. סר מדיה מתאי RD ידי שאיפה ואקום ולהוסיף תקשורת ויראלי מסוננת לתאי RD.
  • יום 5

    1. יום 4. חזרו על תאי HEK293T יכולים להיות מושלכים לאחר בתקשורת ויראלי נאספה.

    יום 7

    1. תאים RD לשטוף עם 1 מ"ל של PBS ולהוסיף 200 μL של טריפסין 0.05% בכל טוב. לדגור על 37 מעלות צלזיוס למשך 5 דקות, להוסיף 2 מ"ל של התקשורת שיושלם, ולעבור ההשעיה לתא חרוטי 15 מ"ל חדש. תאים צנטריפוגה ב 250 XG במשך 5 דקות בטמפרטורת החדר ומדיה לשאוב. גלולה ב 1 מ"ל של DMEM (בתוספת FBS 5% ו 1% פניצילין, סטרפטומיצין).
      הערה: שימוש אחוז גבוה יותר של FBS עלולה לגרום סתימה במהלך cytometry הזרימה
      1. תאי סינון עבור cytometry הזרימה. השתמש פיפטה ליישם את ההשעיה תא 1 מ"ל RD דרך מסנן 30 מיקרומטר לתוך זרימת cytometry צינורות ושפופרות מקום על הקרח.
      2. מיין EGFP + תאים 26 לתוך 1.5 מ"ל צינורות microcentrifuge המכיל 0.5 מ"ל של DMEM בתוספת 10% FBS ו 1% פניצילין, סטרפטומיצין ומניחים על קרח. EGFP פלייט + ממוינים התאים הכולל של 1 מ"ל של DMEM בתוספת לתוך הבאר אחד של צלחת 12-היטב ובמקום בחממה לתרבות.
        ; הערה: התשואה של EGFP + תאי זרימת cytometry לאחר תמרה זו היא בדרך כלל נמוכים (50,000-100,000 תאים). תאים ייתכן שיהיה צורך בתרבית למשך 10 - 14 ימים לפני שתמשיך לשלב 3.

    3. Transfection ההפוך של miR-200s

    1. כן 50 מיקרומטר מניות של מחקת miR-200 באמצעות מחזורי nuclease ללא H 2 O. Aliquot מניות ולאחסן ב -20 ° C, כדי למנוע הקפאת חוזרות / פשרה.
    2. להוסיף 3 μL של כל 50 מיקרומטר miR-200 לחקות (Mir-200a, miR-200B, ומיר-200C) כדי 300 μL של סרום ללא מדיה או 9 μL של 50 מירנה הביקורת השלילית מיקרומטר 300 μL סרום ללא מדיה.
    3. להוסיף 6 μL של מגיב transfection ספציפיים siRNA כדי 600 μL של סרום ללא מדיה ולחלק 300 μL של תערובת זו לשתי צינורות, אחד עבור כל אחד משני תערובות מיר צעד 3.2. מערבבים את 300 μL של כל תערובת מיר צעד 3.2 עם שילוב של 300 μL של מגיב transfection. דגירה של 20 דקות ב חדר temperature.
    4. בעוד דוגרים, להכין ההשעיה תא של 600,000 תאים EGFP + RD להביע EV או GRHL2 נוצר בסעיף 2 ב 2.4 מ"ל (250 תאים / μL) של סרום ללא מדיה לכל טיפול.
    5. בשנת צלחת 24-היטב, להוסיף 100 μL לכל טוב של תערובת miR-200 או לערבב ביקורת שלילית משלב 3.3 לתוך שש בארות, ולאחר מכן להוסיף 400 μL של כל השעית תא לשלוש בארות של כל ערבוב של מיר.
    6. דגירת תאים ב 37 מעלות צלזיוס ב 5% CO 2 לילה ולשנות תקשורת שתושלם במלואו DMEM למחרת. איסוף תאים 2 ימים מאוחר יותר לניתוח באמצעות המאגר המתאים (ראה להלן). זמן לשגות הדמיה של תאי סרקומה RD עוברים MET זמינה כחומר משלים. תמונה כל טוב כל 2 שעות עם מטרת 10X באמצעות תרמי-תא חי אוטומטי 27.

    4. מיצוי RNA, שעתוק הפוך, ו qPCR

    1. חלץ RNA על פי הוראות היצרן באמצעות RNA סטנדרטימיצוי ערכה 24. RNA שחולץ ניתן לאחסן -80 מעלות צלזיוס.
    2. לכמת ריכוז RNA. הפשרה ולעבוד עם RNA על קרח. כדי לכמת ריכוזי RNA, למדוד ספיגת UV ב 260 ננומטר עם ספקטרופוטומטר קורא צלחת פי הפרוטוקול של היצרן. לדלל כל דגימות לריכוז הנמוך ביותר עם מים nuclease חינם.
    3. בצע שעתוק לאחור של רנ"א מכיל לתוך ה- DNA משלים (cDNA). שלב לא פחות מ 100 ננוגרם של רנ"א הכל עם חיץ PCR, תמהיל dNTP (100 מ"מ), תחל hexamer אקראית, הפוכה transcriptase ו nuclease ללא מים בנפח תגובה 20 μL 24. הפעל מחזורי RT פי הפרוטוקול של הייצור. cDNA ניתן לאחסן לטווח ארוך ב -20 ° C.
    4. לדלל 20 תגובות μL 100 μL עם 80 μL של H nuclease- חופשית 2 O.
    5. מערבבים 5 μL של צבע intercalating הקרינה מבוססי שילוב הורים 2x qPCR, 0.06 μL של כל פריימר 10 מיקרומטר, And 2 μL של התגובה בדילול RT לדגימה.
    6. הפעל qPCR על פי הפרוטוקול של היצרן עבור מיקס מאסטר הקרינה מבוססת.
    7. לכמת הכמויות היחסיות של mRNA על ידי שיטת CT דלתא לנרמל ל GAPDH. שרטט את ביטוי mRNA הממוצע של ביולוגי משכפל ± סטיית תקן לכל קבוצת טיפול.
      הערה: אמצעי זהירות מיוחדת יש לנקוט כאשר עובד עם RNA כדי להימנע ממגע עם RNases, כגון באמצעות פלסטיק RNase ללא ריאגנטים. ציוד Non-פעמי צריך להיות מטופלים לפני השימוש כדי להסיר RNases.

    5. Immunofluorescence מכתים

    1. בעקבות צעד 3.6, מדיה לשאוב ידי שאיפת ואקום מתאי RD בפורמט 24-היטב.
    2. תקן תאים על ידי הוספת 500 μL של 4% paraformaldehyde (PFA) לכל היטב דגירה במשך 15 דקות בטמפרטורת החדר (RT). בעקבות קיבעון, תאים במקום ב פוספט שנאגרו מלוחים (PBS) ולאחסן ב 4 מעלות צלזיוס למשך הלילה במידת הצורך.
    3. Permeabilizeתאים על ידי הוספת 500 μL של PBS + 0.2% Triton-X100 דגירה 30 דקות ב RT. על ידי שאיפת ואקום, ולהסיר חיץ permeabilization ולשטוף שלוש פעמים עם PBS.
    4. בלוק ב 500 μL של 5% אלבומין בסרום שור (BSA) / PBS דגירה תאים עבור 30 דקות ב RT. תאים ניתן לאחסן 4 מעלות צלזיוס למשך הלילה במידת הצורך.
    5. הכן דילול נוגדן ראשוני. פיפטה 200 μL של 5% BSA / PBS לכל גם לתוך חרוטי 15 מ"ל (12 בארות = 2.4 מ"ל) ולהוסיף 1 μL של נוגדן ראשוני לכל מ"ל של 5% BSA / PBS הצורך. סור חסימת חיץ ידי שאיפת ואקום ולחלק 200 μL של נוגדן ראשוני מדולל היטב כל אחד.
      1. דגירת תאים 1: 1000 נוגדנים עיקריים מדוללים 5% BSA / PBS עבור 1 ש 'ב RT או לילה ב 4 מעלות צלזיוס. לאחר דגירה, לשטוף תאים פעמים עם PBS.
    6. הכן את דילול נוגדנים משני באותו נפח של 5% BSA / PBS כאמור. מוסיף את הנוגדנים משני מרחיקות האדומים מצומדות צבע באמצעות 1: דילול 2000. בנוסף להוסיף1 מיקרוגרם / מ"ל ​​של צבע Hoechst לתערובת. הסר את PBS ולהוסיף 200 μL של תמהיל היטב כל אחד.
      1. לדגור על RT עבור 1 h בחושך. לשטוף 3 פעמים עם PBS, לעזוב התאים PBS, להגן על התאים מפני האור באמצעות רדיד. תאים ניתן לאחסן 4 ° C במידת הצורך.
    7. תאי תמונה בהגדלה הכוללת 400X על מיקרוסקופ epifluorescence הפוך עם גל עירור 594 - 650 ננומטר.

    6. מערבי סופג

    1. שטפו תאים מן 3.6 פעמיים עם קרים כקרח PBS. על קרח, תאים lyse עם 50 μL של 1x ריפה חיץ בתוספת קוקטייל מעכבי פרוטאז 1x.
    2. lysates רוק בבית 4 מעלות צלזיוס למשך 15 דקות, לאסוף lysates לתוך 1.5 צינורות מ"ל, ו צנטריפוגות במהירות גבוהה (20,000 XG) במשך 5 דקות כדי להבהיר דגימות. lysates תא ניתן לאחסן לטווח ארוך ב -80 ° C במידת הצורך.
    3. לכמת החלבון הכולל באמצעות assay ברדפורד ו aliquot כמות שווה של חלבון לתוך צינורות microcentrifuge חדש 1.5 מ"ל. בריןg דגימות נפח שווה באמצעות חיץ ריפה ו חיץ טעינת 3x Laemmli בתוספת 2-mercaptoethanol.
    4. דגירה דגימות במאגר טעינת מדגם 1x Laemmli עבור 5 דקות ב 95 ° C ולהפעיל SDS-PAGE באמצעות ג'ל 4-12% טריס-גליצין ב 200 V עבור 45 דקות. כמות טווחי טעון חלבון בהתאם לקו הסלולרי. בחלק מהמקרים, 50-100 מיקרוגרם של חלבון הכוללת נדרש לזהות E-cadherin בשורות תאי המזנכימה.
    5. העברת חלבונים על גבי קרום nitrocellulose עבור 2 שעות ב 50 V ב 1x טריס-גליצין חיץ העברה.
    6. קרום בלוק עבור 1 שעות בטמפרטורת חדר או הלילה ב 4 מעלות צלזיוס חיץ חסימה מבוססת BSA.
    7. מדולל נוגדנים העיקרית בבית 1: 1000 ריכוז 5 מ"ל של חיץ חסימה, להוסיף דילול של קרום, דגירה עם נדנדה עדין עבור 1 שעות בטמפרטורת החדר או לילה ב 4 מעלות צלזיוס. קרום Wash 3 פעמים ב PBS עם 0.05% Tween-20.
    8. דגירה ממברנות עבור 1 ש 'ב RT עם secondar ניאון בשילוב אינפרא אדוםy נוגדן בבית 1: 20,000 דילול בחסימת המאגר כאמור.
    9. לשטוף פעמיים הממברנה ב PBS עם 0.05% Tween-20 ולאחר מכן פעם אחת ב PBS.
    10. קרום תמונה באמצעות גילוי הקרינה האינפרה-אדום סטנדרטי.

    7. מבחני צמיחה Anchorage-עצמאית

    הערה: עבור פרוטוקול assay רך אגר מפורט, ראו 28.

    1. 2x DMEM תקשורת סטרילי חמה כדי 42 מעלות צלזיוס באמבט מים חמים. במהלך תקופה זו, חום מראש autoclaved agarose 1% במיקרוגל למשך 3 דקות. מיקרוגל עבור 30 s נוספות בכל פעם לפי הצורך או עד שהיא נמסה לחלוטין. הזז agarose כדי באמבט מים C 42 °.
    2. מניחים צינור חרוטי 50 מ"ל בכוס עם 42 ° C מים במנדף סטרילי ומערבבים agarose 1% ומדיה 2x DMEM בתוך 1: חשבונאות יחס 1 עבור 1.5 מ"ל של תערובת לכל היטב צלחת 6-היטב. תמיד להכין תוספת DMEM / agarose לתת דין וחשבון על שגיאה pipetting ולהימנע בועות.
    3. מוסיפים לתערובת אתהצדדים של הבאר, הבטחת אין בועות יוצרים ולתת לעמוד במשך 30 דקות ב RT.
    4. בעוד השכבה התחתונה היא המחזקת, להכין כל קבוצה של תאים RD טרנספקציה בשלב 3 על ידי aspirating התקשורת ושטיפת פעם עם 1 מ"ל PBS. לשאוב PBS ולהוסיף 0.2 מ"ל של טריפסין 0.05% ו לדגור על 37 מעלות צלזיוס למשך 5 דקות.
    5. לנטרל טריפסין ב 0.8 מיליליטר של תקשורת ותא triturate להקים השעית תא בודד. העבר ההשעיה לתא צינור חרוטי 15 מ"ל.
    6. ספירת תאים לחשב נפח תא השעיה דרושה 10,000 תאים לכל טוב.
    7. מחממים agarose 0.6% במיקרוגל למשך 3 דקות ואחריו 30 s בכל פעם, עד נמס לחלוטין. זז agarose כדי 42 מעלות צלזיוס מים באמבטיה.
    8. מניחים צינור חרוטי 50 מ"ל בכוס עם 42 ° C מים במנדף סטרילית. מערבבים 0.6% agarose ו ההשעיה תא מדולל 1: יחס 1 להכין 1.5 מ"ל של תערובת לכל היטב צלחת 6-היטב. תמיד להכין השעית תא נוספת / agarose לערבב לתת דין וחשבון על שגיאת pipetting וכדי למנוע בועות.
      הערה: חשוב לעבוד על 42 מעלות צלזיוס כאן. אם הטמפרטורה נמוכה מדי את התערובת תהיה לגבש לפני הציפוי, וטמפרטורות מעל 42 מעלות צלזיוס תשפענה על כדאיויות תא.
    9. מערבבים היטב על ידי triturating תאים מספר פעמים ולהוסיף תא תערובת אל בארות, הבטחת אין טופס בועות, ולתת לחזק עבור 20 דקות ב RT.
    10. להוסיף 2 מ"ל של התקשורת בתוספת היטב כל ולעבור צלחות חממה.
      1. שינוי בתקשורת פעם בשבוע למשך 3-4 שבועות או עד יוצרי מושבות רבות תאיות. היזהר שלא לגעת אגרו כאשר הסרת תקשורת על ידי שאיפת ואקום. לחלופין, להשתמש P1000 כדי להסיר את השכבה העליונה של תקשורת הנוזלית.
      2. הכתם צלחות אגר רך על ידי הוספת 200 μL של ניטרו פתרון כלוריד כחול tetrazolium (1 מ"ג / מ"ל ​​ב PBS) דגירה את הצלחת לילה בשעה 37 ° C. חלף תקשורת למחרת עם PBS עבור הדמיה.
      3. בארות תמונה ב 40X גדלה מוחלטת על מיקרוסקופ הפוכה.
      4. ביצוע ניתוח על ImageJ עבור אזור המושבה ומספר. מגרש אומר מספר מושבה של ביולוגי משכפל ± סטיית תקן.

    Subscription Required. Please recommend JoVE to your librarian.

    Representative Results

    or Start trial to access full content. Learn more about your institution’s access to JoVE content here

    סכימה לזירוז נפגש תאי סרקומה

    ציר זמן בכלל עבור האינדוקציה של שינויי MET דמויי תאי סרקומה מוצג באיור 1. פרוטוקול מתחיל transducing GRHL2 (איור 1A), ואחריו transfection של משפחת miR-200 (איור 1B). GRHL2 או בני משפחה miR-200 לא היו מסוגלים להשפיע על המראה של תאים RD כאשר הביע לבד, אבל ביטוי אקטופי של GRHL2 ומיר-200s יחד התוצאות שינויים מורפולוגיים דמויי אפיתל תאי RD. תאי מעבר מצורה דמוי ציר כדי הופעה מעוגלת יותר עם מגע בין תאים מוגברים (האיור 1C).

    אינדוקציה של שינויים MET דמויי תאים סרקומה

    השינוי המורפולוגי בתאי RD על GRHL2 ומיר-200יתר הביטוי לווה גברת ביטוי של E-cadherin סמן אפיתל (איור 2 א). תוספת של miR-200s שהוגברו E-cadherin לבד, אבל בשילוב miR-200s ו ביטוי יתר GRHL2 משופרת בסינרגיה ביטוי E-cadherin (איור 2 א; לא בסקאלה לוגריתמית). בנוסף, חלה עליה בצמתים תא-תא של מולקולות הדבקה האפיתל, EpCAM ו TJP1, חצים לבנים (הידוע גם בשם Zona occludens 1, ZO-1) (איור 2B).

    אינדוקצית MET פוחתת יכולתו היווצרות מושבה של תאי סרקומה

    גברת ביטוי של חלבונים האפיתל לוותה downregulation של המזנכימה גני Zeb1 ו Notch1 (איור 3A), אשר ידועים יעדי miR-200. אינדוקציה של MET הקטינה את הצמיחה עצמאית-אנקורג של תאים RD כפי שנמדד על ידי מספר המושבה (איור 3B). Gro זהwth עיכוב הונע על ידי miR-200s לבד; כמו יתר של GRHL2 הביאה לעלייה בצמיחה עצמאית Anchorage (איור 3). זה עולה בקנה אחד עם דיווחים קודמים שהראו ביטוי GRHL2 גורם צמיחה עצמאית-אנקורג '22.

    איור 1
    איור 1: ציר זמן של אינדוקציה נפגש עם GRHL2 יתר ביטוי ומיר-200 Transfection. (א) ציר זמן של יתר ביטוי אקטופי של GRHL2 בתאי יעד. (ב) ציר זמן של אינדוקציה MET באמצעות transfection הפוכה של בני המשפחה miR-200 בתאים היעד. (ג) GRHL2 ומיר-200 יתר הביטוי הובילו שינויים במורפולוגיה של תאי היעד עקביים עם MET. בר סולם = 75 מיקרומטר אנא לחץ כאןכדי להציג גרסה גדולה יותר של דמות זו.

    איור 2
    איור 2: במקביל ביטוי יתר של GRHL2 ומיר-200s הוביל נפגשו תאי יעד. (א) ביטוי של miR-200s הוביל ביטוי E-cadherin גבוהה תוך ביטוי בשילוב של GRHL2 ומיר-200s מיוצר אפקט סינרגיסטי על ביטוי E-cadherin הוא ברמה של mRNA (ערכים ממוצעים ± סטיית תקן) ורמות חלבון. (ב) ביטוי בשילוב של GRHL2 ומיר-200s הוביל לביטוי מוגבר של EpCAM ו TJP1 על קשר תאי תאים (חיצים). בר סולם = 20 מיקרומטר. * מציין p <0.05 נותחו באמצעות ANOVA עם פוסט-הוק של Tukey דמות correction.This שונתה ההתייחסות 24. Copyright © האגודה האמריקנית למיקרוביולוגיה, ביולוגיה מולקולרית של התא, נפח 36, גיליון 19, 2503-2513, 2016. אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו.

    איור 3
    איור 3: ביטוי של סמני mesenchymal המדכאים miR-200s וירידות צמיחת Anchorage-עצמאית תאי סרקומה. (א) במהלך - ביטוי של miR-200S אבל לא GRHL2 עכבות ביטוי mRNA Zeb1 ו Notch1 (ערכים ממוצעים ± סטיית תקן). (ב) על הביטוי של miR-200S אבל לא GRHL2 התנגדות anoikis עכבות בתאים סרקומה. נציג תמונות של מושבות צבעוניות (סרגל קנה מידה = 200 מיקרומטר) וכימות של מספר מושבה (ערכים ממוצעים ± סטיית תקן) מוצגות. * מציין p <0.05 נותחו באמצעות ANOVA עם פוסט-הוק של Tukey דמות correction.This שונתה מ reference 24. Copyright © האגודה האמריקנית למיקרוביולוגיה, ביולוגיה מולקולרית של התא, נפח 36, גיליון 19, 2503-2513, 2016. אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו.

    איור 3
    וידאו משלימה: תאי RD להביע וקטור ריק miRNAs שליטה שלילית. וידאו לוקט מתוך תמונות של תאי RD טרנספקציה עם וקטור ריק miRNAs שליטה השלילית רכשה כל שעות באמצעות תרמי לחיות תאים אוטומטיים. אנא לחץ כאן כדי לצפות בסרטון הזה. (לחץ לחיצה ימנית כדי להוריד.)

    איור 3 />
    משלימה וידאו 2: תאים RD הבעת GRHL2-EGFP ו miRNAs בקרה שלילית. וידאו לוקט מתוך תמונות של תאי RD טרנספקציה עם GRHL2-EGFP ו miRNAs שליטה השלילית רכשו כל שעות באמצעות תרמי לחיות תאים אוטומטיים. אנא לחץ כאן כדי לצפות בסרטון הזה. (לחץ לחיצה ימנית כדי להוריד.)

    איור 3
    משלימה וידאו 3: תאים RD הבעת וקטור ריק miR200 miRNAs. וידאו לוקט מתוך תמונות של תאי RD טרנספקציה עם וקטור ריק miR200 miRNAs רכשו כל שעות באמצעות תרמי לחיות תאים אוטומטיים. אנא לחץ כאן כדי לצפות בסרטון הזה. (לחץ לחיצה ימנית כדי להוריד.)

    NT" FO: keep-together.within-page = "1"> איור 3
    משלימה וידאו 4: תאים RD הבעת GRHL2-EGFP ו miR200 miRNAs. וידאו לוקטו מתוך תמונות של תאי RD טרנספקציה עם GRHL2-EGFP ו miR200 miRNAs רכש כל שעות באמצעות תרמי לחיות תאים אוטומטיים. אנא לחץ כאן כדי לצפות בסרטון הזה. (לחץ לחיצה ימנית כדי להוריד.)

    Subscription Required. Please recommend JoVE to your librarian.

    Discussion

    or Start trial to access full content. Learn more about your institution’s access to JoVE content here

    סרקומות הן נדירות, אבל מאוד סוגי סרטן אגרסיביים של השושלת המזנכימה. למרות השושלת המזנכימה שלהם, קבוצת משנה של סרקומות מופיע לעבור במעבר פנוטיפי למצב אפיתל דמוי יותר. יש מתג MET-ככה רלוונטי פרוגנוסטיים, כמו חולים עם גידולים אפיתל דמוית יותר הם פחות אגרסיביים 24. למרות הרלוונטיות הקליניות שלהם, ישנם מחקרים מעטים פונים המנגנונים המולקולריים נהיגת מעברים פנוטיפי אלה סרקומות.

    כדי לבחון מעברים MET דמויי תאים סרקומה, פיתחנו מודל MET-אינדוקציה על ידי שילוב הביטוי של גורמים האפיתל GRHL2 ומשפחת miR-200. שיטה זו במהירות מעוררת תאי סרקומה להיות יותר אפיתל דמוי כפי שנמדד על ידי שינויים במורפולוגיה ועל ביטוי גנים. שימוש בפרוטוקול זה כדי לגרום נפגשו תאי סרקומה מקל חקר את ההשפעה של מעברים אלה על פנוטיפים שמניעים סרקומה תוקפנות, כגוןכמו הגירה, פלישה, התפשטות והתנגדות מוות ואיך כל השינויים האלה בביולוגיה יכולה להשפיע עמידות לתרופות.

    בהקשר של קרצינומות נגזרות האפיתל, ביטוי של גורם המזנכימה אחד הוא לעתים קרובות מספיק כדי לגרום 14 EMT. עם זאת, במודל סרקומה הנגזרות זו של MET הביטוי של שני גורמים האפיתל, GRHL2 ומיר-200s, נדרשים. מעניין, מיר-200s היה לבד השפעה חזקה על רוב סמנים ביולוגיים של MET מ GRHL2, בעוד GRHL2 הצליח להפעיל גנים האפיתל וחסונה רק בנוכחות miR-200 מבוססת דיכוי repressors הגן האפיתל, כגון ZEB1 24. יתכן כי עבור כמה סוגי תאים המזנכימה גנים האפיתל צריך להיות גם דה-מודחק (למשל באמצעות miR-200S) והופעל (למשל באמצעות GRHL2) לנהוג MET.

    יש לנו ניסיון וריאציה ברמות ביטוי GRHL2 ברחבי cel השונהקווי l. כדי להתגבר על זה, השתמשנו פלסמיד ביטוי GRHL2 כי גם מביע 25 EGFP כדי למיין לפי זרימת cytometry תאים חיוביים EGFP לפני ניסויים. זה גם קריטי כדי לאמת את הפונקציונליות של miR-200s ו GRHL2 בסוגי תאים שונים. EMT נתפסת ספקטרום המבוסס על ביטוי של אפיתל גנים הקשורים המזנכימה, אשר יכולה להיות וריאציה תלוית הקשר מבוסס על שורת תאים, סוג הסרטן, טיפול, וכו 'לכן, נתחנו חמישה גנים מוסדרים על ידי miR-200 או GRHL2 כדי דין וחשבון על שינויים תלויי קשר תא. אזהרה נוספת של assay זה היא הסתמכות על transfection חולף של miR-200s לזירוז MET. לפיכך, ניסויים לטווח ארוך יכולים להיות יקרים ומסובכים כאשר transfections החוזרת המרובה להיות הכרחית. זו ניתן להתגבר באמצעות פלסמידים ביטוי miR-200.

    מחקרים אחרים גם הציגו עדויות נפגשו סרקומות. למשל, פגשתי נצפה קבוצת משנה של leiomyosarcomas והיה קשור עם הישרדות טובה יותר לחולים. באופן מכני, יאנג ואח '. נמצא כי בתוך עיכוב שורת תאים leiomyosarcoma של שבלול עם siRNA היה מספיק כדי לגרום לשינויים MET-כמו 29. כמו כן, דלדול של עוד גורם המזנכימה, חילזון, בתאי גזע mesenchymal מופחת היווצרות סרקומה בעכברים 30. לפיכך, ברור מהספרות כי ישנם מסלולים מרובים כדי פנוטיפ MET דמוי, אשר עשוי להשתנות בהתאם לסוג התא. אמנם זה לא הדרך היחידה לגרום MET, השתמשנו בשיטה שלנו כדי לגרום נפגשו שני תתי סוגים סרקומה, כולל ראדומיוסרקומה (תאים RD) ו- אוסטאוסרקומה (143B תאים). בעתיד, זה יהיה מעניין להשוות שיטות שונות אלו מגוון רחב יותר של תאי סרקומה. לדוגמא, אל תת סרקומה מסוים יש שינויים גנטיים או אפיגנטיים בסיסיים שהופכים אותם יותר או פחות רגישים אינדוקצית MET?

    זיהוי ההשפעה של METעל מגוון של יציאות ביולוגיות בתאים סרקומות יכול לספק הבנה טובה יותר של למה בחולים עם סרקומות אפיתל דמוי עוד יש פרוגנוזה משופרת. בנוסף, הבנת ההשפעה של טיפול על נהיגת המעברים פנוטיפי בין המדינות תעמיק את ההבנה הביולוגית שלנו ולהודיע ​​על תגובה לטיפולים נוכחיים בחולי סרקומה.

    Subscription Required. Please recommend JoVE to your librarian.

    Disclosures

    החוקרים אין לחשוף.

    Acknowledgments

    JAS מודה תמיכה ממכון הסרטן Duke, המעבדה לאונקולוגיה המין והשתן אוניברסיטת דיוק, ואת מחלקת אורתופדיה אוניברסיטת דיוק. HL נתמכה על ידי הקרן הלאומית למדע (NSF) המרכז לפיסיקה ביולוגית תיאורטית (NSF PHY-1,427,654) ו- NSF DMS-1,361,411, וכתוצאה CPRIT (מניעת סרטן ולמחקר במכון טקסס) Scholar ב Cancer Research של מדינת טקסס בבית רייס האוניברסיטה. KEW נתמכה על ידי MKJ NIH F32 CA192630 ו HL נהנו מן הדיונים שימושי עם מרי ג Farach-קרסון, JN Onuchic, סמיר M. Hanash, קנת ג'יי Pienta, ו דונלד ס קופי.

    Materials

    Name Company Catalog Number Comments
    Countess automated counter Life technologies AMQAX1000
    Countess cell counting chamber slides Invitrogen C10283
    SimpliAmp Thermal Cycler Thermo Fisher A24811
    Odyssey Fc LI-COR Inc
    ViiA7 Real Time PCR System Thermo Fisher 4453536
    PCR microplate Corning 321-29-051
    KAPA SYBR Fast Universal qPCR Kit KAPA Biosystems KK4602
    Starting Block (PBS) Blocking Buffer Thermo Fisher 37538 BSA-based blocking buffer
    Agarose General Purpose LE Genesee Scientific 20-102
    10x Tris/Glycine/SDS Buffer Bio-Rad Laboratories Inc 161-0732 Running buffer
    10x Tris/Glycine Buffer Bio-Rad Laboratories Inc 161-0734 Transfer buffer
    RIPA Buffer Sigma Life Sciences SLBG8489
    Amersham Protran 0.45 μm nitrocellulose GE Healthcare Lifesciences 10600012
    Quick-RNA MiniPrep Kit Genesee Scientific 11-358
    Laemmli Sample Buffer (4X) Bio-Rad Laboratories Inc 1610747
    Mini Trans-Blot Cell Bio-Rad Laboratories Inc 1703930
    Mini-Protean Tetra Cell Bio-Rad Laboratories Inc 1658005EDU
    DPBS Life technologies 14190-144
    0.05% Trypsin-EDTA Life technologies 11995-065
    DMEM Life technologies 11995-065
    Lipofectamine RNAi Max Thermo Fisher 13778150
    Lipofectamine 2000 Ragents Thermo Fisher 11668019
    Penicillin Streptomycin Life technologies 15140-122
    miRVana miRNA mimic negative control #1 Thermo Fisher 4464058 neg miRNA
    hsa-miR-200 mirVana miRNA mimic Thermo Fisher 4464066 miR200A
    has-miR-200 mirVana miRNA mimic Thermo Fisher 4404066 miR200B
    has-miR-200 mirVana miRNA mimic Thermo Fisher 4404066 miR200C
    Opti-MEM Life technologies 11088-021 serum-free media
    anti-Ecadherin antibody BD Bioscience 610182
    anti-beta actin Santa Cruz Biotechnology sc-69879
    anti-EpCam Ab Serotec MCA18706
    anti-ZO1 Invitrogen 402200
    IRDye 800W LI-COR Inc 925-32210
    IRDye 680 LI-COR Inc 926-32223
    anti-mouse AlexaFluor 647 Thermo Fisher A211241
    anti-rabbit AlexaFluor 647 Thermo Fisher ab150075
    Halt Protease and Phosphatesse Inhibitor Thermo Fisher 1861281
    Precision Plus Protein Dual Color Bio-Rad Laboratories Inc 161-0374
    Partec CellTrics Sysmex 04-004-2326 30 μm filter for flow
    GAPDH-F IDT AGCCACATCGCTCAGACAC
    GAPDH-R IDT GCCCAATACGACCAAATCC
    Ecadherin-F IDT TGGAGGAATTCTTGCTTTGC
    Ecadherin-R IDT CGCTCTCCTCCGAAGAAAC
    ZEB1-F IDT GCATACAGAACCCAACTTGAACGTC
    ZEB1-R IDT CGATTACACCCAGACTGC
    NOTCH-F IDT GGCAATCCGAGGACTATGAG
    NOTCH-R IDT CTCAGAACGCACTCGTTGAT
    nitro blue tetrazolium  Sigma N5514
    hexadimethrine bromide Sigma H9268 polybrene
    3 mL syringe BD Bioscience 309657
    Sterile syringe filter VWR 28145-505
    5mL polypropylene round-bottom tube 352063 flow cytometry tubes
    High-Capacity cDNA Reverse Transcription Kit Thermo Fisher 4368814 reverse transcription kit
    4% paraformaldyhyde Santa Cruz Biotechnology sc-281612
    Triton-X100 Sigma 93443
    bovine serum albumin Sigma A7906

    DOWNLOAD MATERIALS LIST

    References

    1. Weber, C. E., Li, N. Y., Wai, P. Y., Kuo, P. C. Epithelial-mesenchymal transition, TGF-beta, and osteopontin in wound healing and tissue remodeling after injury. J Burn Care Res. 33, (3), 311-318 (2012).
    2. Galichon, P., Finianos, S., Hertig, A. EMT-MET in renal disease: should we curb our enthusiasm. Cancer Lett. 341, (1), 24-29 (2013).
    3. Carew, R. M., Wang, B., Kantharidis, P. The role of EMT in renal fibrosis. Cell Tissue Res. 347, (1), 103-116 (2012).
    4. Willis, B. C., Borok, Z. TGF-beta-induced EMT: mechanisms and implications for fibrotic lung disease. Am J Physiol Lung Cell Mol Physiol. 293, (3), L525-L534 (2007).
    5. Ye, X., Weinberg, R. A. Epithelial-Mesenchymal Plasticity: A Central Regulator of Cancer Progression. Trends Cell Biol. 25, (11), 675-686 (2015).
    6. Li, L., Li, W. Epithelial-mesenchymal transition in human cancer: comprehensive reprogramming of metabolism, epigenetics, and differentiation. Pharmacol Ther. 150, 33-46 (2015).
    7. Tsai, J. H., Yang, J. Epithelial-mesenchymal plasticity in carcinoma metastasis. Genes Dev. 27, (20), 2192-2206 (2013).
    8. Bitting, R. L., Schaeffer, D., Somarelli, J. A., Garcia-Blanco, M. A., Armstrong, A. J. The role of epithelial plasticity in prostate cancer dissemination and treatment resistance. Cancer Metastasis Rev. 33, (2-3), 441-468 (2014).
    9. Schaeffer, D., Somarelli, J. A., Hanna, G., Palmer, G. M., Garcia-Blanco, M. A. Cellular Migration and Invasion Uncoupled: Increased Migration Is Not an Inexorable Consequence of Epithelial-to-Mesenchymal Transition. Mol Cell Biol. 34, (18), 3486-3499 (2014).
    10. Mathow, D., et al. Zeb1 affects epithelial cell adhesion by diverting glycosphingolipid metabolism. EMBO Rep. 16, (3), 321-331 (2015).
    11. Ware, K. E., et al. A mechanism of resistance to gefitinib mediated by cellular reprogramming and the acquisition of an FGF2-FGFR1 autocrine growth loop. Oncogenesis. 2, e39 (2013).
    12. Yauch, R. L., et al. Epithelial versus mesenchymal phenotype determines in vitro sensitivity and predicts clinical activity of erlotinib in lung cancer patients. Clin Cancer Res. 11, (24 Pt 1), 8686-8698 (2005).
    13. Jolly, M. K., et al. Towards elucidating the connection between epithelial-mesenchymal transitions and stemness. J R Soc Interface. 11, (101), 20140962 (2014).
    14. Mani, S. A., et al. The epithelial-mesenchymal transition generates cells with properties of stem cells. Cell. 133, (4), 704-715 (2008).
    15. Chen, L., et al. Metastasis is regulated via microRNA-200/ZEB1 axis control of tumour cell PD-L1 expression and intratumoral immunosuppression. Nat Commun. 5, 5241 (2014).
    16. Nicolazzo, C., Gradilone, A. Significance of circulating tumor cells in soft tissue sarcoma. Anal Cell Pathol (Amst). 697395 (2015).
    17. Somarelli, J. A., et al. Mesenchymal-epithelial transition in sarcomas is controlled by the combinatorial expression of miR-200s and GRHL2. Mol Cell Biol. (2016).
    18. Bae, Y. K., Choi, J. E., Kang, S. H., Lee, S. J. Epithelial-Mesenchymal Transition Phenotype Is Associated with Clinicopathological Factors That Indicate Aggressive Biological Behavior and Poor Clinical Outcomes in Invasive Breast Cancer. J Breast Cancer. 18, (3), 256-263 (2015).
    19. Humphries, B., Yang, C. The microRNA-200 family: small molecules with novel roles in cancer development, progression and therapy. Oncotarget. 6, (9), 6472-6498 (2015).
    20. Renner, M., et al. MicroRNA profiling of primary high-grade soft tissue sarcomas. Genes Chromosomes Cancer. 51, (11), 982-996 (2012).
    21. Petrof, G., et al. Mutations in GRHL2 result in an autosomal-recessive ectodermal Dysplasia syndrome. Am J Hum Genet. 95, (3), 308-314 (2014).
    22. Werner, S., et al. Dual roles of the transcription factor grainyhead-like 2 (GRHL2) in breast cancer. J Biol Chem. 288, (32), 22993-23008 (2013).
    23. Werth, M., et al. The transcription factor grainyhead-like 2 regulates the molecular composition of the epithelial apical junctional complex. Development. 137, (22), 3835-3845 (2010).
    24. Somarelli, J. A., et al. Mesenchymal-Epithelial Transition in Sarcomas Is Controlled by the Combinatorial Expression of MicroRNA 200s and GRHL2. Mol Cell Biol. 36, (19), 2503-2513 (2016).
    25. Varma, S., et al. The transcription factors Grainyhead-like 2 and NK2-homeobox 1 form a regulatory loop that coordinates lung epithelial cell morphogenesis and differentiation. J Biol Chem. 287, (44), 37282-37295 (2012).
    26. Pruitt, S. C., Mielnicki, L. M., Stewart, C. C. Analysis of fluorescent protein expressing cells by flow cytometry. Methods Mol Biol. 263, 239-258 (2004).
    27. Zhao, Z., et al. A high-content morphological screen identifies novel microRNAs that regulate neuroblastoma cell differentiation. Oncotarget. 5, (9), 2499-2512 (2014).
    28. Borowicz, S., et al. The soft agar colony formation assay. J Vis Exp. (92), e51998 (2014).
    29. Yang, J., et al. Integrated proteomics and genomics analysis reveals a novel mesenchymal to epithelial reverting transition in leiomyosarcoma through regulation of slug. Mol Cell Proteomics. 9, (11), 2405-2413 (2010).
    30. Alba-Castellon, L., et al. Snail1 expression is required for sarcomagenesis. Neoplasia. 16, (5), 413-421 (2014).
    31. Takaishi, M., Tarutani, M., Takeda, J., Sano, S. Mesenchymal to Epithelial Transition Induced by Reprogramming Factors Attenuates the Malignancy of Cancer Cells. PLoS One. 11, (6), e0156904 (2016).

    Erratum

    Formal Correction: Erratum: Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells
    Posted by JoVE Editors on 07/03/2018. Citeable Link.

    An erratum was issued for: Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells. An author name was updated.

    One of the authors' names was corrected from:

    Shenghan Xu

    to:

    Shengnan Xu

    אינדוקציה של מעברי אפיתל- mesenchymal בתאי סרקומה
    Play Video
    PDF DOI DOWNLOAD MATERIALS LIST

    Cite this Article

    Ware, K. E., Gilja, S., Xu, S., Shetler, S., Jolly, M. K., Wang, X., Bartholf Dewitt, S., Hish, A. J., Jordan, S., Eward, W., Levine, H., Armstrong, A. J., Somarelli, J. A. Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells. J. Vis. Exp. (122), e55520, doi:10.3791/55520 (2017).More

    Ware, K. E., Gilja, S., Xu, S., Shetler, S., Jolly, M. K., Wang, X., Bartholf Dewitt, S., Hish, A. J., Jordan, S., Eward, W., Levine, H., Armstrong, A. J., Somarelli, J. A. Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells. J. Vis. Exp. (122), e55520, doi:10.3791/55520 (2017).

    Less
    Copy Citation Download Citation Reprints and Permissions
    View Video

    Get cutting-edge science videos from JoVE sent straight to your inbox every month.

    Waiting X
    simple hit counter