Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Developmental Biology

Sarkoma Hücreler Mezenkimal-Epitel Geçişler endüklenmesi

doi: 10.3791/55520 Published: April 7, 2017

ERRATUM NOTICE

Summary

Biz burada mikroRNA-200 aile üyeleri ve grainyhead benzeri 2 (GRHL2) kombine ektopik ifadesine dayalı sarkom hücrelerinde mezenkimal-epitel geçişler (MET) uyarılması için bir hücre kültürü yöntemi sunuyoruz. Bu yöntem kanser agresiflik ve tedavileri hakkında fenotipik esneklik biyolojik etkilerini daha iyi anlamak için uygundur.

Abstract

Fenotipik plastisite hücreleri geçici olarak başka bir soy özellikleri elde ettiği bir olguya karşılık gelir. karsinoma ilerleme sırasında, fenotipik plastisite işgali, yayılmasını ve metastaz sürer. fenotipik plastisite çalışmaların çoğu epitel türetilmiş karsinom bağlamında olmuştur Nitekim, bir mesenchymal- benzer bir fenomen geçiren sarkomlar bir alt kümesi ile de fenotipik plastisite sergiler, mezenkimal kaynaklı olan sarkomu, çıkıyor epitel geçiş (MET). Burada, sırasıyla ardışık GRHL2 ve miR-200 ailesi, hücre transdüksiyonunu ve transfeksiyon kullanılarak ifade sarkom hasta samples.We gözlemlenen bu MET benzeri fenomen taklit etmek için miR-200 aile ve grainyhead benzeri 2 (GRHL2) içeren bir yöntem geliştirdi daha iyi sarkom hücrelerinde bu fenotipik geçişlerinin moleküler temellerini anlamak. miR-200S ve GRHL2 ifade sarkomu hücreleri gelişmiş epitel characterist gösterdiHücre morfolojisi ve epitel ve mezenkimal biyobelirteçlerinin değiştirilmesinin ics. Bu yöntemleri kullanarak gelecekteki çalışmalar ile göç, invazyon, metastatik eğilimi ve tedavi direnci gibi sarkom hücreleri üzerinde MET benzeri işlemler, fenotipik sonuçlarını anlamak için kullanılabilir.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Fenotipik plastisite hücre fenotipleri arasında tersinir bir geçiş anlamına gelir ve genel olarak iki tip epitelyal-to-mezenşimal (EMT) geçişler ve mezenkimal-için-epitel geçişler (MET) bölünür. Bu fenotipik plastisite bu gelişme ve yara iyileşmesi 1 olarak çok hücreli organizmalardan normal süreçlerde önemli bir rol oynar; Bununla birlikte, bu aynı yollar ve gen ekspresyonu programları da fibroz, hastalığa yol açabilir (inceleme 2, 3, 4) ve karsinoma metastazı (referanslar 5, 6, 7 gözden, 8). Metastaz sırasında, örneğin, EMT hücre polarite, hücre-hücre etkileşimleri bozar ve istila 9, 10 destekler. Birlikte, EMT katkıdaKanser hücresi yayılmasını kolaylaştıran bir fenotipik durumuna s. Buna ek olarak, EMT aynı zamanda kanser hücre metabolizması 6 deregülasyonu, ilaç direnci 11, 12 geliştirilmesi dahil olmak üzere agresif fenotipi sürücü diğer fenotipik değişiklikler, artmış tümör başlatma yeteneğine 13, 14 ve bağışıklık kaçırma 15 ev sahibi bir dizi yol açar.

Fenotipik esneklik de karsinoma ilerlemesinde çalışılmıştır; Bununla birlikte, sarkomlar da fenotipik plastisite sergiler. karsinom fenotipik esneklik aynı sürücülerin bazıları da sarkom plastisite ve agresiflik katkıda sanki İlginçtir, o görünür. Örneğin, sarkom hastaların dolaşımdaki tümör hücrelerinin (kapalı zaman eğrilerinin) EpCAM'ı, tipik olarak, epitel hücreleri 16 üzerinde bulunan bir hücre yüzeyi proteinini ifade etmek için gösterilmiştir. Addiarası olarak, 250 yumuşak doku sarkomu örnekleri epitelyal benzeri veya mezenşimal benzeri gen ifadesine dayalı olarak sınıflandırılmıştır. Epitel benzeri biyomarker imzadaki hastalar mezenkimal benzeri biyomarker imza 17 olan hastalarda daha iyi bir prognozu vardı. Bu, daha fazla epitel benzeri karsinom olan hastaların daha mezenkimal benzeri tümörler 18 olan hastalarla karşılaştırıldığında daha iyi sonuçlar sahip olduğu birçok karsinom, tutarlıdır.

Bazı sarkomlar biyolojik ve MET tutarlı gen sentezleme yolları gösterilirken, bu fenotipik esneklik moleküler temelleri yeterince anlaşılamamıştır. sarkomda MET mekanizmaları ve sürücüleri incelemek için iki epitel özgü faktörleri kullanılarak MET indüksiyon bir model geliştirdi, mikroRNA (miR) -200 ailesi ve grainyhead benzeri 2 (GRHL2). miR-200S Messen 3' UTR bağlanarak gen ekspresyonunu regüle küçük kodlayıcı olmayan RNA'lar ailesidirger RNA ve protein içine önleme çevirisi. miR-141 ve miR-200a ihtiva eden bir ve miR-200b, miR-200c ve miR-429 de dahil olmak üzere - diğer miR-200 ailesi, iki alt grup oluşur. MiR-200 ailesinin üyeleri epitel dokuları açısından zengindirler ve miR-200s kaybı karsinomları 19 metastaz ile ilişkilidir. MiR-200 ailesi de normal doku 20 ile karşılaştırıldığında yumuşak doku sarkomları aşağı regüle edilir. MiR-200'ler benzer şekilde, GRHL2 epitel gelişimi 21 için önemli olan düzenlenmesinde anahtar rol oynar. GRHL2 transkripsiyon faktörü, E-kadherin gibi epitel genleri, yukarıya doğru düzenlemek için iki şekilde hareket eder: 1) epitel hücrelerinde, GRHL2 şirketinden EMT ana regülatör bastırmaktadır, ZEB1 22; ve 2) GRHL2 direkt olarak epitel genlerin 23 transkripsiyonunu aktive eder. Bizim önceki araştırmalar göstermiştir ki sarkom hücrelerinde miR-200'ler ve GRHL2 birleşik ifadesiBir MET benzeri fenotip 24 indükler. Burada, miR-200S ve GRHL2 ektopik ekspresyonu ile sarkom hücrelerindeki MET indüksiyon in vitro bir model oluşturmak için ayrıntılı protokol mevcut.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Reaktiflerin hazırlanması 1.

  1. fetal sığır serumu (FBS) ve penisilin-streptomisin (5,000 U / mL), DMEM, 500 mL, 5 mL, 50 mL ilave edilerek hücre kültürü için DMEM hazırlayın. Bu ortam, en fazla altı ay için 4 ° C'de saklanabilir.
  2. 10 uM'lik bir son konsantrasyon elde nükleaz içermeyen su içinde liyofilize primerler yeniden süspanse edin. -20 ° C'de, primerlerin yeniden süspansiyon haline getirilmiştir.
  3. radyoimmünopresipitasyon deneyi (RIPA), tampon (150 mM NaCl,% 0.5 sodyum deoksikolat,% 0.1 SDS, 50 mM Tris, pH 8.0) içinde hazırlayın. Kullanmadan önce, proteaz inhibitör kokteyli ile tamamlamak ve kullanım sırasında buz üzerinde tampon tutun. 4 ° C'de saklayın.
  4. 0.45 um polietersülfon filtre kullanılarak sterilize etmek için su ve şırınga filtresi 10 mg / ml polibren (heksadimetrin bromür) hazırlayın. Çözelti altı aya kadar 4 ° C 'de muhafaza edilebilir.
  5. PBS, 10 ml 10 mg nitrotetrazolivm klorür, 1 mg / ml çalışma çözeltisi hazırlayın. 4 ° C'de saklayın.

GRHL2 2. lentiviral İletimi

1.gün

  1. Levha takviye edilmiş DMEM 2 mL, 6 gözlü bir plakanın her çukuruna 3 x 10 5 HEK293T hücreleri. Otomatik bir hücre sayacı hücreleri sayısal olarak. % 5 CO2 ile 37 ° C 'de bir gece kültürden sonra,% 60 konfluent - Hücreler 40 olmalıdır.

2. gün

  1. 1.8 pΔ8.9 ug ve pCMV-VSV'nin 0.2 ug ile birlikte, serum içermeyen ortam, 200 uL 2 boş vektör ug (pCMV-UBC EGFP) ya da 2, pCMV-GRHL2-UBC-EGFP 24 ug, 25 seyreltin -G yardımcı plazmid. Ayrı bir tüp içinde, transfeksiyon başına serumsuz ortam (iki numune için 400 uL 8 uL), 200 uL bir lipid bazlı transfeksiyon reaktifi 4 uL seyreltin. Her plazmid çözeltisine transfeksiyon reaktifi karışımın 200 uL ilave edilir ve oda sıcaklığında 20 dakika inkübe edilir.
  2. incuba sırasındabelirleme, vakum aspirasyon ile orta çıkarılması ve 1 mL PBS ile hücrelerin durulanarak HEK293T hücreleri yıkayın. serumsuz ortamın 800 mcL ile PBS değiştirin. % 5 CO2 içinde 37 ° C 'de 2 saat boyunca hücrelerin her bir adım 2.2 damla damla plazmid karışımını inkübe: 20 dakika sonra, transfeksiyon tepkin maddesi 200 uL ekleyin.
  3. Dikkatle vakum aspirasyon ile transfeksiyon ortamı ortadan kaldırmak ve takviye edilmiş DMEM 2 mL ile değiştirin. Gece boyunca kültür için inkübatör hücreleri dönün.
    NOT: HEK293T hücreleri gevşek yapışık bulunmaktadır. Ortam değişimi tabak veya şişe tabanından hücrelerin çıkarılmasını sınırlamak için dikkatle gerçekleştirilmelidir.

3. Gün

  1. Takviye edilmiş DMEM 2 mL transfekte HEK293T hücrelerinin ve plaka üzerinde, 6 gözlü bir plakanın her çukuruna 3 x 10 5 RD hücreleri ortamı yenileyin. Gece boyunca Kültür hücreleri. RD hücreleri, ticari olarak temin edilebilen insan rabdomiyosarkom hücre çizgisidir.

4. Gün

  • HEK293T hücrelerinden viral ortamı toplayın. yeni bir 15 ml konik içine HEK293T hücrelerinin ve yerden DMEM ortamı pipetle. Dikkatle geri ertesi gün için kuluçka yeni DMEM medya ve yer HEK293T hücreleri ile değiştirin.
  • iki yeni 50 ml konik borular (GRHL2 transfeksiyon için, boş vektör transfeksiyonu için) ve başka içine, 10 mg / viral medya mL'si başına ml polibren 2 uL ekleyin. 3 ml'lik bir şırınga pistonu çıkarılması ve uç için 0.45 um polietersülfon filtre iliştirmek Şırınga filtre viral ortam.
    1. şırınganın haznesine adım 2.6 toplanan virüs ortam ekleyin ve polybrene ihtiva eden yeni bir 50 mL konik tüp içine ortam dalma. Vakum aspirasyon ile RD hücrelerinden Ortamı çıkarın ve RD hücrelerinden üzere filtre virüs ortamı eklenir.
  • 5. Gün

    1. Viral medya toplandıktan sonra tekrarlayın Gün 4. HEK293T hücreleri atılabilir.

    7. Gün

    1. Yıkama RD 1 mL PBS ile hücre ve 200% 0.05 tripsin uL çukur başına ekleyin. 5 dakika boyunca 37 ° C'de inkübe edilir takviye edilmiş bir ortam, 2 ml ekleyin ve yeni bir 15 ml konik hücre süspansiyonu hareket ettirin. Oda sıcaklığında ve aspirat ortamı 5 dakika boyunca 250 x g'de santrifüje hücreleri. DMEM, 1 mL içinde süspanse (% 5 FBS ve% 1 ile takviye penisilin-streptomisin).
      NOT: FBS daha yüksek bir yüzdesi kullanılarak flow sitometri sırasında tıkanma neden olabilir
      1. flow sitometri için filtre hücreleri. Buz üzerinde boru ve yer tüpler akış sitometrisi bir 30 um filtre üzerinden 1 ml RD hücre süspansiyonunun tatbik edilmesi için bir pipet kullanın.
      2. DMEM, 0.5 mL içeren 1.5 ml mikrosantrifüj tüplerine kriteri + EGFP hücreler 26 buz üzerinde,% 10 FBS ve% 1 penisilin-streptomisin ve yer ile desteklenmiştir. Plaka eGFP + kültür inkübatörü içinde 12 oyuklu plaka ve yer tek bir kuyusuna takviye edilmiş DMEM, 1 mL toplam tasnif edilen hücreler.
        ; NOT: akışından sitometri bu transdüksiyon sonra EGFP + hücrelerinin verimi, genellikle düşük (50,000-100,000 hücre). 3. adıma ilerlemeden önce, 14 gün - Hücreler 10 kültürlenebilir gerekebilir.

    miR-200s 3. Ters transfeksiyonu

    1. Tekrarlanan donma / erime döngülerinden kaçınmak için -20 ° C'de nükleazsız H2O kısım stokları ve deposunu kullanan miR-200 taklit 50 uM stokları hazırlayın.
    2. serumsuz ortam 300 uL veya 300 uL serumsuz ortama 50 uM negatif kontrol miRNA'nm 9 uL, her 50 uM miR-200 mimik (miR-200a, miR-200b ve miR-200c) 3 uL ekleyin.
    3. serumsuz ortam 600 uL siRNA özgü transfeksiyon reaktifi 6 uL ekleyin ve iki boru, adım 3.2 iki mıR karışımlarının her biri için bir içine bu karışımın 300 uL bölün. transfeksiyon reaktifi 300 uL bir karışımı ile adım 3.2 'den her mıR karışımı 300 uL birleştirin. Oda te 20 dakika süreyle inkübe edinmperature.
    4. kuluçka sırasında, 2.4 mL, Bölüm 2'de oluşturulan EV veya GRHL2 eksprese 600,000 eGFP + RD hücrelerinden oluşan bir hücre süspansiyonunun muamele başına serumsuz ortam (250 hücre / ml) hazırlayın.
    5. 24 oyuklu bir plaka, altı kuyu içine miR-200 karışımı ya da adım 3.3 negatif kontrol karışımı oyuk başına 100 uL ekleyin ve daha sonra her bir miR karışımın üç kuyu içine her bir hücre süspansiyonu 400 uL ekleyin.
    6. % 5 CO2 içinde 37 ° C 'de hücreler bir gece boyunca inkübe edin ve ortamı değiştirmek tam ertesi gün DMEM takviye etmek. Uygun tampon (aşağıya bakınız) kullanılarak analiz için 2 gün sonra hücreler toplanır. MET geçiren RD sarkom hücrelerinin zaman atlamalı görüntüleme tamamlayıcı malzeme olarak kullanılabilir. Görüntü otomatik canlı hücre görüntüleyici 27 kullanan bir 10X amacı ile her kuyu her 2 saat.

    4. RNA ekstraksiyonu, ters transkripsiyon ve qPCR

    1. Standart bir RNA kullanılarak üreticinin talimatlarına göre RNA Özüekstraksiyon kiti 24. Çıkarılan RNA -80 ° C'de saklanabilir.
    2. RNA konsantrasyonu ölçmek. Çözülme ve buz üzerinde RNA ile çalışır. RNA konsantrasyonlarının ölçümü, üreticinin protokolüne uygun olarak, bir plaka okuyucu spektrofotometre ile 260 nm'de UV absorbansı ölçmek. nükleaz içermeyen su ile en düşük konsantrasyonu, tüm numuneler seyreltin.
    3. Tamamlayıcı DNA (cDNA) içine toplam RNA ters transkripsiyon gerçekleştirin. Bir 20 uL reaksiyon hacmi 24 transkriptaz ve nükleaz içermeyen su, ters PCR tamponu, dNTP karışımı (100 mM), rastgele heksamer primerleri ile total RNA en az 100 ng birleştirin. imalatçının protokolüne göre RT döngüleri çalıştırın. cDNA, -20 ° C de, uzun süreli saklanabilir.
    4. Nükleaz içermeyen H2O 80 uL 100 uL 20 uL reaksiyonları seyreltin
    5. bir floresans bazlı interkalasyon boya 2x qPCR ana karışımı 5 uL, her biri 10 uM primer 0.06 uL, karıştırınörnek başına seyreltilmiş RT reaksiyonunun nd 2 uL.
    6. floresan bazlı ana karışımı için üreticinin protokole göre çalıştırın qPCR.
    7. Delta BT yöntemi ile mRNA'nın nispi miktarlarını ölçmek ve GAPDH için normalize. Her tedavi grubu için ortalama ± standart sapma biyolojik tekrarın ortalaması mRNA ekspresyonunu çizilir.
      NOT: Bu RNaz içermeyen plastik ve reaktif maddelerin kullanıldığı olarak RNases, temastan kaçınmaya RNA ile çalışırken özel önlemler alınmalıdır. Sigara atılabilir ekipman RNases kaldırmak için kullanılmadan önce tedavi edilmelidir.

    5. Bağışık Boyama

    1. 24 oyuklu bir formatta RD hücrelerinden vakum aspirasyon adım 3.6, aspirat ortam et.
    2. oyuk başına% 4 paraformaldehit (PFA), 500 uL ekleyerek hücreleri saptamak ve oda sıcaklığında 15 dakika (RT) enkübe edilir. tespit sonra, fosfat yer hücreleri gerektiğinde gece boyunca 4 ° C'de tuzlu su (PBS) ve mağaza tamponlu.
    3. PermeabilizePBS +% 0.2 Triton-X100, 500 uL ilave edilmesi ve oda sıcaklığında 30 dakika inkübe göre hücre. vakum aspirasyon ile, permeabilizasyon tamponu çıkarın ve üç kez PBS ile yıkayın.
    4. % 5 bovin serum albümini, 500 uL (BSA) / PBS içinde Blok ve oda sıcaklığında 30 dakika boyunca hücreler inkübe edin. Hücreler, bir gece boyunca, gerekirse 4 ° C'de saklanabilir.
    5. Primer antikor seyreltme hazırlayın. 15 ml konik içine% 5 BSA pipetle 200 uL / ​​göz başına PBS (12 kuyu = 2.4 mL) ve% 5 BSA mL'si başına birincil antikor 1 uL ekleyin / PBS içinde gerekli. Vakum aspirasyon ile Bloklama tamponunu çıkarın ve her bir oyuğa seyreltilmiş birincil antikor 200 uL dağıtın.
      1. 1 hücreleri inkübe:% 5 BSA 1000 seyreltilmiş primer antikorlar / PBS içinde 1 saat süre ile, oda sıcaklığında ya da gece boyunca 4 ° C'de karıştırıldı. İnkübasyondan sonra, hücreler PBS ile iki kez yıkanır.
    6. yukarıdaki gibi% 5 BSA / PBS, aynı hacimde ikincil antikor seyreltme hazırlayın. 2,000 seyreltme: 1 kullanarak uzak-kırmızı boya-konjüge edilmiş ikincil antikor ekleyin. Ayrıca eklemekkarışıma Hoechst boya 1 ug / ml. PBS çıkarın ve her bir oyuğa karışımdan 200 uL ekleyebilir.
      1. karanlıkta oda sıcaklığında 1 saat inkübe edin. PBS ile 3 kez yıkayın, PBS hücrelerin bırakın ve folyo kullanarak ışık hücreleri korur. Gerekirse Hücreler, 4 ° C'de saklanabilir.
    7. 650 nm - eksitasyon dalga boyu 594 ile ters epifloresans mikroskop 400X toplam büyütmede Resim hücreleri.

    6. Western Blot

    1. buz gibi soğuk PBS ile iki kez 3.6 hücreleri yıkayın. Buz üzerinde, 1 x RIPA 50 uL lize hücreleri 1 x proteaz inhibitör kokteyli ile takviye edilmiş tampon.
    2. 15 dakika boyunca 4 ° C 'de kaya lizatları, 5 dakika örnekleri açıklamak için yüksek hızda (20,000 xg) 1.5 ml tüpler içine lizatları ve santrifüj toplar. gerektiğinde hücre lizatları, -80 ° C'de uzun süreli saklanabilir.
    3. bir Bradford tahlili kullanılarak toplam protein miktarını ve yeni bir 1.5 mL mikrosantrifüj tüplerine protein eşit miktarda kısım. Brin2-merkaptoetanol ile takviye edilmiş RIPA tamponu ve 3x Laemmli yükleme tamponu kullanılarak eşit hacme gr numune.
    4. 95 ° C'de 5 dakika süre ile 1 x Laemmli numune yükleme tamponu içinde inkübe edin ve 45 dakika boyunca 200 V'de% 4-12 Tris-glisin jel kullanılarak SDS-PAGE çalıştırın. hücre serisine bağlı olarak protein yüklü kadar artar. Bazı durumlarda, toplam proteinin 50-100 ug mezenkimal hücre çizgilerinde e-kaderin tespit etmek için gereklidir.
    5. 1x Tris-glisin transfer tampon maddesi içinde 50 V, 2 saat boyunca bir nitroselüloz zar üzerine transfer proteinleri.
    6. Oda sıcaklığında ya da gece boyunca BSA tabanlı bloke edici tampon içinde 4 ° C'de 1 saat boyunca blok membran.
    7. , Bloke edici tampon 5 ml 1.000 konsantrasyon membrana olarak seyreltme ve yumuşak, oda sıcaklığında veya gece boyunca 4 ° C sıcaklıkta 1 saat süreyle sallanan inkübe: 1 ile birincil antikorlar seyreltilir. % 0.05 Tween-20 ile PBS içinde yıkama zar 3 kez.
    8. Kızılötesi floresan bağlanmış İkincil ile oda sıcaklığında 1 st için membranlar inkübe1 de y antikoru: Yukarıda anlatıldığı gibi, blokaj tamponu içinde 20,000 seyrelti.
    9. % 0.05 Tween-20 ile PBS içinde membran, iki kez yıkanır ve PBS içinde daha sonra bir kez.
    10. Standart kızılötesi floresens kullanarak görüntü membran.

    7. tutunmadan çoğalması Tahliller

    NOT: Ayrıntılı yumuşak agar denemesi protokolü için, 28 bkz.

    1. Sıcak su banyosu içerisinde 42 ° C'ye kadar sıcak steril 2x DMEM ortamı. Bu süre boyunca, ısı 3 dakika süreyle mikrodalgada içinde% 1 agaroz önceden otoklava. gerekli ya da tamamen eriyene kadar bir zamanda, ilave bir 30 s için mikrodalga. 42 ° C su banyosu için agaroz hareket ettirin.
    2. bir steril bir muhafaza içinde 42 ° C'de su içinde bir çanak içinde bir 50 mL konik tüp yerleştirilir ve 1% 1 agaroz ve 2x DMEM ortamı karışımı: 6 gözlü bir plakada göz başına 1.5 mL karışım 1 oranı muhasebe. Her zaman DMEM agaroz pipetleme hatası hesaba / ekstra hazırlayıp kabarcıklarını önlemek için.
    3. Karışımı ekleyinhiçbir kabarcık sağlanması da kenarları oluşturur ve oda sıcaklığında 30 dakika bekletildi.
    4. alt tabaka katılaşan edilirken, ortam aspire ve 1 ml PBS ile bir kez yıkanarak 3. adımda Transfekte edilmiş RD hücrelerinden her grup hazırlar. PBS aspire ve% 0.05 tripsin 0.2 mL eklenir ve 5 dakika boyunca 37 ° C'de inkübe edin.
    5. Bir tek hücre süspansiyonu meydana getirmek üzere medya ve çiğnemek hücreler 0.8 mL tripsin nötralize. 15 ml konik bir tüp hücre süspansiyonu aktarın.
    6. Hücre sayımı ve oyuk başına 10,000 hücre için gerekli olan hücre süspansiyonu hacmi hesaplamak.
    7. tamamen eriyene kadar bir seferde 30 s, ardından 3 dakika süreyle mikrodalgada% 0.6 agaroz ısıtın. 42 ° C su banyosuna agaroz hareket ettirin.
    8. bir steril bir muhafaza içinde 42 ° C'de su içinde bir çanak içinde bir 50 mL konik tüp yerleştirin. 6 gözlü bir plakada göz başına, 1.5 mL hazırlanması için 1: 1 oranında% 0.6 agaroz ve seyreltilmiş hücre süspansiyonu karıştırın. Her zaman pipetleme hatalarını hesaba mix agaroz / ekstra hücre süspansiyonu hazırlamak vekabarcıklarını önlemek için.
      NOT: Burada 42 ° C'de çalışmak önemlidir. sıcaklık çok düşükse karışım kaplama önce katılaşması olacak ve 42 ° C'nin üzerindeki sıcaklıklar, hücre canlılığını etkileyecektir.
    9. hücreler bir kaç kez ezilip karıştırılarak İyice karıştırın ve kabarcık formu sağlayarak, gözlere hücre karışımı ekleyin ve oda sıcaklığında 20 dakika boyunca katılaşmaya sağlar.
    10. Her bir takviye edilmiş bir ortam, 2 ml de ekleme ve inkübatör plakaları hareket eder.
      1. 3-4 hafta veya çok hücreli koloniler oluştururlar kadar haftada bir kez medya değiştirin. Vakum aspirasyon yoluyla ortamları çıkartırken agar dokunmaktan kaçınmak için dikkatli olun. Alternatif olarak, sıvı ortamın üst tabakayı kaldırmak için bir P1000 kullanın.
      2. 200 uL Nitro Mavi Tetrazolyum klorür çözeltisi eklenerek (1 mg / PBS ml) yumuşak agar plakaları leke ve 37 ° C'de gece boyunca plaka inkübe edilir. görüntüleme için PBS ile ertesi gün medya değiştirin.
      3. ters çevrilmiş bir mikroskop 40X toplam büyütmede Resim kuyular.
      4. koloni alanı ve sayısı için ImageJ analiz yapın. Arsa biyolojik çoğaltır koloni sayısı standart sapma ortalaması ±.

    Subscription Required. Please recommend JoVE to your librarian.

    Representative Results

    or Start trial to access full content. Learn more about your institution’s access to JoVE content here

    sarkom hücrelerindeki MET indüksiyonu için Şema

    Sarkom hücrelerindeki MET benzeri değişikliklerin indüksiyonu için genel bir zaman çizelgesi, Şekil 1 'de gösterilmiştir. Protokol miR-200 etti (Şekil 1B) transfeksiyonu takiben GRHL2 (Şekil 1A), transduse edilmesiyle başlar. GRHL2 veya miR-200 aile üyeleri tek basma ifade edildiğinde RD hücrelerinin görünümünü etkileyen mümkün değildi, ama birlikte GRHL2 ve miR-200'ler ektopik ifade RD hücrelerinde epitel benzeri morfolojik değişikliklere yol açar. Artan hücre-hücre teması (Şekil 1C) ile daha yuvarlak bir görünüm için, bir sürücü-şekilli biçimde alınan hücreler bir geçiş.

    sarkom hücrelerindeki MET benzeri değişiklikler indüksiyonu

    GRHL2 ve miR-200 üzerine RD hücrelerinde morfolojik değişimaşırı ekspresyonu epitel işaretleyici e-kaderin (Şekil 2A) düzenlenmesi de eşlik edilmiştir. MiR-200s eklenmesi tek başına e-kaderin regüle ama miR-200S ve GRHL2 aşın sinerjistik E-kadherin bir ekspresyon birleştirildi (Şekil 2A; log ölçeği) içerir. Buna ek olarak, (Şekil 2B) (aynı zamanda zona occludens 1, ZO-1 olarak da bilinir), epitelyal yapışma moleküllerinin, EpCAM ve TJP1, beyaz oklar, hücre-hücre birleşme bir artış vardır.

    MET indüksiyon sarkoma hücre koloni oluşumu yeteneği azalır

    Epitel protein upregülasyonu miR-200 için hedefler bilinmektedir mezenkimal genleri Zeb1 ve NOTCH1 (Şekil 3A), bir azalma ile eşlik etti. Koloni sayısındaki (Şekil 3B) ölçüldüğü gibi MET indüksiyonu, RD hücrelerinin ankrajdan bağımsız büyüme azalttı. Bu groinhibisyonu tek başına miR-200s tarafından tahrik edilmiş wth; GRHL2 aşırı ifadesi ankrajdan bağımsız büyüme (Şekil 3) bir artışa yol açtı. Bu ankraj bağımsız büyümesini 22 uyarır GRHL2 ifadesini gösteren önceki raporlar ile uyumludur.

    Şekil 1
    Şekil 1: GRHL2 aşırı ifadesi ve miR-200 Transfeksiyon ile MET indüksiyon zaman çizelgesi. Hedef hücrelerde GRHL2 ektopik aşırı ifadesi (A) zaman çizelgesi. Hedef hücrelerin miR-200 aile üyelerinin tersine transfeksiyonu yoluyla MET indüksiyonu (B) zaman çizelgesi. (C) GRHL2 ve miR-200 aşırı ekspresyon MET tutarlı hedef hücrelerinin morfolojisinde değişimlere yol açtı. Ölçek çubuğu = 75 mikron buraya tıklayınBu rakamın daha büyük bir versiyonunu görmek için.

    şekil 2
    Şekil 2: Eşzamanlı Aşırı ekspresyon GRHL2 ve miR-200s hedef hücrelerindeki MET için LED. GRHL2 ve miR-200s birleşik sentezleme mRNA hem de E-kadherin ifadesi üzerindeki sinerjistik bir etki (ortalama ± standart sapma değerleri) ve protein düzeyleri üretmiştir miR-200s (A) ekspresyonu, yüksek E-kadherin ekspresyonuna yol açmıştır. (B) GRHL2 ve miR-200s kombine sentezleme hücre-hücre temas (oklar) EpCAM ve TJP1 artan ekspresyonu yol açtı. Ölçek çubuğu 20 um =. * 0.05 Tukey post-hoc correction.This Şekil referans 24 değişiklikler yapılarak elde edilmiş olan ANOVA kullanılarak analiz <p gösterir. Mikrobiyoloji, Moleküler Hücre Biyolojisi, hacim 36, Sayı 19, 2503-2513, 2 Copyright © Amerikan Derneği016dır bu rakamın büyük halini görmek için lütfen buraya tıklayın.

    Şekil 3,
    Şekil 3: miR-200S bastırır Mezenkimal Markers ve sarkomu Hücrelerinde azaltır tutunmadan çoğalması ekspresyonu. (A) üzerinde - miR-200s ekspresyonu ancak GRHL2 Zeb1 ve NOTCH1 mRNA ifadesini (ortalama değerler ± standart sapma) inhibe etti. Aşırı ekspresyon miR-200s (B), fakat sarkom hücrelerinde değil GRHL2 inhibe anoikisi direnci. lekeli kolonileri (Ölçü bar = 200 um) ve koloni sayısı (± standart sapma ortalama değer) miktarının temsili görüntüleri gösterilmektedir. * P <0.05, r modifiye edilmiş Tukey post hoc correction.This rakam ile ANOVA kullanılarak analiz gösterireference 24. Mikrobiyoloji, Moleküler Hücre Biyolojisi, hacim 36, Sayı 19, 2503-2513, 2016 için Copyright © Amerikan Derneği bu rakamın büyük halini görmek için lütfen buraya tıklayın.

    Şekil 3,
    Ek Video: Boş vektör ve negatif kontrol miRNA'ları ifade eden RD hücreleri. Videolar boş vektör ve otomatik canlı hücre görüntü cihazını kullanarak iki saatte edinilen negatif kontrol miRNA'lann ile transfekte RD hücrelerinin görüntülerden derlenmiştir. Bu videoyu görüntülemek için buraya tıklayın. (Indirmek için sağ tıklayın.)

    Şekil 3, />
    Ek Video 2: GRHL2-EGFP ve Negatif Kontrol miRNA'ları ifade RD hücreler. Videolar otomatik canlı hücre görüntü cihazını kullanarak iki saatte edinilen GRHL2-EGFP ve negatif kontrol miRNA'lann ile transfekte RD hücrelerinin görüntülerden derlenmiştir. Bu videoyu görüntülemek için buraya tıklayın. (Indirmek için sağ tıklayın.)

    Şekil 3,
    Ek Video 3: Boş Vector ve miR200 miRNA'ları ifade RD hücreler. Videolar otomatik canlı hücre görüntü cihazını kullanarak iki saatte edinilen boş vektör ve miR200 miRNA'larının ile transfekte RD hücrelerinin görüntülerden derlenmiştir. Bu videoyu görüntülemek için buraya tıklayın. (Indirmek için sağ tıklayın.)

    nt" fo: keep-together.within sayfa = "1"> Şekil 3,
    Ek Video 4: GRHL2-EGFP ve miR200 miRNA'ları ifade RD hücreler. GRHL2-EGFP ve miR200 miRNA'larının ile transfekte RD hücrelerinin görüntülerden derlenmiştir videolar otomatik canlı hücre görüntü cihazını kullanarak her iki saatte satın aldı. Bu videoyu görüntülemek için buraya tıklayın. (Indirmek için sağ tıklayın.)

    Subscription Required. Please recommend JoVE to your librarian.

    Discussion

    or Start trial to access full content. Learn more about your institution’s access to JoVE content here

    Sarkomları bir mezenkimal kökenli nadir fakat son derece agresif kanserlerdir. bunların mezenkimal kökenli rağmen, sarkom bir alt kümesi, bir daha epitel benzeri bir duruma fenotipik dönüşmesine görünmektedir. Daha fazla epitel benzeri tümörlü hastaların 24 daha az agresif olduğu gibi bu MET benzeri anahtarı, prognostik bir önemi vardır. klinik önemine rağmen, sarkomlarda bu fenotipik geçişlerini sürüş moleküler mekanizmalar çok az çalışma vardır.

    sarkom hücrelerindeki MET-benzeri geçişleri incelemek için, epitel faktörler GRHL2 ve miR-200 ailenin ifadesini birleştirerek bir MET-indüksiyon modeli geliştirdik. Bu yöntem, hızlı bir şekilde morfolojisi ve gen ifadesindeki değişiklikler ile ölçüldüğü haliyle daha epitelyal gibi olmak sarkoma hücreleri neden olur. sarkom hücrelerinde MET yaratmak üzere bu protokolü kullanarak sarkom saldırganlık, böyle sürücü fenotipleri bu geçişlerin etkisi çalışmayı kolaylaştırırgöç, istila, çoğalması ve ölüm direnci ve nasıl olarak biyolojide bu değişikliklerin her ilaç direncini etkileyebilir.

    Epitel türevli karsinomların bağlamda, mezenkimal faktörünün ekspresyonu genellikle EMT 14 uyarmak için yeterlidir. Bununla birlikte, bir araya gelen iki epitel faktörlere GRHL2 ve miR-200s ifadesi bu sarkom türetilmiş modelinde, gereklidir. GRHL2 sağlam ZEB1 24 gibi, sadece epitel gen baskılayıcıların miR-200 bazlı baskı mevcudiyetinde epitel genleri aktif hale getirmek için mümkün iken İlginç bir şekilde, miR-200S, tek başına, GRHL2 daha MET en biyolojik üzerinde daha güçlü bir etkiye sahip değildir. Bazı mezenkimal hücre tipleri için epitel genler olması gerektiğini mümkündür hem de-bastırılmış (örn aracılığıyla miR-200'ler) ve aktive (örn aracılığıyla GRHL2) MET götürmek.

    Farklı cel genelinde GRHL2 ifade seviyelerinde değişim yaşamışl hatları. Bunun üstesinden gelmek için, biz de deneylerden önce EGFP pozitif hücrelerin flow sitometri ile sıralamak için EGFP 25 ifade eden bir GRHL2 ifade plazmid kullanılmaktadır. Farklı hücre tipleri miR-200S ve GRHL2 işlevselliğini doğrulamak için de kritiktir. EMT hücre çizgisi, bir kanser türüne, tedavi, vb Bu nedenle temel içerik bağımlı varyasyon olabilir epitelyal ve mezenkimal ilişkili genlerin ekspresyonu dayanan bir spektrum olarak görülür, biz miR-200 ya da GRHL2 düzenlenir beş gen analiz hücre bağlam-bağımlı değişiklikler için hesap. Bu testin bir başka uyarı MET indüksiyonu için miR-200s bir geçici transfeksiyon dayanılması. Birden fazla tekrar transfeksiyonlar gerekli hale Dolayısıyla, uzun süreli deneyler pahalı ve karmaşık bir hal alabilir. Bu miR-200 ekspresyon plazmidleri kullanılarak aşılabilir.

    Diğer çalışmalar da sarkomlarda MET etkilediğini söylemektedirler. Örneğin, MET leiomyosa bir alt gözlendircomas ve hastalar için daha iyi yaşam ile ilişkili bulunmuştur. Mekanik olarak, Yang ve ark. siRNA ile parça arasında bir leyomiyosarkom hücre çizgisi inhibisyonu MET benzeri değişiklikler 29 uyarılması için yeterli olduğu bulunmuştur. Benzer şekilde, mezenkimal kök hücrelerinde bir mezenkimal faktörü, salyangoz, tükenmesi farelerde 30 sarkom oluşumu azalır. Bu nedenle, hücre türüne göre değişebilir bir MET benzeri fenotip için muhtelif yollar olduğu literatürden açıkça bellidir. Bu MET ikna etmenin tek yolu olmasa da, biz rabdomyosarkomu (RD hücreleri) ve osteosarkom (143B hücre) olmak üzere iki sarkom alt tipte de MET ikna etmek bizim yöntemini kullandık. Gelecekte, sarkom hücrelerinin geniş bir yelpazede bu farklı yöntemler karşılaştırmak ilginç olacaktır. Örneğin, belirli sarkoma alt tiplerinin MET indüksiyon daha fazla veya daha az duyarlıdır yol açan diğer genetik veya epigenetik değişiklikler var mı?

    MET etkisini belirlemesarkomlar hücrelerinde biyolojik çıkışların çeşitli daha epitel benzeri sarkomu olan hastalar geliştirilmiş bir prognozu neden daha iyi anlaşılmasını sağlayabilir. Ayrıca, biyolojik anlayışı derinleştirmek ve sarkom hastalarda mevcut tedavilere yanıt üzerine bilgilendirmek istiyorum devletler arasındaki fenotipik geçişleri sürüş uygulanan tedavinin etkisinin anlaşılması.

    Subscription Required. Please recommend JoVE to your librarian.

    Disclosures

    Yazarlar ifşa hiçbir şey yok.

    Acknowledgments

    JAS Duke Kanser Enstitüsü, Duke Üniversitesi Genitoüriner Onkoloji Laboratuvarı ve Ortopedi Duke Üniversitesi Bölümü'nden destek kabul eder. HL Teorik Biyolojik Fizik Ulusal Bilim Vakfı (NSF) Merkezi tarafından desteklenmiştir (NSF FİZ-1.427.654) ve NSF DMS-1361411, ve Texas Eyaleti Kanser Araştırma bir CPRIT olarak (Kanser Önleme ve Texas Araştırma Enstitüsü) Akademik Rice University'de. KEW NIH F32 CA192630 MKJ tarafından desteklenen ve HL Mary C. Farach-Carson, JN Onuchic Samir M. Hanash, Kenneth J. Pienta ve Donald S. Coffey ile yararlı tartışmalar yararlanmıştır.

    Materials

    Name Company Catalog Number Comments
    Countess automated counter Life technologies AMQAX1000
    Countess cell counting chamber slides Invitrogen C10283
    SimpliAmp Thermal Cycler Thermo Fisher A24811
    Odyssey Fc LI-COR Inc
    ViiA7 Real Time PCR System Thermo Fisher 4453536
    PCR microplate Corning 321-29-051
    KAPA SYBR Fast Universal qPCR Kit KAPA Biosystems KK4602
    Starting Block (PBS) Blocking Buffer Thermo Fisher 37538 BSA-based blocking buffer
    Agarose General Purpose LE Genesee Scientific 20-102
    10x Tris/Glycine/SDS Buffer Bio-Rad Laboratories Inc 161-0732 Running buffer
    10x Tris/Glycine Buffer Bio-Rad Laboratories Inc 161-0734 Transfer buffer
    RIPA Buffer Sigma Life Sciences SLBG8489
    Amersham Protran 0.45 μm nitrocellulose GE Healthcare Lifesciences 10600012
    Quick-RNA MiniPrep Kit Genesee Scientific 11-358
    Laemmli Sample Buffer (4X) Bio-Rad Laboratories Inc 1610747
    Mini Trans-Blot Cell Bio-Rad Laboratories Inc 1703930
    Mini-Protean Tetra Cell Bio-Rad Laboratories Inc 1658005EDU
    DPBS Life technologies 14190-144
    0.05% Trypsin-EDTA Life technologies 11995-065
    DMEM Life technologies 11995-065
    Lipofectamine RNAi Max Thermo Fisher 13778150
    Lipofectamine 2000 Ragents Thermo Fisher 11668019
    Penicillin Streptomycin Life technologies 15140-122
    miRVana miRNA mimic negative control #1 Thermo Fisher 4464058 neg miRNA
    hsa-miR-200 mirVana miRNA mimic Thermo Fisher 4464066 miR200A
    has-miR-200 mirVana miRNA mimic Thermo Fisher 4404066 miR200B
    has-miR-200 mirVana miRNA mimic Thermo Fisher 4404066 miR200C
    Opti-MEM Life technologies 11088-021 serum-free media
    anti-Ecadherin antibody BD Bioscience 610182
    anti-beta actin Santa Cruz Biotechnology sc-69879
    anti-EpCam Ab Serotec MCA18706
    anti-ZO1 Invitrogen 402200
    IRDye 800W LI-COR Inc 925-32210
    IRDye 680 LI-COR Inc 926-32223
    anti-mouse AlexaFluor 647 Thermo Fisher A211241
    anti-rabbit AlexaFluor 647 Thermo Fisher ab150075
    Halt Protease and Phosphatesse Inhibitor Thermo Fisher 1861281
    Precision Plus Protein Dual Color Bio-Rad Laboratories Inc 161-0374
    Partec CellTrics Sysmex 04-004-2326 30 μm filter for flow
    GAPDH-F IDT AGCCACATCGCTCAGACAC
    GAPDH-R IDT GCCCAATACGACCAAATCC
    Ecadherin-F IDT TGGAGGAATTCTTGCTTTGC
    Ecadherin-R IDT CGCTCTCCTCCGAAGAAAC
    ZEB1-F IDT GCATACAGAACCCAACTTGAACGTC
    ZEB1-R IDT CGATTACACCCAGACTGC
    NOTCH-F IDT GGCAATCCGAGGACTATGAG
    NOTCH-R IDT CTCAGAACGCACTCGTTGAT
    nitro blue tetrazolium  Sigma N5514
    hexadimethrine bromide Sigma H9268 polybrene
    3 mL syringe BD Bioscience 309657
    Sterile syringe filter VWR 28145-505
    5mL polypropylene round-bottom tube 352063 flow cytometry tubes
    High-Capacity cDNA Reverse Transcription Kit Thermo Fisher 4368814 reverse transcription kit
    4% paraformaldyhyde Santa Cruz Biotechnology sc-281612
    Triton-X100 Sigma 93443
    bovine serum albumin Sigma A7906

    DOWNLOAD MATERIALS LIST

    References

    1. Weber, C. E., Li, N. Y., Wai, P. Y., Kuo, P. C. Epithelial-mesenchymal transition, TGF-beta, and osteopontin in wound healing and tissue remodeling after injury. J Burn Care Res. 33, (3), 311-318 (2012).
    2. Galichon, P., Finianos, S., Hertig, A. EMT-MET in renal disease: should we curb our enthusiasm. Cancer Lett. 341, (1), 24-29 (2013).
    3. Carew, R. M., Wang, B., Kantharidis, P. The role of EMT in renal fibrosis. Cell Tissue Res. 347, (1), 103-116 (2012).
    4. Willis, B. C., Borok, Z. TGF-beta-induced EMT: mechanisms and implications for fibrotic lung disease. Am J Physiol Lung Cell Mol Physiol. 293, (3), L525-L534 (2007).
    5. Ye, X., Weinberg, R. A. Epithelial-Mesenchymal Plasticity: A Central Regulator of Cancer Progression. Trends Cell Biol. 25, (11), 675-686 (2015).
    6. Li, L., Li, W. Epithelial-mesenchymal transition in human cancer: comprehensive reprogramming of metabolism, epigenetics, and differentiation. Pharmacol Ther. 150, 33-46 (2015).
    7. Tsai, J. H., Yang, J. Epithelial-mesenchymal plasticity in carcinoma metastasis. Genes Dev. 27, (20), 2192-2206 (2013).
    8. Bitting, R. L., Schaeffer, D., Somarelli, J. A., Garcia-Blanco, M. A., Armstrong, A. J. The role of epithelial plasticity in prostate cancer dissemination and treatment resistance. Cancer Metastasis Rev. 33, (2-3), 441-468 (2014).
    9. Schaeffer, D., Somarelli, J. A., Hanna, G., Palmer, G. M., Garcia-Blanco, M. A. Cellular Migration and Invasion Uncoupled: Increased Migration Is Not an Inexorable Consequence of Epithelial-to-Mesenchymal Transition. Mol Cell Biol. 34, (18), 3486-3499 (2014).
    10. Mathow, D., et al. Zeb1 affects epithelial cell adhesion by diverting glycosphingolipid metabolism. EMBO Rep. 16, (3), 321-331 (2015).
    11. Ware, K. E., et al. A mechanism of resistance to gefitinib mediated by cellular reprogramming and the acquisition of an FGF2-FGFR1 autocrine growth loop. Oncogenesis. 2, e39 (2013).
    12. Yauch, R. L., et al. Epithelial versus mesenchymal phenotype determines in vitro sensitivity and predicts clinical activity of erlotinib in lung cancer patients. Clin Cancer Res. 11, (24 Pt 1), 8686-8698 (2005).
    13. Jolly, M. K., et al. Towards elucidating the connection between epithelial-mesenchymal transitions and stemness. J R Soc Interface. 11, (101), 20140962 (2014).
    14. Mani, S. A., et al. The epithelial-mesenchymal transition generates cells with properties of stem cells. Cell. 133, (4), 704-715 (2008).
    15. Chen, L., et al. Metastasis is regulated via microRNA-200/ZEB1 axis control of tumour cell PD-L1 expression and intratumoral immunosuppression. Nat Commun. 5, 5241 (2014).
    16. Nicolazzo, C., Gradilone, A. Significance of circulating tumor cells in soft tissue sarcoma. Anal Cell Pathol (Amst). 697395 (2015).
    17. Somarelli, J. A., et al. Mesenchymal-epithelial transition in sarcomas is controlled by the combinatorial expression of miR-200s and GRHL2. Mol Cell Biol. (2016).
    18. Bae, Y. K., Choi, J. E., Kang, S. H., Lee, S. J. Epithelial-Mesenchymal Transition Phenotype Is Associated with Clinicopathological Factors That Indicate Aggressive Biological Behavior and Poor Clinical Outcomes in Invasive Breast Cancer. J Breast Cancer. 18, (3), 256-263 (2015).
    19. Humphries, B., Yang, C. The microRNA-200 family: small molecules with novel roles in cancer development, progression and therapy. Oncotarget. 6, (9), 6472-6498 (2015).
    20. Renner, M., et al. MicroRNA profiling of primary high-grade soft tissue sarcomas. Genes Chromosomes Cancer. 51, (11), 982-996 (2012).
    21. Petrof, G., et al. Mutations in GRHL2 result in an autosomal-recessive ectodermal Dysplasia syndrome. Am J Hum Genet. 95, (3), 308-314 (2014).
    22. Werner, S., et al. Dual roles of the transcription factor grainyhead-like 2 (GRHL2) in breast cancer. J Biol Chem. 288, (32), 22993-23008 (2013).
    23. Werth, M., et al. The transcription factor grainyhead-like 2 regulates the molecular composition of the epithelial apical junctional complex. Development. 137, (22), 3835-3845 (2010).
    24. Somarelli, J. A., et al. Mesenchymal-Epithelial Transition in Sarcomas Is Controlled by the Combinatorial Expression of MicroRNA 200s and GRHL2. Mol Cell Biol. 36, (19), 2503-2513 (2016).
    25. Varma, S., et al. The transcription factors Grainyhead-like 2 and NK2-homeobox 1 form a regulatory loop that coordinates lung epithelial cell morphogenesis and differentiation. J Biol Chem. 287, (44), 37282-37295 (2012).
    26. Pruitt, S. C., Mielnicki, L. M., Stewart, C. C. Analysis of fluorescent protein expressing cells by flow cytometry. Methods Mol Biol. 263, 239-258 (2004).
    27. Zhao, Z., et al. A high-content morphological screen identifies novel microRNAs that regulate neuroblastoma cell differentiation. Oncotarget. 5, (9), 2499-2512 (2014).
    28. Borowicz, S., et al. The soft agar colony formation assay. J Vis Exp. (92), e51998 (2014).
    29. Yang, J., et al. Integrated proteomics and genomics analysis reveals a novel mesenchymal to epithelial reverting transition in leiomyosarcoma through regulation of slug. Mol Cell Proteomics. 9, (11), 2405-2413 (2010).
    30. Alba-Castellon, L., et al. Snail1 expression is required for sarcomagenesis. Neoplasia. 16, (5), 413-421 (2014).
    31. Takaishi, M., Tarutani, M., Takeda, J., Sano, S. Mesenchymal to Epithelial Transition Induced by Reprogramming Factors Attenuates the Malignancy of Cancer Cells. PLoS One. 11, (6), e0156904 (2016).

    Erratum

    Formal Correction: Erratum: Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells
    Posted by JoVE Editors on 07/03/2018. Citeable Link.

    An erratum was issued for: Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells. An author name was updated.

    One of the authors' names was corrected from:

    Shenghan Xu

    to:

    Shengnan Xu

    Sarkoma Hücreler Mezenkimal-Epitel Geçişler endüklenmesi
    Play Video
    PDF DOI DOWNLOAD MATERIALS LIST

    Cite this Article

    Ware, K. E., Gilja, S., Xu, S., Shetler, S., Jolly, M. K., Wang, X., Bartholf Dewitt, S., Hish, A. J., Jordan, S., Eward, W., Levine, H., Armstrong, A. J., Somarelli, J. A. Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells. J. Vis. Exp. (122), e55520, doi:10.3791/55520 (2017).More

    Ware, K. E., Gilja, S., Xu, S., Shetler, S., Jolly, M. K., Wang, X., Bartholf Dewitt, S., Hish, A. J., Jordan, S., Eward, W., Levine, H., Armstrong, A. J., Somarelli, J. A. Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells. J. Vis. Exp. (122), e55520, doi:10.3791/55520 (2017).

    Less
    Copy Citation Download Citation Reprints and Permissions
    View Video

    Get cutting-edge science videos from JoVE sent straight to your inbox every month.

    Waiting X
    simple hit counter