Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Developmental Biology

육종 세포의 중간 엽 상피 전환 유도

doi: 10.3791/55520 Published: April 7, 2017

ERRATUM NOTICE

Summary

우리는 여기에서 마이크로 RNA-200의 가족과 같은 grainyhead 2 (GRHL2)의 결합에 기초 이소성 발현 육종 세포에서 중간 엽 상피 전환 (MET)을 유도하는 세포 배양 방법을 제시한다. 이 방법은 암의 공격성과 치료에 대한 표현형 가소성의 생물학적 영향을 이해하기 더 적합합니다.

Abstract

표현형 소성은 세포가 일시적으로 다른 혈통의 특성을 얻을하는 현상을 말한다. 암 진행하는 동안, 표현형의 가소성은 침공, 보급 및 전이를 구동한다. 표현형 가소성 연구의 대부분은 상피 유래 암의 맥락에서되었지만 실제로, 그것은 mesenchymal- 유사한 현상을 겪고 육종의 부분 집합으로, 또한 표현형의 가소성을 전시, 기원 중간 엽 있습니다 육종을 밝혀 상피 성 전이 (MET). 여기서는 각각 순차적 GRHL2 및 미르 200 패밀리는 세포 형질 도입 및 형질 전환을 이용하여 표현 육종 환자 samples.We 관찰이 메티오닌과 같은 현상을 모방 미르-200 가족 grainyhead 같은 2 (GRHL2)를 포함하는 방법을 개발 더 나은 육종 세포에서 이러한 형질 전환의 분자 토대를 이해합니다. 미르 200S 및 GRHL2 표현 육종 세포는 상피 향상된 characterist 입증세포 형태와 상피와 중간 엽 바이오 마커의 변화에 ​​ICS. 이러한 방법을 사용하여 앞으로의 연구는 더 나은 등의 이동, 침윤, 전이 성향 및 치료 저항 등의 육종 세포에 대한 MET-같은 프로세스의 표현형의 결과를 이해하는 데 사용할 수 있습니다.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

표현형 가소성 세포 표현형 사이의 가역적 인 변화를 의미하고, 일반적으로 두 가지 유형, 상피 간 간엽 (EMT) 전환 및 중간 엽 간 상피 천이 (MET)로 분할된다. 이 표현형의 가소성은 개발 및 상처 치유 1과 다세포 생물의 정상적인 과정에서 중요한 역할을한다; 그러나,이 같은 경로 유전자 발현 프로그램 또한 섬유증, 질병을 초래할 수있다 (검토를 2, 3, 4), 암 전이 (참고 문헌 5, 6, 7의 평가 8). 전이 동안, 예를 들어, EMT 세포 극성, 세포 - 세포 상호 작용을 방해하고, 침략 9, 10 추진하고 있습니다. 함께, EMT 기여암 세포의 보급을 촉진하는 표현형 상태로의. 또한 EMT는 암 세포 대사 (6)의 규제 완화 약물 저항 (11), (12)의 개발을 포함 공격적인 표현형을 유도 다른 표현형 변화, 증가 된 종양 개시 능력 (13), (14)와 면역 회피 15 호스트의 호스트로 이끈다.

표현형 소성 잘 암의 진행에서 연구되고있다; 그러나, 육종은 표현형의 가소성을 나타낸다. 암의 표현형 가소성 같은 드라이버 중 일부는 또한 육종 소성 및 공격성에 기여하는 것처럼 흥미롭게도,이 나타납니다. 예를 들어, 육종 환자의 순환 성 종양 세포 (CTCS은)는 EpCAM, 일반적으로 상피 세포 (16)에서 발견되는 세포 표면 단백질을 발현하는 것으로 나타났다. ADDI전통적으로, 250 개 연조직 육종 샘플 상피 형상 또는 간엽 같은 유전자 발현에 기초로 분류 하였다. 상피와 같은 바이오 마커의 서명이있는 환자는 중간 엽 같은 바이오 마커의 서명 (17)을 가진 환자보다 더 나은 예후를했다. 이것은 더 상피와 같은 암 환자보다 중간 엽 같은 종양 18 환자에 비해 더 나은 결과를 보유하고있는 많은 암과 일치한다.

일부 육종이 생체와 MET와 일치 유전자 발현 경로를 표시하지만,이 표현형 가소성의 분자 토대는 잘 이해되지 유지. 육종 MET의 메커니즘과 드라이버를 연구하기 위해 우리는 두 가지 상피 특정 요소를 사용하여 MET 유도의 모델을 개발, 마이크로 RNA (은 miR) -200 가족과 grainyhead 같은 2 (GRHL2). 미르-200S는 messen의 3 '의 UTRs에 결합함으로써 유전자 발현을 조절하는 작은 비 RNA를 코딩하는 가족게르 RNA와 단백질에 방지 번역. 미르 141, 미르 (200A)를 포함 하나, 미르-200B, 200C 미르, 미르-429을 포함한 타 - 미르-200 가족 개의 서브 그룹들로 구성된다. 미르-200 계열의 구성원은 상피 조직에 충실 미르-200S 손실은 암 (19)의 전이와 관련된다. 미르-200 계열은 정상 조직에 비해 20 연조직 육종에서 하향 조절된다. 미르-200S 유사하게, GRHL2 상피 개발 (21)에 대한 중요 핵심 레귤레이터이다. GRHL2 전사 인자는 E-cadherin의 상피 유전자를 상향 조절하는 방법은 두 가지 작용 1) 상피 세포에서 GRHL2 직접 EMT 마스터 레귤레이터 억압을 ZEB1 22; 2) GRHL2 직접 상피 유전자 (23)의 전사를 활성화합니다. 우리의 이전 연구는 것으로 나타났습니다 육종 세포 미르-200S와 GRHL2의 결합 된 표현MET-같은 표현형 (24)를 유도한다. 여기서는은 miR-200S 및 GRHL2의 이소성 발현하여 육종 세포에서 MET 유도 시험 관내 모델을 작성하는 구체적인 프로토콜을 제안한다.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

시약의 제조 1.

  1. 소 태아 혈청 (FBS) 및 페니실린 - 스트렙토 마이신 (5,000 U / ㎖) 500 ㎖의 DMEM에 5 mL의 50 ㎖를 첨가하여 세포를 DMEM 배양을 준비한다. 이 매체는 최대 6 개월 동안 4 ° C에 저장할 수 있습니다.
  2. 10 μM의 최종 농도 핵산 분해 효소가없는 물에 동결 건조 된 프라이머를 재현 탁. 저장 -20 ° C에서 프라이머를 재 - 중단.
  3. radioimmunoprecipitation 분석 (RIPA) 완충액 (150 mM의 염화나트륨, 0.5 % 나트륨 데 옥시 콜레이트, 0.1 % SDS, 50 개 mM 트리스, pH를 8.0)을 준비한다. 사용하기 전에 프로테아제 억제제 칵테일 보충 및 사용시 얼음에 버퍼를 유지한다. 4 ℃에서 보관하십시오.
  4. 0.45 ㎛의 폴리 필터를 이용하여 멸균 물 및 주사기 필터에 10 ㎎ / ㎖의 폴리 브렌 (hexadimethrine 브로마이드)를 준비한다. 솔루션은 최대 6 개월 동안 4 ° C에 저장할 수 있습니다.
  5. PBS 10 ㎖의 10 ㎎을 용해시켜 니트로 블루 테트라 졸륨 클로라이드의 1 ㎎ / ㎖ 작업 용액을 제조 하였다. 4 ℃에서 보관하십시오.

GRHL2 2. 렌티 바이러스 형질 도입

1 일

  1. 접시 보충 DMEM 2 ㎖로 6 웰 플레이트에 웰당 3 × 105 HEK293T 세포. 자동 세포 계수기를 사용하여 세포를 정량화. 5 % CO 2, 37 ℃에서 밤새 배양 한 후 60 % 융합 - 셀 40이어야한다.

제 2 일

  1. 1.8 pΔ8.9의 μg의 및을 pCMV-VSV의 0.2 μg의와 함께 혈청이없는 미디어의 200 μL에 2 빈 벡터의 μg의 (을 pCMV-UBC-EGFP) 또는 둘을 pCMV-GRHL2-UBC-EGFP 24 μg의 25 희석 -G 도우미 플라스미드. 별도의 튜브에, 형질 당 혈청이없는 배지 (두 샘플 400 μL 8 μL)을 200 μL의 지질 계 형질 감염 시약 4 μL 희석. 각 플라스미드 용액으로 형질 전환 시약 혼합물을 200 μL를 첨가하고 실온에서 20 분 동안 배양한다.
  2. incuba 동안능은, 진공 흡인에 의해 배지를 제거하고 PBS 1 ㎖로 세포를 세척함으로써 HEK293T 세포를 세척한다. 혈청이없는 미디어의 800 μL와 PBS를 교체합니다. 5 % CO 2, 37 ℃에서 2 시간 동안 세포를 각 웰에 적하 단계 2.2에서 플라스미드 혼합물을 배양하고 20 분 후에, 트랜 스펙 션 시약 200 μL를 추가한다.
  3. 조심스럽게 진공 흡인 형질 감염 배지를 제거하고 보충 된 DMEM 2 mL로 교체한다. 하룻밤 문화 인큐베이터로 세포를 반환합니다.
    참고 : HEK293T 세포는 느슨하게 부착합니다. 미디어 교체 접시 또는 플라스크의 바닥으로부터 세포를 제거하기 위해주의를 제한하여 수행되어야한다.

3 일

  1. 보충 된 DMEM 2 ㎖로 형질 HEK293T 세포 플레이트에 6 웰 플레이트의 웰 당 3 × 105 RD 세포를 새로 고침 매체. 하룻밤 문화 전지. RD 세포는 시판 인간 횡문근 육종 세포주이다.

4 일

  • HEK293T 세포에서 바이러스 성 미디어를 수집합니다. 새로운 15ml의 원뿔형으로 HEK293T 세포 장소로부터 DMEM 배지 피펫. 조심스럽게 다시 다음 날을위한 인큐베이터에서 새로운 DMEM 매체와 장소 HEK293T 세포로 대체합니다.
  • 두 개의 새로운 50ml의 원뿔형 튜브 (GRHL2 형질 대한 빈 벡터 형질 다른 하나)로 10 밀리그램 / 바이러스 미디어 1 ㎖ 당 용액의 폴리 브렌 2 μL를 추가한다. 3 ml 주사기의 플런저를 제거하고 선단에 0.45 ㎛의 폴리 필터를 부착하여 주사기 필터 바이러스 매체.
    1. 주사기 배럴로 단계 260에서 수집 된 바이러스 미디어를 추가하고, 폴리 브렌을 함유하는 새로운 50 개 ㎖ 원뿔형 튜브에 미디어를 뛰어. 진공 흡인 RD 세포로부터 용지를 분리 RD 세포 바이러스 여과 매체를 추가한다.
  • 5 일

    1. 바이러스 미디어가 수집 한 후 반복 일 4. HEK293T 세포는 폐기 될 수있다.

    7 일

    1. 워시 RD의 PBS 1 ㎖로 세포를 200 0.05 % 트립신 μL 웰 당을 추가한다. 5 분 동안 37 ℃에서 인큐베이션 보충 미디어 2 ㎖를 추가하고, 새로운 15ml의 원뿔에 세포 현탁액을 이동. 실온 대기음 매체에서 5 분 동안 원심 분리기 (250) XG 세포. DMEM 1 ㎖에 재현 탁은 (5 % FBS 및 1 %의 페니실린 스트렙토 마이신이 보충).
      참고 : FBS의 높은 비율을 사용하여 유동 세포 계측법 동안 막힘이 발생할 수 있습니다
      1. 유동 세포 계측법에 대한 필터 세포. 얼음 튜브 대신 파이프를 유세포 분석기로 30 μm의 필터를 사용하여 1 ㎖의 RD 세포 현탁액을 적용하기 위해 피펫을 사용한다.
      2. 0.5ml의 DMEM을 함유하는 1.5 mL의의 마이크로 원심 튜브에 놓아 + EGFP 셀 26 얼음에 10 % FBS와 1 % 페니실린 - 스트렙토 마이신으로 보충 장소. 플레이트는 EGFP + 배양 인큐베이터에서 12 웰 플레이트와 장소의 단일 웰에 첨가 DMEM 1 ㎖의 총 세포를 분류.
        ; 참고 : 흐름 계측법이 전달 후 EGFP + 세포의 수율은 일반적으로 저 (50000 개 세포)이다. 3 단계로 진행하기 14 일 전 - 세포는 10 배양해야 할 수도 있습니다.

    미르 200S 3. 역방향 형질

    1. 반복 된 동결 / 해동 사이클을 피하기 위하여 -20 ° C에서 클레아없는 H 2 O. 나누어 축적량 및 저장소를 사용하여 결과 miR-200 모방 50 개 μM 주식을 준비한다.
    2. 혈청이없는 배지 300 μL 300 μL의 혈청이없는 배지에서 50 μM 음성 대조군 miRNA를 9 μL 각 50 μM은 miR-200 모방 (미르 200A 미르-200B, 미르-200C) 3 μL를 추가한다.
    3. 혈청이없는 배지 600 μL에 siRNA를 형질 특정 시약 6 μL를 첨가하고 두 튜브, 단계 3.2에서 두 미르 혼합물의 각 하나에이 혼합물을 300 μL를 나눈다. 형질 전환 시약 300 μL를 혼합하여, 각 단계에서 3.2 미르 혼합물의 300 μL를 결합. 방 TE에서 20 분 동안 인큐베이션mperature.
    4. 배양하는 동안, 2.4 ㎖의 생성 된 제 2 또는 EV GRHL2 EGFP 발현 600000 개 + RD 세포의 세포 현탁액 처리 당 혈청 매체 (250 세포 / μL)을 준비한다.
    5. 24- 웰 플레이트에서, 여섯 개 웰로은 miR-200 혼합 또는 단계 3.3 대조군 혼합물의 웰 당 100 μL를 추가 한 다음 각 미르 믹스 세 웰에 각각의 세포 현탁액을 400 μL를 추가한다.
    6. 5 % CO 2에서 37 ℃에서 세포를 밤새 인큐베이션 미디어 변경 완전히 다음날 DMEM을 첨가한다. 적절한 완충액 (하기 참조)을 이용하여 분석을 2 일 후, 세포를 수집한다. MET를 겪고 RD 육종 세포의 시간 경과 영상은 보충 자료로 사용할 수 있습니다. 이미지 자동 라이브 셀 이미 저 (27)를 사용하여 10 배 목적으로 각 웰마다 2 시간.

    4. RNA 추출, 역전사 및 qPCR에

    1. 표준 RNA를 사용하여 제조업체의 지침에 따라 RNA를 추출추출 키트 (24). 추출 된 RNA는 -80 ° C에 저장할 수 있습니다.
    2. RNA 농도를 정량화. 해동 얼음에 RNA와 함께 작동합니다. , RNA 농도를 정량화 제조사의 프로토콜에 따라 플레이트 리더 분광 광도계로 260 nm에서 UV 흡광도를 측정한다. 핵산 분해 효소가없는 물을 낮은 농도의 모든 샘플을 희석.
    3. 상보 적 DNA (cDNA의) 총 RNA로 역전사를 수행한다. 20 μL의 반응 부피 24 효소 및 뉴 클레아없는 물을 역 PCR 완충액의 dNTP 믹스 (100 mM)을 랜덤 헥사 머 프라이머와 총 RNA의 덜 100 NG를 결합하지 않는다. 제조의 프로토콜에 따라 RT주기를 실행합니다. cDNA를 -20 ° C에서 장기 저장할 수 있습니다.
    4. 뉴 클레아 제 무 H 2 O 80 μL에 100 μL에 20 μL 반응 희석
    5. 형광 기반 인터 염료 배 qPCR의 마스터 믹스를 5 μL, 각각 10 μM의 프라이머 0.06 μL를 섞어샘플 당 희석 RT 반응 ND 2 μL.
    6. 형광 기반의 마스터 믹스 제조 업체의 프로토콜에 따라 실행 qPCR에.
    7. 델타 CT 법에 의해 mRNA의 상대적인 양을 정량화 GAPDH로 정상화. 각 치료 그룹에 대한 표준 편차 ± 생물 복제의 평균 mRNA 발현을 그린다.
      참고 : 등의 RNase없는 플라스틱 및 시약을 사용하는 등 RNases과 접촉을 피하기 위해 RNA로 작업 할 때 특별한 예방 조치가 취해 져야한다. 비 일회용 장비는 RNases을 제거하기 위해 사용하기 전에 처리해야합니다.

    5. 면역 형광 염색

    1. 24- 웰 포맷에서 RD 세포로부터 진공 흡인 단계 3.6 대기음 미디어 다음.
    2. 웰당 4 % 파라 포름 알데히드 (PFA) 500 μL를 첨가하여 세포를 고정하고, 실온에서 15 분 (RT) 동안 배양. 정착 이후, 인산 장소 세포 밤새 필요한 경우 39 ° C에서 생리 식염수 (PBS) 및 스토어 버퍼.
    3. Permeabilize 하시려면PBS + 0.2 % 트리톤 X100 500 μL를 첨가하고, RT에서 30 분 동안 배양하여 세포. 진공 흡인, permeabilization 버퍼를 제거하고 PBS로 3 회 세척 하였다.
    4. 5 % 소 혈청 알부민 500 μL (BSA) / PBS에서 차단하고 RT에서 30 분 동안 세포를 배양한다. 세포를 밤새 필요한 경우 4 ℃에서 저장 될 수있다.
    5. 차 항체 희석을 준비한다. 15 ML 원뿔로 5 % BSA 피펫 200 μL / 웰 당 PBS (12 웰 = 2.4 mL) 및 5 % BSA 1 ㎖ 당 1 차 항체 μL를 추가 / PBS를 필요로했다. 진공 흡인 차단 완충액을 제거하고, 각 웰에 희석 된 일차 항체의 200 μL 분주.
      1. 1 세포를 인큐베이션 : 5 % BSA에서 희석 된 1000 개 차 항체 / PBS 실온에서 1 시간 동안 또는 밤새 4 ℃에서. 부화 후, PBS로 세포를 두 번 씻는다.
    6. 상기와 같이, 5 % BSA / PBS 동량의 차 항체 희석을 준비한다. 2,000 희석 : 1을 사용하여 원적외선 염료 복합 이차 항체를 추가합니다. 또한 추가믹스 훽스트 염료 1 ㎍ / mL로. PBS를 제거하고 각 웰에 믹스 200 μL를 추가합니다.
      1. 어둠 속에서 실온에서 1 시간 동안 인큐베이션. PBS로 3 회 세척, PBS에서 셀을두고 호일을 사용하여 빛으로부터 세포를 보호합니다. 필요한 경우 세포를 4 ℃에서 저장 될 수있다.
    7. 650 나노 미터 - 여기 파장 (594)와 반전 된 표면 형광 현미경의 400 배의 총 배율에서 이미지 셀.

    6. 웨스턴 블로 팅

    1. 얼음처럼 차가운 PBS로 두 번 3.6에서 세포를 씻으십시오. 얼음, 1X RIPA 50 μL와 세포를 Lyse 1X 프로테아제 억제제 칵테일 보충 버퍼입니다.
    2. 15 분 동안 4 ℃에서 락 해물을 5 분 샘플을 명확히하기위한 고속 (20,000 XG)에 1.5 ㎖의 튜브에 해물을 원심 분리 수집. 필요한 경우 세포 용 해물은 -80 ° C에서 장기 저장할 수 있습니다.
    3. 브래드 포드 분석을 이용하여 총 단백질을 정량화 된 새로운 1.5 ㎖의 마이크로 원심 튜브에 단백질의 동일한 양 나누어지는. 브린2- 머 캅토 에탄올이 보충 된 RIPA 완충액과 3X 램리 로딩 완충액을 사용하여 동일한 부피 샘플 g.
    4. 95 ° C에서 5 분 동안 1X 램 믈리 시료 완충액 로딩 샘플을 인큐베이션하고 45 분 동안 200 V에서 4-12 % 트리스 - 글리신 겔을 사용하여 SDS-PAGE를 실행. 세포주에 따라 단백질 적재 범위의 양. 어떤 경우에는, 총 단백질의 50 ~ 100 μg의는 중간 엽 세포 라인에서 E-cadherin의를 감지하기 위해 필요합니다.
    5. 1X 트리스 - 글리신 전송 버퍼에서 50 V에서 2 시간 동안 니트로 셀룰로오스 막 상으로 전달 단백질.
    6. 실온에서 밤새 또는 BSA 기반 차단 완충액 4 ° C에서 1 시간 동안 차단 막.
    7. 차단 완충액 5 mL 중에 1000 농도로 희석 멤브레인을 추가하고 부드러운 실온에서 또는 밤새 4 ℃에서 1 시간 동안 흔들 함께 배양 1 주에서 항체를 희석. 0.05 % 트윈 20과 함께 PBS에서 세척 막을 3 회.
    8. 적외선 형광 결합 secondar 함께 RT에서 1 시간 동안 막을 인큐베이션예 1에서 항체 : 위와 블로킹 완충액에 희석 20,000.
    9. 0.05 % 트윈 20과 함께 PBS로 막 두 번 세척하고 PBS에 다음 한 시간.
    10. 표준 적외선 형광 검출을 이용하여, 화상을 막.

    7. 앵커리지 독립적 인 성장 분석

    참고 : 자세한 부드러운 한천 분석 프로토콜의 28을 참조하십시오.

    1. 온수욕에서 42 ° C로 예열 멸균 배 DMEM 배지. 이 시간 동안, 열은 3 분 동안 전자 레인지에서 1 % 아가로 미리 멸균. 필요하거나 완전히 용해 될 때까지로 한 번에 추가로 30 초 동안 전자 레인지. 42 ° C의 물을 욕조에 아가로 이동합니다.
    2. 무균 후드에서 42 ° C의 물과 함께 비이커에 50ml의 원뿔형 튜브를 배치하고, 1을 1 % 아가 로즈 및 배 DMEM 배지를 혼합 : 6 웰 플레이트에 웰 당 혼합물을 1.5 mL의 1 비율 회계. 항상 DMEM 아가로 오스 피펫 오류에 대해 설명 할 / 추가로 준비하고 거품을 피하기 위해.
    3. 받는 사람 혼합물을 추가기포를 확보하지 웰의 측면, 형태 및 RT에서 30 분 동안 방치하자.
    4. 하부 층이 고화되는 동안 미디어를 흡입하고 1 ㎖의 PBS로 한번 세척 3 단계에서 형질 RD 세포의 각 그룹을 준비한다. 대기음 PBS 및 0.05 % 트립신, 0.2 mL를 첨가하고 5 분 동안 37 ℃에서 배양한다.
    5. 단일 세포 현탁액을 형성하기 위하여 미디어 씹다 세포를 0.8 mL의 트립신을 중화. 15 mL의 원뿔형 튜브에 세포 현탁액을 전송.
    6. 세포를 세어 웰 당 10,000 세포에 필요한 세포 현탁액의 양을 계산한다.
    7. 완전히 용해 될 때까지 한 번에 30 초 다음 3 분 동안 전자 레인지에서 0.6 % 아가로 가열한다. 42 ° C의 물을 욕조에 아가로 이동합니다.
    8. 무균 후드에서 42 ° C의 물과 함께 비이커에 50ml의 원뿔형 튜브를 놓는다. 6 웰 플레이트에 웰 당 1.5 ㎖의 혼합물을 제조 한 비 : 1의 0.6 % 아가로 희석 세포 현탁액을 혼합한다. 항상 피펫 오류를 설명하는 혼합 아가로 오스 / 여분의 세포 현탁액을 준비하고거품을 방지한다.
      참고 : 여기에 42 ° C에서 작동하는 것이 중요합니다. 온도가 너무 낮 으면, 혼합물 도금 전에 고체화되고, 42 ° C 이상의 온도가 세포 생존에 영향을 미칠 것이다.
    9. 세포를 여러 번으로 분쇄하여 잘 혼합 및 기포 형태를 보장하지 웰에 세포 혼합액을 추가하고, 실온에서 20 분 동안 응고하자.
    10. 각 보충 미디어 2 용액을 웰에 첨가하고 플레이트를 인큐베이터를 이동.
      1. 3~4주 또는 다세포 식민지 형성 할 때까지 일주일에 한 번 미디어를 변경합니다. 진공 흡인에 의해 용지를 제거 할 때 한천을 만지지 않도록주의하십시오. 대안 적으로, 액체 매질의 상층을 제거하는 P1000을 사용한다.
      2. 200 μL 니트로 블루 테트라 졸륨 클로라이드 용액을 첨가하여 (1 밀리그램 / PBS 용액에서) 소프트 한천 플레이트 얼룩과 37 ℃에서 밤새 배양 접시. 영상 PBS로 다음날 매체를 교체합니다.
      3. 거꾸로 현미경에 40X 총 배율에서 이미지 우물.
      4. 식민지 지역 및 번호 ImageJ에에 분석을 수행합니다. 플롯은 생물 복제의 콜로니 수는 표준 편차를 ± 의미한다.

    Subscription Required. Please recommend JoVE to your librarian.

    Representative Results

    or Start trial to access full content. Learn more about your institution’s access to JoVE content here

    육종 세포에서 MET 유도를위한 스키마

    육종 세포에서 MET와 같은 변화의 도입을위한 일반적인 타임 라인은도 1에 도시되어있다. 프로토콜은 미르-200 계열 (도 1b)의 형질 GRHL2 하였다 (도 1a)을 열 변환하는 것으로 시작한다. GRHL2 또는은 miR-200 가족만으로는 표현할 때 RD 세포의 모양에 영향을 미칠 수 없었다하지만 함께 GRHL2 미르-200S의 이소성 발현 RD 상피 세포와 같은 형태 변화의 결과. 증가 된 세포 - 세포 접촉 (도 1C)와 더 둥근 모양으로 방추형의 세포 형태의 변화.

    육종 세포에서 MET-같은 변화 유도

    GRHL2 미르 RD-200에 따라 세포의 형태 변화과발현 상피 마커 E-cadherin의 (도 2a)의 상향 조절을 수반 하였다. 미르 200S 첨가만으로는 E-cadherin의 상향 조절을하지만은 miR-200S 및 GRHL2 과발현이 상승적 E-cadherin의 발현 향상 결합 (도 2a를, 로그 스케일 생략). 또한, (도 2B) (도 1 조나의 occludens, ZO-1이라고 함) 상피 부착 분자, 및 TJP1는 EpCAM, 흰색 화살표의 세포 - 세포 연접에서 증가 하였다.

    MET 유도 육종 세포의 콜로니 형성 능력을 감소

    상피는 단백질의 상향 조절은 miR-200의 대상 알려진 중간 엽 유전자 Zeb1 및 Notch1 (도 3a)의 하향 조절을 수반 하였다. 콜로니 수 (도 3b)에 의해 측정 MET의 유도 RD 세포의 앵커리지 - 독립된 성장을 감소시켰다. 이 촉진제억제 형은 miR-200S 구동 한 WTH; GRHL2 과발현 앵커리지 독립적 성장 (도 3)의 증가를 이끌었다. 이 앵커리지 독립적 인 성장 (22)을 유도 GRHL2 식을 보여주는 이전의보고와 일치한다.

    그림 1
    도 1 : GRHL2 과발현은 miR-200와 형질과 MET 유도 타임 라인. 표적 세포에서의 이소성 GRHL2 과발현의 (A) 타임 라인. 표적 세포 미르-200 가족의 역 형질 감염을 통해 MET 유도 (B) 타임 라인. (C) GRHL2 미르-200 과발현 MET와 일치 표적 세포의 형태 변화되었다. 스케일 바 = 75 μm의 여기를 클릭하십시오이 그림의 더 큰 버전을 볼 수 있습니다.

    그림 2
    그림 2 : 동시 이상의 표현 GRHL2 미르-200S의 대상 세포에 MET되었다. GRHL2 미르-200S의 조합 발현은 mRNA의 모두에서 E-cadherin의 발현에 상승 효과 (평균 ± 표준 편차 값) 및 단백질 수준을 제작하는 동안은 miR-200S의 (A) 식 높은 E-cadherin의 발현되었다. (B) GRHL2 미르-200S 결합의 발현은 세포 간 접촉 (화살표)으로는 EpCAM 및 TJP1의 발현이 증가되었다. 스케일 바는 20 μm의 =. * 0.05 Tukey에의 사후 correction.This도 24을 참조로하여 수정 된 ANOVA를 이용하여 분석 <p를 나타낸다. 미생물학, 분자 세포 생물학, 볼륨 36, 문제 19, 2,503에서 2,513 사이, 2에 대한 저작권 © 미국 사회016 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

    그림 3
    그림 3 :은 miR-200S를 억제 중간 엽 마커 및 육종 세포의 감소 앵커리지 독립적 인 성장의 발현. (A) 오버 - 미르 200S 발현하지만 GRHL2는 Zeb1 및 Notch1 mRNA 발현 (평균값 ± 표준 편차)을 억제 하였다. 과발현은 miR-200S의 (B)이지만 육종 세포의 억제되지 GRHL2 anoikis 저항. 염색 콜로니 (눈금 막대 = 200 μm의) 콜로니 수 (평균 ± 표준 편차 값)의 정량의 대표적인 이미지를 나타낸다. * p <0.05, R로부터 수정 된 Tukey에의 사후 correction.This도 ANOVA로 분석하여 나타낸다명 서 (24). 미생물학, 분자 세포 생물학, 볼륨 36, 문제 19, 2,503에서 2,513 사이, 2016 년에 대한 저작권 © 미국 사회는 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

    그림 3
    보충 비디오 : 빈 벡터 및 음성 대조군의 miRNA를 발현하는 RD 세포. 영화는 빈 벡터 및 자동화 라이브 셀 이미 저를 사용하여 두 시간마다 획득 한 음성 대조군의 miRNA로 트랜 RD 세포의 이미지에서 컴파일 된. 이 동영상을 보려면 여기를 클릭하십시오. (다운로드하려면 마우스 오른쪽 버튼을 클릭합니다.)

    그림 3 />
    보충 비디오 2 : GRHL2-EGFP 및 음성 대조군 miRNA가 표현 RD 세포. 영화는 자동화 된 라이브 셀 이미 저를 사용하여 두 시간마다 획득 GRHL2-EGFP 및 음성 대조군 miRNA가로 트랜 RD 세포의 이미지에서 컴파일 된. 이 동영상을 보려면 여기를 클릭하십시오. (다운로드하려면 마우스 오른쪽 버튼을 클릭합니다.)

    그림 3
    보충 비디오 3 : 빈 벡터 및 miR200의 miRNAs 표현 RD 세포. 영화는 자동화 된 라이브 셀 이미 저를 사용하여 두 시간마다 획득 한 빈 벡터 및 miR200의 miRNA로 트랜 RD 세포의 이미지에서 컴파일 된. 이 동영상을 보려면 여기를 클릭하십시오. (다운로드하려면 마우스 오른쪽 버튼을 클릭합니다.)

    NT "FO : 유지 - together.within 페이지 ="1 "> 그림 3
    보충 비디오 4 : GRHL2-EGFP 및 miR200의 miRNAs 표현 RD 세포. GRHL2-EGFP 및 miR200의 miRNA로 트랜 RD 세포의 이미지에서 컴파일 된 비디오는 자동화 된 라이브 셀 이미 저를 사용하여 두 시간마다 인수했다. 이 동영상을 보려면 여기를 클릭하십시오. (다운로드하려면 마우스 오른쪽 버튼을 클릭합니다.)

    Subscription Required. Please recommend JoVE to your librarian.

    Discussion

    or Start trial to access full content. Learn more about your institution’s access to JoVE content here

    육종은 중간 엽 계보의 희귀하지만, 매우 공격적인 암이다. 자신의 중간 엽 혈통에도 불구하고, 육종의 부분 집합은 더 상피와 같은 상태로 형질 전환을 겪을 것으로 보인다. 더 상피와 같은 종양을 가진 환자가 24 덜 공격적으로이 MET-같은 스위치는, 예후 관련이있다. 임상 관련성에도 불구하고, 육종 이러한 형질 전환을 운전하는 분자 메커니즘을 해결 몇몇 연구가있다.

    육종 세포에서 MET-같은 전환을 검토하기 위해, 우리는 상피 요인 GRHL2와 미르-200 가족의 발현을 결합하여 MET-유도 모델을 개발했다. 이 방법은 급속히 형태와 유전자 발현 변화에 의해 측정되는 더 많은 상피 추천 될 육종 세포를 유도한다. 육종 세포에서 MET를 유도하기 위해이 프로토콜을 사용하여 육종 침략 등을 드라이브 표현형에서 이러한 전환의 영향의 연구를 용이하게마이그레이션, 침입, 증식과 죽음에 저항하는 방법으로 생물학에서 이러한 변경의 각 약물 저항에 영향을 줄 수 있습니다.

    상피 유래 암종의 맥락에서 하나 개의 중간 엽 인자의 발현은 종종 EMT (14)를 유도하기에 충분하다. 그러나, MET 개의 상피 요인 GRHL2 미르-200S의 발현이 유도 육종 모델에서 요구된다. GRHL2 견고하게 ZEB1 24 등만을 상피 유전자 리프레의 결과 miR-200 기반의 억제의 존재하에 상피 유전자를 활성화 할 수있는 동안 흥미롭게 미르-200S 혼자 GRHL2보다 MET 대부분 생체에 강한 영향을 미쳤다. 그것은 어떤 간엽 세포 유형 상피 유전자가 될 필요가있다 모두 탈 억제 (예를 통해 미르 200S) 및 활성 (예를 통해 GRHL2) MET를 구동한다.

    우리는 다른 CEL에서 GRHL2 발현의 수준에서 변화를 경험했다L 라인. 이 문제를 극복하기 위해, 우리는 또한 이전 실험에 EGFP 양성 세포 유동 세포 계측법에 의해 정렬 EGFP 25 표현하는 GRHL2 발현 플라스미드를 사용했다. 서로 다른 세포 유형 미르-200S와 GRHL2의 기능을 확인하는 것이 중요하다. EMT는 세포주, 암 종류, 치료 등 그러므로에 기초한 콘텍스트 - 의존 변화를 가질 수 상피 및 간엽 - 관련 유전자의 발현에 기초하여 스펙트럼으로 볼 때, 우리는에 미르 200 GRHL2 의해 조절 다섯 개 유전자 분석 세포 상황에 따라 변화를 설명. 이 분석의 또 다른 단서는 MET 유도 용은 miR-200S의 일시적 형질 전환에 의존한다. 여러 반복 형질이 필요하게되면 따라서, 장기간의 실험은 비용이 많이 들고 복잡해질 수 있습니다. 이것은은 miR-200의 발현 플라스미드를 사용하여 극복 될 수있다.

    다른 연구는 육종에서 MET의 증거를보고했다. 예를 들어, MET는 leiomyosa의 하위 집합에서 관찰되었다rcomas와는 환자의 생존율과 연관이 있었다. 기계적으로, 양 등. siRNA와 함께 슬러그의 평활근 육종 세포주 억제 MET-29 등의 변화를 유도하기에 충분한 것을 발견했다. 마찬가지로, 중간 엽 줄기 세포의 또 다른 중간 엽 인자, 달팽이, 고갈 생쥐의 육종 (30) 형성을 감소시켰다. 따라서, 세포의 종류에 따라 다를 수있는 MET 같은 표현형에 다중 경로가 존재하는 문헌으로부터 명백하다. 이 MET를 유도 할 수있는 유일한 방법은 아니지만, 우리는 횡문근 육종 (RD 세포)와 골육종 (143B 세포)를 포함하는 두 개의 육종의 아형에 MET를 유도하기 위해 우리의 방법을 사용했다. 앞으로, 육종 세포의 넓은 범위에서 서로 다른 방법을 비교하는 흥미로운 일이 될 것이다. 예를 들어, 특정 육종 하위 유형 MET 유도에 더 또는 덜 민감하게 기본 유전 적 또는 후생 유전 학적 변화가 있습니까?

    MET의 영향을 확인육종 세포의 생물학적 출력의 다양한에 대한 자세한 상피 같은 육종 환자가 개선 된 예후 이유의 더 나은 이해를 제공 할 수있다. 또한, 우리의 생물학적 이해를 깊게하고 육종 환자의 현재 치료에 대한 응답에 통보 할 상태 사이의 형질 전환을 운전에 대한 치료의 영향을 이해.

    Subscription Required. Please recommend JoVE to your librarian.

    Disclosures

    저자가 공개하는 게 없다.

    Acknowledgments

    JAS는 듀크 암 연구소, 듀크 대학 비뇨 생식기 종양학 연구소 및 정형 외과의 듀크 대학교의 지원을 인정합니다. HL은 이론 생물 물리학에 대한 국립 과학 재단 (National Science Foundation, NSF) 센터에 의해 지원되었다 (NSF PHY-1427654)와 NSF DMS-1361411, 텍사스 주 암 연구에 CPRIT로 (암 예방 및 텍사스 연구소) 학술 라이스 대학 (Rice University)에서. KEW는 NIH F32 CA192630 MKJ 지원하고 HL 메리 C. Farach-카슨 JN Onuchic 사미르 M. Hanash, 케네스 J 피엔타, 도널드 S. 코피 유용한 논의 혜택.

    Materials

    Name Company Catalog Number Comments
    Countess automated counter Life technologies AMQAX1000
    Countess cell counting chamber slides Invitrogen C10283
    SimpliAmp Thermal Cycler Thermo Fisher A24811
    Odyssey Fc LI-COR Inc
    ViiA7 Real Time PCR System Thermo Fisher 4453536
    PCR microplate Corning 321-29-051
    KAPA SYBR Fast Universal qPCR Kit KAPA Biosystems KK4602
    Starting Block (PBS) Blocking Buffer Thermo Fisher 37538 BSA-based blocking buffer
    Agarose General Purpose LE Genesee Scientific 20-102
    10x Tris/Glycine/SDS Buffer Bio-Rad Laboratories Inc 161-0732 Running buffer
    10x Tris/Glycine Buffer Bio-Rad Laboratories Inc 161-0734 Transfer buffer
    RIPA Buffer Sigma Life Sciences SLBG8489
    Amersham Protran 0.45 μm nitrocellulose GE Healthcare Lifesciences 10600012
    Quick-RNA MiniPrep Kit Genesee Scientific 11-358
    Laemmli Sample Buffer (4X) Bio-Rad Laboratories Inc 1610747
    Mini Trans-Blot Cell Bio-Rad Laboratories Inc 1703930
    Mini-Protean Tetra Cell Bio-Rad Laboratories Inc 1658005EDU
    DPBS Life technologies 14190-144
    0.05% Trypsin-EDTA Life technologies 11995-065
    DMEM Life technologies 11995-065
    Lipofectamine RNAi Max Thermo Fisher 13778150
    Lipofectamine 2000 Ragents Thermo Fisher 11668019
    Penicillin Streptomycin Life technologies 15140-122
    miRVana miRNA mimic negative control #1 Thermo Fisher 4464058 neg miRNA
    hsa-miR-200 mirVana miRNA mimic Thermo Fisher 4464066 miR200A
    has-miR-200 mirVana miRNA mimic Thermo Fisher 4404066 miR200B
    has-miR-200 mirVana miRNA mimic Thermo Fisher 4404066 miR200C
    Opti-MEM Life technologies 11088-021 serum-free media
    anti-Ecadherin antibody BD Bioscience 610182
    anti-beta actin Santa Cruz Biotechnology sc-69879
    anti-EpCam Ab Serotec MCA18706
    anti-ZO1 Invitrogen 402200
    IRDye 800W LI-COR Inc 925-32210
    IRDye 680 LI-COR Inc 926-32223
    anti-mouse AlexaFluor 647 Thermo Fisher A211241
    anti-rabbit AlexaFluor 647 Thermo Fisher ab150075
    Halt Protease and Phosphatesse Inhibitor Thermo Fisher 1861281
    Precision Plus Protein Dual Color Bio-Rad Laboratories Inc 161-0374
    Partec CellTrics Sysmex 04-004-2326 30 μm filter for flow
    GAPDH-F IDT AGCCACATCGCTCAGACAC
    GAPDH-R IDT GCCCAATACGACCAAATCC
    Ecadherin-F IDT TGGAGGAATTCTTGCTTTGC
    Ecadherin-R IDT CGCTCTCCTCCGAAGAAAC
    ZEB1-F IDT GCATACAGAACCCAACTTGAACGTC
    ZEB1-R IDT CGATTACACCCAGACTGC
    NOTCH-F IDT GGCAATCCGAGGACTATGAG
    NOTCH-R IDT CTCAGAACGCACTCGTTGAT
    nitro blue tetrazolium  Sigma N5514
    hexadimethrine bromide Sigma H9268 polybrene
    3 mL syringe BD Bioscience 309657
    Sterile syringe filter VWR 28145-505
    5mL polypropylene round-bottom tube 352063 flow cytometry tubes
    High-Capacity cDNA Reverse Transcription Kit Thermo Fisher 4368814 reverse transcription kit
    4% paraformaldyhyde Santa Cruz Biotechnology sc-281612
    Triton-X100 Sigma 93443
    bovine serum albumin Sigma A7906

    DOWNLOAD MATERIALS LIST

    References

    1. Weber, C. E., Li, N. Y., Wai, P. Y., Kuo, P. C. Epithelial-mesenchymal transition, TGF-beta, and osteopontin in wound healing and tissue remodeling after injury. J Burn Care Res. 33, (3), 311-318 (2012).
    2. Galichon, P., Finianos, S., Hertig, A. EMT-MET in renal disease: should we curb our enthusiasm. Cancer Lett. 341, (1), 24-29 (2013).
    3. Carew, R. M., Wang, B., Kantharidis, P. The role of EMT in renal fibrosis. Cell Tissue Res. 347, (1), 103-116 (2012).
    4. Willis, B. C., Borok, Z. TGF-beta-induced EMT: mechanisms and implications for fibrotic lung disease. Am J Physiol Lung Cell Mol Physiol. 293, (3), L525-L534 (2007).
    5. Ye, X., Weinberg, R. A. Epithelial-Mesenchymal Plasticity: A Central Regulator of Cancer Progression. Trends Cell Biol. 25, (11), 675-686 (2015).
    6. Li, L., Li, W. Epithelial-mesenchymal transition in human cancer: comprehensive reprogramming of metabolism, epigenetics, and differentiation. Pharmacol Ther. 150, 33-46 (2015).
    7. Tsai, J. H., Yang, J. Epithelial-mesenchymal plasticity in carcinoma metastasis. Genes Dev. 27, (20), 2192-2206 (2013).
    8. Bitting, R. L., Schaeffer, D., Somarelli, J. A., Garcia-Blanco, M. A., Armstrong, A. J. The role of epithelial plasticity in prostate cancer dissemination and treatment resistance. Cancer Metastasis Rev. 33, (2-3), 441-468 (2014).
    9. Schaeffer, D., Somarelli, J. A., Hanna, G., Palmer, G. M., Garcia-Blanco, M. A. Cellular Migration and Invasion Uncoupled: Increased Migration Is Not an Inexorable Consequence of Epithelial-to-Mesenchymal Transition. Mol Cell Biol. 34, (18), 3486-3499 (2014).
    10. Mathow, D., et al. Zeb1 affects epithelial cell adhesion by diverting glycosphingolipid metabolism. EMBO Rep. 16, (3), 321-331 (2015).
    11. Ware, K. E., et al. A mechanism of resistance to gefitinib mediated by cellular reprogramming and the acquisition of an FGF2-FGFR1 autocrine growth loop. Oncogenesis. 2, e39 (2013).
    12. Yauch, R. L., et al. Epithelial versus mesenchymal phenotype determines in vitro sensitivity and predicts clinical activity of erlotinib in lung cancer patients. Clin Cancer Res. 11, (24 Pt 1), 8686-8698 (2005).
    13. Jolly, M. K., et al. Towards elucidating the connection between epithelial-mesenchymal transitions and stemness. J R Soc Interface. 11, (101), 20140962 (2014).
    14. Mani, S. A., et al. The epithelial-mesenchymal transition generates cells with properties of stem cells. Cell. 133, (4), 704-715 (2008).
    15. Chen, L., et al. Metastasis is regulated via microRNA-200/ZEB1 axis control of tumour cell PD-L1 expression and intratumoral immunosuppression. Nat Commun. 5, 5241 (2014).
    16. Nicolazzo, C., Gradilone, A. Significance of circulating tumor cells in soft tissue sarcoma. Anal Cell Pathol (Amst). 697395 (2015).
    17. Somarelli, J. A., et al. Mesenchymal-epithelial transition in sarcomas is controlled by the combinatorial expression of miR-200s and GRHL2. Mol Cell Biol. (2016).
    18. Bae, Y. K., Choi, J. E., Kang, S. H., Lee, S. J. Epithelial-Mesenchymal Transition Phenotype Is Associated with Clinicopathological Factors That Indicate Aggressive Biological Behavior and Poor Clinical Outcomes in Invasive Breast Cancer. J Breast Cancer. 18, (3), 256-263 (2015).
    19. Humphries, B., Yang, C. The microRNA-200 family: small molecules with novel roles in cancer development, progression and therapy. Oncotarget. 6, (9), 6472-6498 (2015).
    20. Renner, M., et al. MicroRNA profiling of primary high-grade soft tissue sarcomas. Genes Chromosomes Cancer. 51, (11), 982-996 (2012).
    21. Petrof, G., et al. Mutations in GRHL2 result in an autosomal-recessive ectodermal Dysplasia syndrome. Am J Hum Genet. 95, (3), 308-314 (2014).
    22. Werner, S., et al. Dual roles of the transcription factor grainyhead-like 2 (GRHL2) in breast cancer. J Biol Chem. 288, (32), 22993-23008 (2013).
    23. Werth, M., et al. The transcription factor grainyhead-like 2 regulates the molecular composition of the epithelial apical junctional complex. Development. 137, (22), 3835-3845 (2010).
    24. Somarelli, J. A., et al. Mesenchymal-Epithelial Transition in Sarcomas Is Controlled by the Combinatorial Expression of MicroRNA 200s and GRHL2. Mol Cell Biol. 36, (19), 2503-2513 (2016).
    25. Varma, S., et al. The transcription factors Grainyhead-like 2 and NK2-homeobox 1 form a regulatory loop that coordinates lung epithelial cell morphogenesis and differentiation. J Biol Chem. 287, (44), 37282-37295 (2012).
    26. Pruitt, S. C., Mielnicki, L. M., Stewart, C. C. Analysis of fluorescent protein expressing cells by flow cytometry. Methods Mol Biol. 263, 239-258 (2004).
    27. Zhao, Z., et al. A high-content morphological screen identifies novel microRNAs that regulate neuroblastoma cell differentiation. Oncotarget. 5, (9), 2499-2512 (2014).
    28. Borowicz, S., et al. The soft agar colony formation assay. J Vis Exp. (92), e51998 (2014).
    29. Yang, J., et al. Integrated proteomics and genomics analysis reveals a novel mesenchymal to epithelial reverting transition in leiomyosarcoma through regulation of slug. Mol Cell Proteomics. 9, (11), 2405-2413 (2010).
    30. Alba-Castellon, L., et al. Snail1 expression is required for sarcomagenesis. Neoplasia. 16, (5), 413-421 (2014).
    31. Takaishi, M., Tarutani, M., Takeda, J., Sano, S. Mesenchymal to Epithelial Transition Induced by Reprogramming Factors Attenuates the Malignancy of Cancer Cells. PLoS One. 11, (6), e0156904 (2016).

    Erratum

    Formal Correction: Erratum: Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells
    Posted by JoVE Editors on 07/03/2018. Citeable Link.

    An erratum was issued for: Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells. An author name was updated.

    One of the authors' names was corrected from:

    Shenghan Xu

    to:

    Shengnan Xu

    육종 세포의 중간 엽 상피 전환 유도
    Play Video
    PDF DOI DOWNLOAD MATERIALS LIST

    Cite this Article

    Ware, K. E., Gilja, S., Xu, S., Shetler, S., Jolly, M. K., Wang, X., Bartholf Dewitt, S., Hish, A. J., Jordan, S., Eward, W., Levine, H., Armstrong, A. J., Somarelli, J. A. Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells. J. Vis. Exp. (122), e55520, doi:10.3791/55520 (2017).More

    Ware, K. E., Gilja, S., Xu, S., Shetler, S., Jolly, M. K., Wang, X., Bartholf Dewitt, S., Hish, A. J., Jordan, S., Eward, W., Levine, H., Armstrong, A. J., Somarelli, J. A. Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells. J. Vis. Exp. (122), e55520, doi:10.3791/55520 (2017).

    Less
    Copy Citation Download Citation Reprints and Permissions
    View Video

    Get cutting-edge science videos from JoVE sent straight to your inbox every month.

    Waiting X
    simple hit counter