육종 세포의 중간 엽 상피 전환 유도
Summary
우리는 여기에서 마이크로 RNA-200의 가족과 같은 grainyhead 2 (GRHL2)의 결합에 기초 이소성 발현 육종 세포에서 중간 엽 상피 전환 (MET)을 유도하는 세포 배양 방법을 제시한다. 이 방법은 암의 공격성과 치료에 대한 표현형 가소성의 생물학적 영향을 이해하기 더 적합합니다.
Abstract
표현형 소성은 세포가 일시적으로 다른 혈통의 특성을 얻을하는 현상을 말한다. 암 진행하는 동안, 표현형의 가소성은 침공, 보급 및 전이를 구동한다. 표현형 가소성 연구의 대부분은 상피 유래 암의 맥락에서되었지만 실제로, 그것은 mesenchymal- 유사한 현상을 겪고 육종의 부분 집합으로, 또한 표현형의 가소성을 전시, 기원 중간 엽 있습니다 육종을 밝혀 상피 성 전이 (MET). 여기서는 각각 순차적 GRHL2 및 미르 200 패밀리는 세포 형질 도입 및 형질 전환을 이용하여 표현 육종 환자 samples.We 관찰이 메티오닌과 같은 현상을 모방 미르-200 가족 grainyhead 같은 2 (GRHL2)를 포함하는 방법을 개발 더 나은 육종 세포에서 이러한 형질 전환의 분자 토대를 이해합니다. 미르 200S 및 GRHL2 표현 육종 세포는 상피 향상된 characterist 입증세포 형태와 상피와 중간 엽 바이오 마커의 변화에 ICS. 이러한 방법을 사용하여 앞으로의 연구는 더 나은 등의 이동, 침윤, 전이 성향 및 치료 저항 등의 육종 세포에 대한 MET-같은 프로세스의 표현형의 결과를 이해하는 데 사용할 수 있습니다.
Introduction
표현형 가소성 세포 표현형 사이의 가역적 인 변화를 의미하고, 일반적으로 두 가지 유형, 상피 간 간엽 (EMT) 전환 및 중간 엽 간 상피 천이 (MET)로 분할된다. 이 표현형의 가소성은 개발 및 상처 치유 1과 다세포 생물의 정상적인 과정에서 중요한 역할을한다; 그러나,이 같은 경로 유전자 발현 프로그램 또한 섬유증, 질병을 초래할 수있다 (검토를 2, 3, 4), 암 전이 (참고 문헌 5, 6, 7의 평가 8). 전이 동안, 예를 들어, EMT 세포 극성, 세포 – 세포 상호 작용을 방해하고, 침략 9, 10 추진하고 있습니다. 함께, EMT 기여암 세포의 보급을 촉진하는 표현형 상태로의. 또한 EMT는 암 세포 대사 (6)의 규제 완화 약물 저항 (11), (12)의 개발을 포함 공격적인 표현형을 유도 다른 표현형 변화, 증가 된 종양 개시 능력 (13), (14)와 면역 회피 15 호스트의 호스트로 이끈다.
표현형 소성 잘 암의 진행에서 연구되고있다; 그러나, 육종은 표현형의 가소성을 나타낸다. 암의 표현형 가소성 같은 드라이버 중 일부는 또한 육종 소성 및 공격성에 기여하는 것처럼 흥미롭게도,이 나타납니다. 예를 들어, 육종 환자의 순환 성 종양 세포 (CTCS은)는 EpCAM, 일반적으로 상피 세포 (16)에서 발견되는 세포 표면 단백질을 발현하는 것으로 나타났다. ADDI전통적으로, 250 개 연조직 육종 샘플 상피 형상 또는 간엽 같은 유전자 발현에 기초로 분류 하였다. 상피와 같은 바이오 마커의 서명이있는 환자는 중간 엽 같은 바이오 마커의 서명 (17)을 가진 환자보다 더 나은 예후를했다. 이것은 더 상피와 같은 암 환자보다 중간 엽 같은 종양 18 환자에 비해 더 나은 결과를 보유하고있는 많은 암과 일치한다.
일부 육종이 생체와 MET와 일치 유전자 발현 경로를 표시하지만,이 표현형 가소성의 분자 토대는 잘 이해되지 유지. 육종 MET의 메커니즘과 드라이버를 연구하기 위해 우리는 두 가지 상피 특정 요소를 사용하여 MET 유도의 모델을 개발, 마이크로 RNA (은 miR) -200 가족과 grainyhead 같은 2 (GRHL2). 미르-200S는 messen의 3 '의 UTRs에 결합함으로써 유전자 발현을 조절하는 작은 비 RNA를 코딩하는 가족게르 RNA와 단백질에 방지 번역. 미르 141, 미르 (200A)를 포함 하나, 미르-200B, 200C 미르, 미르-429을 포함한 타 – 미르-200 가족 개의 서브 그룹들로 구성된다. 미르-200 계열의 구성원은 상피 조직에 충실 미르-200S 손실은 암 (19)의 전이와 관련된다. 미르-200 계열은 정상 조직에 비해 20 연조직 육종에서 하향 조절된다. 미르-200S 유사하게, GRHL2 상피 개발 (21)에 대한 중요 핵심 레귤레이터이다. GRHL2 전사 인자는 E-cadherin의 상피 유전자를 상향 조절하는 방법은 두 가지 작용 1) 상피 세포에서 GRHL2 직접 EMT 마스터 레귤레이터 억압을 ZEB1 22; 2) GRHL2 직접 상피 유전자 (23)의 전사를 활성화합니다. 우리의 이전 연구는 것으로 나타났습니다 육종 세포 미르-200S와 GRHL2의 결합 된 표현MET-같은 표현형 (24)를 유도한다. 여기서는은 miR-200S 및 GRHL2의 이소성 발현하여 육종 세포에서 MET 유도 시험 관내 모델을 작성하는 구체적인 프로토콜을 제안한다.
Protocol
Representative Results
Discussion
육종은 중간 엽 계보의 희귀하지만, 매우 공격적인 암이다. 자신의 중간 엽 혈통에도 불구하고, 육종의 부분 집합은 더 상피와 같은 상태로 형질 전환을 겪을 것으로 보인다. 더 상피와 같은 종양을 가진 환자가 24 덜 공격적으로이 MET-같은 스위치는, 예후 관련이있다. 임상 관련성에도 불구하고, 육종 이러한 형질 전환을 운전하는 분자 메커니즘을 해결 몇몇 연구가있다.
<p cla…Disclosures
The authors have nothing to disclose.
Acknowledgements
JAS는 듀크 암 연구소, 듀크 대학 비뇨 생식기 종양학 연구소 및 정형 외과의 듀크 대학교의 지원을 인정합니다. HL은 이론 생물 물리학에 대한 국립 과학 재단 (National Science Foundation, NSF) 센터에 의해 지원되었다 (NSF PHY-1427654)와 NSF DMS-1361411, 텍사스 주 암 연구에 CPRIT로 (암 예방 및 텍사스 연구소) 학술 라이스 대학 (Rice University)에서. KEW는 NIH F32 CA192630 MKJ 지원하고 HL 메리 C. Farach-카슨 JN Onuchic 사미르 M. Hanash, 케네스 J 피엔타, 도널드 S. 코피 유용한 논의 혜택.
Materials
| Countess automated counter | Life technologies | AMQAX1000 | |
| Countess cell counting chamber slides | Invitrogen | C10283 | |
| SimpliAmp Thermal Cycler | Thermo Fisher | A24811 | |
| Odyssey Fc | LI-COR Inc | ||
| ViiA7 Real Time PCR System | Thermo Fisher | 4453536 | |
| PCR microplate | Corning | 321-29-051 | |
| KAPA SYBR Fast Universal qPCR Kit | KAPA Biosystems | KK4602 | |
| Starting Block (PBS) Blocking Buffer | Thermo Fisher | 37538 | BSA-based blocking buffer |
| Agarose General Purpose LE | Genesee Scientific | 20-102 | |
| 10X Tris/Glycine/SDS Buffer | Bio-Rad Laboratories Inc | 161-0732 | Running buffer |
| 10X Tris/Glycine Buffer | Bio-Rad Laboratories Inc | 161-0734 | Transfer buffer |
| RIPA Buffer | Sigma Life Sciences | SLBG8489 | |
| Amersham Protran 0.45 μm nitrocellulose | GE Healthcare Lifesciences | 10600012 | |
| Quick-RNA MiniPrep Kit | Genesee Scientific | 11-358 | |
| Laemmli Sample Buffer (4X) | Bio-Rad Laboratories Inc | 1610747 | |
| Mini Trans-Blot Cell | Bio-Rad Laboratories Inc | 1703930 | |
| Mini-Protean Tetra Cell | Bio-Rad Laboratories Inc | 1658005EDU | |
| DPBS | Life technologies | 14190-144 | |
| 0.05% Trypsin-EDTA | Life technologies | 11995-065 | |
| DMEM | Life technologies | 11995-065 | |
| Lipofectamine RNAi Max | Thermo Fisher | 13778150 | |
| Lipofectamine 2000 Ragents | Thermo Fisher | 11668019 | |
| Penicillin Streptomycin | Life technologies | 15140-122 | |
| miRVana miRNA mimic negative control #1 | Thermo Fisher | 4464058 | neg miRNA |
| hsa-miR-200 mirVana miRNA mimic | Thermo Fisher | 4464066 | miR200A |
| has-miR-200 mirVana miRNA mimic | Thermo Fisher | 4404066 | miR200B |
| has-miR-200 mirVana miRNA mimic | Thermo Fisher | 4404066 | miR200C |
| Opti-MEM | Life technologies | 11088-021 | serum-free media |
| anti-Ecadherin antibody | BD Bioscience | 610182 | |
| anti-beta actin | Santa Cruz Biotechnology | sc-69879 | |
| anti-EpCam | Ab Serotec | MCA18706 | |
| anti-ZO1 | Invitrogen | 402200 | |
| IRDye 800W | LI-COR Inc | 925-32210 | |
| IRDye 680 | LI-COR Inc | 926-32223 | |
| anti-mouse AlexaFluor 647 | Thermo Fisher | A211241 | |
| anti-rabbit AlexaFluor 647 | Thermo Fisher | ab150075 | |
| Halt Protease and Phosphatesse Inhibitor | Thermo Fisher | 1861281 | |
| Precision Plus Protein Dual Color | Bio-Rad Laboratories Inc | 161-0374 | |
| Partec CellTrics | Sysmex | 04-004-2326 | 30 μm filter for flow |
| GAPDH-F | IDT | AGCCACATCGCTCAGACAC | |
| GAPDH-R | IDT | GCCCAATACGACCAAATCC | |
| Ecadherin-F | IDT | TGGAGGAATTCTTGCTTTGC | |
| Ecadherin-R | IDT | CGCTCTCCTCCGAAGAAAC | |
| ZEB1-F | IDT | GCATACAGAACCCAACTTGAACGTC | |
| ZEB1-R | IDT | CGATTACACCCAGACTGC | |
| NOTCH-F | IDT | GGCAATCCGAGGACTATGAG | |
| NOTCH-R | IDT | CTCAGAACGCACTCGTTGAT | |
| nitro blue tetrazolium | Sigma | N5514 | |
| hexadimethrine bromide | Sigma | H9268 | polybrene |
| 3 mL syringe | BD Bioscience | 309657 | |
| Sterile syringe filter | VWR | 28145-505 | |
| 5mL polypropylene round-bottom tube | 352063 | flow cytometry tubes | |
| High-Capacity cDNA Reverse Transcription Kit | Thermo Fisher | 4368814 | reverse transcription kit |
| 4% paraformaldyhyde | Santa Cruz Biotechnology | sc-281612 | |
| Triton-X100 | Sigma | 93443 | |
| bovine serum albumin | Sigma | A7906 |
References
- Weber, C. E., Li, N. Y., Wai, P. Y., Kuo, P. C. Epithelial-mesenchymal transition, TGF-beta, and osteopontin in wound healing and tissue remodeling after injury. J Burn Care Res. 33 (3), 311-318 (2012).
- Galichon, P., Finianos, S., Hertig, A. EMT-MET in renal disease: should we curb our enthusiasm. Cancer Lett. 341 (1), 24-29 (2013).
- Carew, R. M., Wang, B., Kantharidis, P. The role of EMT in renal fibrosis. Cell Tissue Res. 347 (1), 103-116 (2012).
- Willis, B. C., Borok, Z. TGF-beta-induced EMT: mechanisms and implications for fibrotic lung disease. Am J Physiol Lung Cell Mol Physiol. 293 (3), L525-L534 (2007).
- Ye, X., Weinberg, R. A. Epithelial-Mesenchymal Plasticity: A Central Regulator of Cancer Progression. Trends Cell Biol. 25 (11), 675-686 (2015).
- Li, L., Li, W. Epithelial-mesenchymal transition in human cancer: comprehensive reprogramming of metabolism, epigenetics, and differentiation. Pharmacol Ther. 150, 33-46 (2015).
- Tsai, J. H., Yang, J. Epithelial-mesenchymal plasticity in carcinoma metastasis. Genes Dev. 27 (20), 2192-2206 (2013).
- Bitting, R. L., Schaeffer, D., Somarelli, J. A., Garcia-Blanco, M. A., Armstrong, A. J. The role of epithelial plasticity in prostate cancer dissemination and treatment resistance. Cancer Metastasis Rev. 33 (2-3), 441-468 (2014).
- Schaeffer, D., Somarelli, J. A., Hanna, G., Palmer, G. M., Garcia-Blanco, M. A. Cellular Migration and Invasion Uncoupled: Increased Migration Is Not an Inexorable Consequence of Epithelial-to-Mesenchymal Transition. Mol Cell Biol. 34 (18), 3486-3499 (2014).
- Mathow, D., et al. Zeb1 affects epithelial cell adhesion by diverting glycosphingolipid metabolism. EMBO Rep. 16 (3), 321-331 (2015).
- Ware, K. E., et al. A mechanism of resistance to gefitinib mediated by cellular reprogramming and the acquisition of an FGF2-FGFR1 autocrine growth loop. Oncogenesis. 2, e39 (2013).
- Yauch, R. L., et al. Epithelial versus mesenchymal phenotype determines in vitro sensitivity and predicts clinical activity of erlotinib in lung cancer patients. Clin Cancer Res. 11 (24 Pt 1), 8686-8698 (2005).
- Jolly, M. K., et al. Towards elucidating the connection between epithelial-mesenchymal transitions and stemness. J R Soc Interface. 11 (101), 20140962 (2014).
- Mani, S. A., et al. The epithelial-mesenchymal transition generates cells with properties of stem cells. Cell. 133 (4), 704-715 (2008).
- Chen, L., et al. Metastasis is regulated via microRNA-200/ZEB1 axis control of tumour cell PD-L1 expression and intratumoral immunosuppression. Nat Commun. 5, 5241 (2014).
- Nicolazzo, C., Gradilone, A. Significance of circulating tumor cells in soft tissue sarcoma. Anal Cell Pathol (Amst). , 697395 (2015).
- Somarelli, J. A., et al. Mesenchymal-epithelial transition in sarcomas is controlled by the combinatorial expression of miR-200s and GRHL2. Mol Cell Biol. , (2016).
- Bae, Y. K., Choi, J. E., Kang, S. H., Lee, S. J. Epithelial-Mesenchymal Transition Phenotype Is Associated with Clinicopathological Factors That Indicate Aggressive Biological Behavior and Poor Clinical Outcomes in Invasive Breast Cancer. J Breast Cancer. 18 (3), 256-263 (2015).
- Humphries, B., Yang, C. The microRNA-200 family: small molecules with novel roles in cancer development, progression and therapy. Oncotarget. 6 (9), 6472-6498 (2015).
- Renner, M., et al. MicroRNA profiling of primary high-grade soft tissue sarcomas. Genes Chromosomes Cancer. 51 (11), 982-996 (2012).
- Petrof, G., et al. Mutations in GRHL2 result in an autosomal-recessive ectodermal Dysplasia syndrome. Am J Hum Genet. 95 (3), 308-314 (2014).
- Werner, S., et al. Dual roles of the transcription factor grainyhead-like 2 (GRHL2) in breast cancer. J Biol Chem. 288 (32), 22993-23008 (2013).
- Werth, M., et al. The transcription factor grainyhead-like 2 regulates the molecular composition of the epithelial apical junctional complex. Development. 137 (22), 3835-3845 (2010).
- Somarelli, J. A., et al. Mesenchymal-Epithelial Transition in Sarcomas Is Controlled by the Combinatorial Expression of MicroRNA 200s and GRHL2. Mol Cell Biol. 36 (19), 2503-2513 (2016).
- Varma, S., et al. The transcription factors Grainyhead-like 2 and NK2-homeobox 1 form a regulatory loop that coordinates lung epithelial cell morphogenesis and differentiation. J Biol Chem. 287 (44), 37282-37295 (2012).
- Pruitt, S. C., Mielnicki, L. M., Stewart, C. C. Analysis of fluorescent protein expressing cells by flow cytometry. Methods Mol Biol. 263, 239-258 (2004).
- Zhao, Z., et al. A high-content morphological screen identifies novel microRNAs that regulate neuroblastoma cell differentiation. Oncotarget. 5 (9), 2499-2512 (2014).
- Borowicz, S., et al. The soft agar colony formation assay. J Vis Exp. (92), e51998 (2014).
- Yang, J., et al. Integrated proteomics and genomics analysis reveals a novel mesenchymal to epithelial reverting transition in leiomyosarcoma through regulation of slug. Mol Cell Proteomics. 9 (11), 2405-2413 (2010).
- Alba-Castellon, L., et al. Snail1 expression is required for sarcomagenesis. Neoplasia. 16 (5), 413-421 (2014).
- Takaishi, M., Tarutani, M., Takeda, J., Sano, S. Mesenchymal to Epithelial Transition Induced by Reprogramming Factors Attenuates the Malignancy of Cancer Cells. PLoS One. 11 (6), e0156904 (2016).
