Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

CAPRRESI: Chimera Assembly ved Plasmid Recovery og Restriction Enzyme Site Insertion

doi: 10.3791/55526 Published: June 25, 2017

Summary

Her presenterer vi kimærmontering ved plasmidgjenoppretting og restriksjonsenzymstedinnsetting (CAPRRESI), en protokoll basert på innsetting av restriksjonsenzymsteder i synonym-DNA-sekvenser og funksjonell plasmidutvinning. Denne protokollen er en rask og rimelig metode for fusjon av proteinkoding-gener.

Abstract

Her presenterer vi kimærmontering ved plasmidgjenoppretting og restriksjon av enzyminnlegg (CAPRRESI). CAPRRESI drar fordel av mange styrker av den opprinnelige plasmidgjenvinningsmetoden og introduserer restriktionsenzymfordøyelse for å lette DNA-ligeringsreaksjoner (kreves for kimærmontering). For denne protokollen klones brukere av wildtype-gener i det samme plasmidet (pUC18 eller pUC19). Etter at silikoseleksjonen av aminosyresekvensregioner hvor kimærene skulle settes sammen, oppnår brukere alle de synonym-DNA-sekvensene som koder for dem. Ad hoc Perl skript gir brukere mulighet til å bestemme alle synonyme DNA-sekvenser. Etter dette trinnet søker et annet Perl-skript for restriktionsenzymsteder på alle synonym-DNA-sekvenser. Dette i silikoanalyse utføres også ved bruk av ampicillinresistensgenet ( ampR ) funnet på pUC18 / 19 plasmider. Brukere utformer oligonukleotider inne i synonymområder for å forstyrre wildtype- og ampR- gener ved PCR. Etter obtAining og rensing av komplementære DNA-fragmenter, oppnås restriksjon enzym-fordøyelse. Kimærsammenstilling oppnås ved å ligere passende komplementære DNA-fragmenter. PUC18 / 19 vektorer er valgt for CAPRRESI fordi de tilbyr tekniske fordeler, som for eksempel liten størrelse (2 686 basepar), høy kopiantal, fordelaktige sekvenseringsreaksjonsfunksjoner og kommersiell tilgjengelighet. Bruken av restriksjonsenzymer for kimærsammensetning eliminerer behovet for DNA-polymeraser som gir truende produkter. CAPRRESI er en rask og rimelig metode for fusjon av proteinkoding gener.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Kimære gensamlinger har blitt mye brukt i molekylærbiologi for å belyse proteinfunksjon og / eller bioteknologiske formål. Forskjellige metoder eksisterer for fusjonsgener, slik som overlappende PCR-produktforsterkning 1 , plasmidutvinning 2 , homolog rekombinasjon 3 , CRISPR-Cas9-systemer 4 , stedregistrert rekombinasjon 5 og Gibson-samling 6 . Hver av disse tilbyr forskjellige tekniske fordeler; For eksempel fleksibiliteten til overlappende PCR-design, in vivo- valget av konstruksjoner under plasmidutvinning eller høy effektivitet av CRISPR-Cas9- og Gibson-systemer. På den annen side kan det oppstå noen vanskeligheter når du utfører noen av disse metodene; For eksempel er de to første tilnærmingene avhengig av stumpede DNA-fragmenter, og ligering av disse typer produkter kan være teknisk utfordrende sammenlignet med stikkKy-endig ligering. Site-directed rekombination kan etterlate spor av ekstra DNA-sekvenser (arr) på originalen, som i CrecoxP- systemet 5 . CRISPR-Cas9 kan noen ganger endre andre genomregioner i tillegg til målstedet 4 .

Her presenterer vi chimera-montering ved plasmidgjenoppretting og restriksjonsenzymstedinnsetting (CAPRRESI), en protokoll for fusing proteinkoding gener som kombinerer plasmidgjenvinningsmetoden (PRM) med innsetting av restriksjonsenzymsteder på synonym-DNA-sekvenser, forbedrende ligeringseffektivitet . For å sikre aminosyresekvensintegritet settes restriksjonsenzymsteder inn på synonym-DNA-sekvensstrøk. Blant fordelene med CAPPRESI er at den kan utføres ved hjelp av vanlige laboratoriereagenser / verktøy ( f.eks . Enzymer, kompetente celler, løsninger og termocykler) og at det kan gi raske resultater (når de aktuelle enzymer brukes). Stole på begrensningEnzymsteder som kommer fra synonym-DNA-sekvenser kan begrense valget av de eksakte fusjonspunktene inne i proteiene av interesse. I slike tilfeller bør målgener bli fusjonert ved bruk av overlappende oligonukleotider, og restriktionsenzymsteder bør settes inn på resistensgenet til vektoren.

CAPRRESI består av syv enkle trinn ( figur 1 ): 1) utvalg av kloningsvektoren, pUC18 eller pUC196; 2) i silikoanalyse av wildtype-sekvensene som skal smeltes; 3) utvalg av bryteområder for kimærsammenstilling og plasmidforstyrrelse; 4) i silico- generasjon av synonym-DNA-sekvenser som inneholder restriksjonsenzymsteder; 5) uavhengig kloning av wildtype-gener til det valgte plasmid; 6) plasmidforstyrrelse ved PCR, etterfulgt av restriktionsenzym fordøyelse; Og 7) plasmidutvinning ved bruk av DNA-ligering og bakteriell transformasjon. Kimære gener fremstilt ved denne teknikken bør verifiseres wEtter sekvensering.

PUC18 / 19 vektorer tilbyr tekniske fordeler for kloning og kimærmontering, for eksempel liten størrelse ( dvs. 2 686 basepar), høykopi-nummer, fordelaktige sekvenseringsreaksjonsfunksjoner og kommersiell tilgjengelighet 7 . Her ble en Escherichia coli vert brukt til å samle og håndtere chimærene fordi bakteriekulturer er billige og vokser raskt. På grunn av dette vil etterfølgende kloning av fusjonsfragmentene i de endelige målplasmiderne være nødvendig ( eks. Ekspresjonsvektorer som pRK415 i bakterier eller pCMV i pattedyrceller).

CAPRRESI ble testet for å fusere to primære sigmafaktorgener: E. colirpoD og Rhizobium etlisigA . Primær sigmafaktorer er RNA-polymerasubenheter som er ansvarlige for transkripsjonsinitiering, og de består av fire domener ( dvs. σ1, σ2, σ3 og σ4) 8 . Aminosyresekvensen lengterH av proteiner kodet av rpoD og sigA er henholdsvis 613 og 685. RpoD og SigA deler 48% identitet (98% dekning). Disse primære sigmafaktorene ble delt inn i to komplementære fragmenter mellom regioner σ2 og σ3. To kimære gener ble samlet i henhold til denne konstruksjonen: chimera 01 (RpoDσ1-σ2 + SigAσ3-σ4) og kimær 02 (SigAσ1-σ2 + RpoDσ3-σ4). DNA-fusjonsprodukter ble verifisert ved sekvensering.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. CAPRRESI-protokoll

MERK: Figur 1 representerer den generelle CAPRRESI-protokollen. Denne teknikken er basert på en silikondesign og den etterfølgende konstruksjonen av de ønskede kimærene.

  1. Utvalg av kloningsplasmidet, pUC18 eller pUC19.
    1. Velg pUC-vektoren som best passer til tekniske krav.
      MERK: Begge vektorer har samme sekvens, unntatt orienteringen av det flere kloningsstedet. Dette er viktig for utformingen av oligonukleotider og PCR-plasmidforstyrrelsen.
  2. Ved silikoanalyse av wildtype-gener og pUC18 / 19-sekvenser.
    1. Hent DNA-sekvensene av wildtype-gener og lagre dem i en FASTA-formatfil ( f.eks. Genes.fas).
      MERK: Sekvensene av pUC18 / 19 vektorer finnes i pUC.fas-filen ( Figur 1 , trinn 1).
    2. Bestem hvilken begrensning osvYmes kutter ikke wildtype-gener og pUC18 / 19-sekvenser ved å kjøre REsearch.pl-skriptet. Alternativt kan du utføre et restriksjonssysymsøk med et elektronisk verktøy ( Figur 1 , trinn 2).
      1. Skriv inn følgende i en terminal:
        Perl REsearch.pl genes.fas
        Perl REsearch.pl pUC.fas
        MERK: Disse kommandoene vil opprette følgende utdatafiler: genes_lin.fas, genes_re.fas, pUC_lin.fas og pUC_re.fas.
      2. Velg de riktige restriksjonsenzymer for kloning av wildtype-gener i det multiple kloningsstedet for den valgte pUC18 / 19-vektoren ved å sammenligne genene_re.fas og pUC.fas-filene. Velg orienteringen til innsatsen i forhold til ampicillinresistensgenet ( ampR ) av pUC18 / 19-vektoren.
    3. Design fremover og revers-oligonukleotider for å amplifisere kodende regionen av wildtype-gener (eksterne oligonukleotider). Inkluder det riktige restriktionsenzymstedet ved hver 5'-endeAv oligonukleotidene; Dette vil definere innsatsretningen.
      1. Inkluder et funksjonelt ribosombindingssted i de fremadrettede oligonukleotider.
      2. Sett inn begge wildtype-gener i samme retning inne i vektoren.
  3. Utvelgelse av brytningsområdene for chimeraenhet og plasmidforstyrrelse.
    1. Hent aminosyresekvensen av wildtype og ampR- gener ved å kjøre translate.pl-skriptet ( Figur 1 , trinn 3).
      1. Skriv inn følgende i en terminal:
        Perl translate.pl genes.fas
        Perl translate.pl ampR.fas

        MERK: Dette skriptet vil opprette følgende utdatafiler: genes_aa.fas og ampR_aa.fas.
    2. Juster de to wildtype-aminosyresekvensene globalt med en passende programvare ( f.eks. MUSCLE) 9 .
    3. Velg de ønskede pauseområdene (3-6 aminosyrer) for chimera asseMbly basert på sekvensjusteringen. Lagre dem i en fil i FASTA-format ( f.eks . Regions.fas).
    4. Finn DNA-sekvensene som koder for den valgte aminosyren, strekker seg på begge wildtype-gener.
  4. I silico- generasjon av synonyme DNA-sekvenser som inneholder restriktionsenzymsteder.
    1. Hent alle de synonym-DNA-sekvensene som kodes for hver aminosyresekvens strekkes utvalgt som bryteområder ( figur 1 , trinn 4); Disse sekvensene ble lagret i region.fas-filen.
      1. Skriv inn følgende i en terminal:
        Perl synonym.pl regions.fas
        MERK: Dette skriptet vil opprette region_syn.fas-utdatafilen.
    2. Søk etter restriktionsenzymsteder funnet på synonym-DNA-sekvenser.
      1. Skriv inn følgende i en terminal: perl REsynonym.pl regions_syn.fas
        MERK: Dette skriptet vil opprette region_syn-re.fas-utdatafilen.
    3. Velg ett restriksjonsenzym som deles mellom synonym-sekvenser av begge wildtype-gener; Dette nettstedet vil bli brukt til å samle kimærer via restriktionsenzym fordøyelse. Verifiser at det valgte restriksjons-enzymet ikke skjærer heller wildtype-genene eller pUC18 / 19-vektorsekvensene.
      1. Sammenlign restriksjonsenzymer funnet på genene_re.fas, pUC_re.fas og regions_syn-re.fas-filer.
    4. I silico erstatter originalene for deres synonym DNA-sekvenser på de tilsvarende stedene på begge wildtype-gener. Legg til synonyme DNA-sekvenser i wildtype-sekvensfilen (genes.fas).
    5. Få aminosyresekvensen av gener som finnes på genes.fas-filen ( perl translate.pl genes.fas ).
    6. Juster aminosyresekvensene oversatt fra wildtype og synonym DNA-sekvenser. Bekreft at begge sekvensene er de samme.
    7. Gjenta alle trinnene i denne delen med ampR- genet som er tilstede på pUC18 / 19 vektor.
      MERK: Målet er å forstyrre ampR- genet (fil ampR.fas) i to komplementære deler. Restriksjonsenzymet som er valgt for å forstyrre ampR- genet, bør være forskjellig fra det som brukes for kimærenheten.
  5. Uavhengig kloning av de to wildtype-gener i den valgte pUC18 / 19-vektoren (figur 1, trinn 3).
    1. Rens det valgte pUC18 / 19 plasmid DNA ved bruk av et plasmid DNA rensing kit.
      1. For eksempel transformer E. coli DH5a med pUC18 plasmid og dyrk transformantene over natten ved 37 ° C på fast LB-0,3 mg / ml ampicillin (Amp). Velg en transformant koloni, inokulere en ny LB-0.3 mg / mL Amp plate, og vokse den over natten ved 37 ° C.
      2. Ta del av forrige kultur og vokse den i flytende LB-0.3 mg / ml Amp i 6-8 timer ved 37 ° C. Ekstraher plasmid DNA ved bruk av et kit.
    2. PCR amplifiserer wildtype-gener fra det totale genomiske DNA ved bruk av appropDanner eksterne oligonukleotider. Bruk en høyfidelitets DNA-polymerase hvis mulig. Velg DNA-polymerasen som maksimerer utbyttet. Utfør PCR i henhold til produsentens retningslinjer og smeltetemperaturen til oligonukleotidene.
      1. Kjør PCR-sykluser, avhengig av DNA-polymerase, amplikonstørrelse, mal og oligonukleotider som anvendes. For eksempel for å amplifisere rpoD- DNA, lag en 50 μl reaksjon: 5 μl 10 x buffer, 2 μL 50 mM MgSO 4 , 1 μl 10 mM dNTP-blanding, 2 μl av hvert 10 μM oligonukleotid (tabell 2), 2 Μl mal DNA ( E. coli DH5a totalt DNA), 35,8 μl ultra-rent vann og 0,2 μl høyfidelitets-DNA-polymerase. Kjør følgende PCR-sykluser: 1 min ved 94 ° C for den første denatureringen etterfulgt av 30 sykluser av amplifikasjon (30 s ved 94 ° C til denaturering, 30 s ved 60 ° C for å anneere oligonukleotidene og 2 min ved 68 ° C å forlenge).
      2. Oppløs 1,2 gAgarose i 100 ml dobbeltdestillert vann ved å varme dem i mikrobølgeovnen. Monter en gelbrett og kam og legg dem i det horisontale gelstøtfangeren. Fyll gelskuffen med smeltet agaroseoppløsning og la det størkne. Fjern kammen.
      3. Plasser gelen i elektroforese kammeret. Fyll kammer med 1 x Tris-acetat-EDTA buffer. Legg 50 μl PCR-produkter i gelbrønnene. Elektroforese prøvene ( f.eks . Ved 110 V i 1 time).
      4. Etter elektroforese, flekk gelen i 100 ml dobbeltdestillert vann inneholdende 100 ul 1 mg / ml etidiumbromidoppløsning i 10 minutter med langsom risting. Vask gelen i dobbeltdestillert vann i ytterligere 10 minutter i sakte risting; Bruk en horisontal shaker.
        Forsiktig: Etidiumbromid er en giftig forbindelse; Bruk vernehansker og bomullslaboratorium.
      5. Rens vildtype-gen-DNA fra de tilsvarende båndene av gelen ved å bruke et kit. Visualiser båndene ved å plassere den farget gel i et UV-kammer (Anbefalt bølgelengde: 300 nm). Hold eksponeringen av gelen til et minimum. Bruk et DNA-rensingssett og følg produsentens anvisninger.
        Forsiktig: UV-stråling er farlig; Bruk beskyttelsesskjold, briller og bomullslaboratorium.
    3. Fordelte rensede wildtype-gener og pUC18 / 19 plasmid-DNA med restriktjonsenzymer i henhold til produsentens instruksjoner. Bruk hurtig fordøyelsesenzymer når det er mulig. For eksempel fordøye 6 μl pUC18 DNA (300 ng / μl) i 10 μl ultrapure vann, 2 μl 10X buffer, 1 μl Kpn I restriksjonsenzym og 1 μl Xba I restriksjonsenzym. La reaksjonen stå ved 37 ° C i 30 minutter.
      1. Inaktiver begrensningsenzymer i henhold til produsentens retningslinjer. For eksempel inaktivere dobbeltfordøyelsesreaksjonen Kpn I- Xba I ved 80 ° C i 5 minutter.
    4. Bland innsats: vektor DNA ved en volumetrisk ratiO av 3: 1. Følg produsentens instruksjoner for en ligasjonsreaksjon. Bruk raske ligeringsenzymer når det er mulig (la reaksjonen stå ved 25 ° C i 10 minutter).
      MERK: DNA-konsentrasjonen etter rensing ved hjelp av kittene er typisk god for fordøyelses- og ligeringsreaksjoner. Legg til for eksempel 6 μl rpoD DNA ( Kpn I- Xba I, 150 ng / μl), 3 μl pUC18 DNA ( Kpn I- Xba I, 150 ng / μl), 10 μl 2x buffer, 1 μl ultrapure Vann og 1 ul T4 DNA ligase. La ligeringsreaksjon ved 25 ° C i 10 minutter.
    5. Transform E. coli DH5a med 2-4 μl av ligeringsreaksjonen, som beskrevet i tilleggsmaterialene. Plater de transformerte cellene til faste LB / Amp / X-gal / IPTG-plater. La platene overnatte ved 37 ° C.
    6. Velg hvite fargete E. coli- kolonier av transformant og strekk dem på en ny LB / Amp-plate. La platene overnatte ved 37 ° C. </ Li>
    7. Utfør en koloni-PCR for å velge kandidater for sekvensering av reaksjonen, som beskrevet i tilleggsmaterialene. Ekstraher plasmid DNA fra kandidater. Alternativt fordøyes kandidatplasmid-DNA med de samme restriksjonsenzymer som brukes til kloning av innsatsene.
    8. Sekvenskandidatkonstruksjoner med en sekventeringsleverandør 10 . Monter sekvensen i silico ved hjelp av en DNA-samler 11 ( Figur 1 , trinn 5).
  6. Plasmidforstyrrelse ved PCR etterfulgt av restriktionsenzymfordøyelse.
    1. Design i silico fremover og revers-oligonukleotider ved pauseområder for henholdsvis vildtype og ampR- gener. Substitue i silico wildtype-fragmentet for den tilsvarende synonym-DNA-sekvensen (oppnådd i trinn 1.4).
      MERK: Denne synonym-DNA-sekvensen inneholder et restriksjonsenzymsted. Forover- og revers-oligonukleotider overlapper ved tHan restriktionsenzymsted. Oligonukleotider bør variere fra 21-27 nukleotider, ende med en cytosin eller guanin, og inneholder et restriksjonsenzymsted. Et fremad-oligonukleotid har samme sekvens som dets målområde på mal-DNA. Et omvendt oligonukleotid er den omvendte komplementære sekvens av målområdet på mal-DNA.
    2. Bruk de to wildtype-genkonstruksjonene som DNA-malen for PCR-reaksjoner ( f.eks. PUC18 rpoD og pUC18 sigA ). Oppnå to komplementære deler av hver konstruksjon (pUC18 rpoD σ1-σ2, pUC18 rpoD σ3 -σ4, pUC18 sigA σ1-σ2 og pUC18 sigA σ3 -σ4) ( Figur 1 , trinn 6).
    3. Last inn DNA-prøver i en agarosegel 1-1,2% [w / v]. Separat PCR-produktene fra DNA-malen ved elektroforese ( f.eks. 110 V i 1 time). Alternativt fordøyes PCR-reaksjonene med Dpn I for å bryte DNA-malen.
      MERK: DpnJeg enzymet gjenkjenner bare metylerte DNA-sekvenser (5'-GATC-3 ').
      1. Rens prøvene ved hjelp av et DNA-rensingssett. Følg produsentens retningslinjer.
    4. Dobbeltklyv alle komplementære DNA-fragmenter med de passende restriksjonsenzymer i henhold til produsentens anvisninger. Bruk hurtig-fordøye restriksjons enzymer når det er mulig. For eksempel fordobles pUC18rpoDσ1-σ2 DNA-fragmentet med Afl II og Spe I ved hjelp av produsentens protokoll. La fordøyelsesreaksjonen ved 37 ° C i 15 minutter.
    5. Inaktiver begrensningsenzymer i henhold til produsentens retningslinjer. For eksempel, inaktivere Afl II- Spe I ved 80 ° C i 20 minutter.
  7. Plasmidutvinning ved bruk av DNA-ligering og bakteriell transformasjon.
    1. Bland de riktige DNA-fragmentene i et volumetrisk forhold på 1: 1 for å samle det ønskede kimære genet ( figur1, trinn 7).
      MERK: På denne måten gjenopprettes integriteten til ampR- genet, som produserer et funksjonelt protein.
      1. Bland for eksempel 4 μL pUC18 rpoD σ1-σ2 DNA (fordøyd med Afl II- Spe I, 150 ng / μl), 4 μl pUC18 sigA σ3 -σ4 DNA ( Afl II- Spe I, 150 ng / μl), 10 μl 2x buffer, 2 μl ultrapure vann og 1 μl T4 DNA ligase; DNA-konsentrasjonen etter kitrensing er god nok til fordøyelse og påfølgende ligering. La ligeringsreaksjonen være ved 25 ° C i 10 minutter.
    2. Transform E. coli DH5a med 3-5 μl av kimærsammenligningsreaksjonen (tilleggsmaterialer). Voks transformantcellene i LB / Amp / X-gal / IPTG-plater over natten ved 37 ° C over natten.
    3. Velg hvite fargete E. coli- kolonier av transformant og strekk dem på en ny LB / Amp-plate. La platene overnatte på 37° C.
    4. Utfør en koloni-PCR for å velge kandidater for en sekvenseringsreaksjon, som beskrevet i tilleggsmaterialene. Visualiser bånd i en 1-1,2% (w / v) agarosegel ved å utføre elektroforese (beskrevet i trinn 2.3.2.1).
    5. Voks kulturer fra positive kandidater. Ekstraher plasmid DNA fra dem ved å bruke et plasmid DNA rensing kit.

2. Sekvenskandidat-kimære konstruksjoner

  1. Kontroller at kvaliteten på plasmid-DNA er god nok til sekvenseringsreaksjonen ved å følge retningslinjer fra sekvensleverandøren. Trekk ut DNA ved hjelp av rensingssett. For eksempel, på nettsiden til sekvensleverandøren, gi spesiell oppmerksomhet til den anbefalte DNA-konsentrasjonen for prøvene. Hent konsentrasjonen av prøver ved hjelp av et DNA-kvantifiseringsinstrument.
  2. Sekvenskandidat-kimære konstruksjoner med en sekvenseringsleverandør 10 .
  3. Samle se Quencing leser med en i silico DNA assembler 11 .
  4. Juster montert versus i silikondesignede kimære sekvenser ved hjelp av sekvensjusteringsverktøy 9 , 12 . Bekreft at det kimære genet ble smeltes med suksess.

3. Forberedelser

MERK: Alle trinn som involverer levende celler, skal utføres i en ren laminær hette med Bunsen-brenneren på.

  1. Produksjon av E. coli DH5a-kompetente celler.
    1. For å produsere E. coli- kompetente celler, følg publiserte protokoller 13 eller se tilleggsmaterialene . Alternativt, bruk kommersielt tilgjengelige kompetente celler.
  2. Transformering av E. coli DH5a-kompetente celler.
    1. For kjemisk transformasjon av E. coli kulturer, følg publiserte protokollerClass = "xref"> 13 eller se tilleggsmaterialene . Alternativt, bruk elektroporation for bakteriell transformasjon. Hvis kommersielle tilgjengelige kompetente celler brukes, følg produsentens retningslinjer.
  3. Rensing av genomisk og plasmid-DNA fra E. coli DH5a.
    1. Utfør nukleinsyreekstraksjon, som angitt i tilleggsmaterialene , ved bruk av kommersielt tilgjengelige kits eller følgende publiserte protokoller 13 .
  4. Utfør koloni-PCR.
    1. Bruk denne teknikken til å identifisere kandidat transformant kolonier for påfølgende sekvenseringsreaksjon.
      MERK: Denne metoden representerer ikke en endelig verifisering av sekvensens integritet. En detaljert beskrivelse av denne teknikken er tilgjengelig i tilleggsmaterialene .
  5. Forbereder løsningene.
    1. Se
  6. Last ned skript og sekvensfiler som kreves for CAPRRESI-protokollen.
    1. Last ned genbankfiler som inneholder den fullstendige genomsekvensen av den ønskede arten, ekstraher DNA-sekvensen av det valgte genet ved hjelp av en genomleser, og lagre det i fasta filformat. Last ned Perl-skriptene som kreves for CAPRRESI-protokollen. Lagre skript og sekvensfiler i samme katalog.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Figur 1 viser CAPRRESI. Ved anvendelse av denne metoden ble to kimære gener samlet ved å bytte domenene til to bakterielle primære sigmafaktorer ( dvs. E. coli RpoD og R. etli SigA). DNA-sekvensene av rpoD- og sigA- gener ble oppnådd ved bruk av Artemis Genome Browser 14 fra henholdsvis GenBank-genomfiler NC_000913 og NC_007761. DNA-sekvensen av pUC18-vektoren ble oppnådd fra nukleotiddatabasen til NCBI-serveren. I silicoanalyser av restriksjonsenzymsteder ble gjort på DNA-sekvenser ved å kjøre REsearch.pl Perl-skriptet (se trinn 1.2.2). Disse resultatene ble brukt for oligonukleotidutforming (trinn 1.2.3). Eksterne oligonukleotider innbefattet anerkjennelsessteder for Xba I og Kpn I restriksjonsenzymer for å klone vildtype-gener inn i pUC18-flere kloningsstedet. Det fremadrettede oligonukleotid inneholdt også en riboNoe bindingssted ( tabell 2 ). Genomisk DNA ble ekstrahert fra E. coli DH5a-celler dyrket i LB / Nal-buljong (37 ° C, 220-250 rpm) og R. etli CFN42-celler dyrket i PY / Nal / CaCl2-buljong (30 ° C, 220-250 rpm ). Disse prøvene ble brukt som DNA-maler for wildtype-genforsterkning (trinn 1.5.2).

Wildtype-gener ble amplifisert ved anvendelse av en Taq høyfidelitets -DNA-polymerase, som ble renset fra agarosegeler (DNA-rensingssett), fordoblet med Kpn I- Xba I-restriksjonsenzymer og klonet inn i pUC18-vektoren. Kjemisk kompetente E. coli DH5a-celler ble transformert med 5 μl ligeringsreaksjon tilsvarende vildtypekonstruksjoner pUC18 rpoD og pUC18 sigA (trinn 1.5.5). Transformante celler ble valgt på faste LB / Amp / X-gal / IPTG-plater dyrket ved 37 ° C. Wildtype-konstruksjoner ble verifisert av Sanger-sekvensenIng 10 . Sanger sekvens leser var i silico montert ved hjelp av MIRA 11 (trinn 1.5.8).

Aminosyresekvenser fra wildtype-gener ble oppnådd ved å kjøre translate.pl-skriptet (trinn 1.3.1). Etter justering av wildtype-gener med Clustal 12 ble aminosyreregionene TLV og NLR valgt på henholdsvis ampicillinresistensgen ( ampR ) og villtype primære sigmafaktorer (trinn 1.3.3). Disse aminosyreregioner ble brukt til å beregne alle mulige DNA-synonym-sekvenser som koder for dem ved å kjøre synonym.pl-skriptet (trinn 1.4.1). REsynonym.pl-skriptet søkte etter restriktionsenzymsteder funnet på de tidligere genererte synonym-DNA-sekvensene (trinn 1.4.2). De synonymregioner som introduserte det laveste antall endringer i forhold til wildtype-sekvensene ble valgt. For de primære sigmafaktorgener, wildtype-sekvenser av RpOD (AACTTACGT) og SigA (AACCTTCGC) ble utvekslet for AA CTTAAG G. Den sistnevnte inkluderte et Afl II-sted (fet). For ampR- genet ble wildtype-sekvensen ACGCTGGTG utvekslet for sitt synonym, AC ACTAGT G. Synonym-DNA-sekvensen satt inn i ampR- genet inneholdt et SpeI- sted (fet). Silikon- substitusjonen av wildtypen for de tilsvarende synonym-sekvenser ble gjort for å verifisere sekvensintegritet og oligonukleotidutformingen (trinn 1.2-1.4).

Synonome sekvensendringer ble introdusert ved PCR ved anvendelse av passende oligonukleotider ( tabell 2 ) og villtypekonstruksjoner som DNA-maler (trinn 1.5.2). Amplifikasjonsreaksjoner fremstilt fire komplementære deler: pUC18 rpoD σ1-σ2, pUC18 rpoD σ3 -σ4, pUC18 sigA σ1 -σ2 og pUC18 sigA σ3 -σ4. Komplementære deler disBrøt seg ikke bare sigmafaktorer, men også ampR- gener. Komplementære deler ble renset ved bruk av et DNA-rensingssett (trinn 1.6.3).

Disse komplementære DNA-fragmenter ble fordoblet med Afl II og Spe I-restriksjonsenzymer (trinn 1.6.4). Ifølge CAPRRESI-design ble DNA-fragmenter pUC18 rpoD σ1-σ2 ligert med pUC18 sigA σ3 -σ4 for å oppnå chimera 01, og pUC18 sigA σ1-σ2 ble ligert med pUC18 rpoD σ3 -σ4 for å samle chimera 02 (trinn 1.7.1-1.7 0,3). Kjemisk kompetente E. coli DH5a-celler ble transformert med 5 ul av ligeringsreaksjonen av pUC18 chim01 og pUC18 chim02 (trinn 1.7.4). Transformante celler ble valgt på faste LB / Amp / X-gal / IPTG-plater dyrket ved 37 ° C (trinn 1.7.5). Kimære konstruksjoner ble verifisert ved Sanger-sekvensering 10 (trinn 2). Sanger-sekvens rEads ble samlet sammen med MIRA 11 , og dets resulterende filer er oppført i tabell 3 . Figur 2 viser justeringene (utført ved bruk av MUSCLE) 9 av sammenstilte sekvenser av wildtype og kimære gener ved bruddområder.

Figur 1
Figur 1: CAPRRESI oversikt. Representasjoner: gener (tykke piler), funksjonelle plasmider (lukkede sirkler) og oligonukleotider (tynne, svarte piler). Restriktionsenzymsteder satt inn i oligonukleotider fremkommer i farger. Forkortelser: Wt (villtype), FWD (fremad oligonukleotid), REV (revers oligonukleotid), ampR (ampicillinresistensgen), RES (restriksjonsenzymsted), RE (restriksjonsenzym). Vennligst klikk her for å se en større versjonPå denne figuren.

Figur 2
Figur 2: Justering av samlede villtype og kimære gensekvenser. Samlede DNA-sekvenser ble justert ved bruk av MUSCLE 9 . Sekvenser ble satt sammen med MIRA 11 . Synonym sekvenser vises i svart. Avl II-anerkjennelsessiden vises understreket. IUPAC-nukleotidkode: R (A eller G) og K (G eller T). Konstruksjoner: rpoD (rød), sigA (blå), chimera 01-sekvens ( rpoD σ1-σ2-sigA σ3 -σ4) og chimera 02-sekvensen ( sigA σ1-σ2-rpoD σ3 -σ4). Vennligst klikk her for å se en større versjon av denne figuren.

Løsning komponenter Bruksanvisning
Mengde forbindelse
Luria-Bertani (LB) kjøttkraft 5 g gjærekstrakt Oppløs alle komponentene i vann. Autoklav. Oppbevares ved romtemperatur til bruk. For solid LB-buljong, tilsett 15 g bakteriologisk agar til oppskriften.
10 g Kaseinpepton
10 g NaCl
Opptil 1 liter Dobbelt destillert vann
LB / Amp / X-gal / IPTG-plater 100 ml Smeltet fast LB-buljong Legg alle komponenter til temperert LB buljong. Fyll Petriskål og vent til de stivner. Utfør trinnene i en ren laminær hette med Bunsen-brenneren på.
100 μl Ampicillin (Amp) [100 mg / ml]
100 μl X-gal [20 mg / ml]
50 μl 1 M IPTG løsning
Pepton gjær (PY) buljong 3 g gjærekstrakt Oppløs alle komponentene i vann. Autoklav. Oppbevares ved romtemperatur til bruk. For fast PY-kjøttkraft, tilsett 15 g bakteriologisk agar til oppskriften. For R. etli-kultur, tilsett 700 μL 1 M CaCl2-oppløsning før bruk.
5 g Kaseinpepton
Opptil 1 liter Dobbelt destillert vann
PY / CaCl2 / Nal plater 100 ml Smeltet fast PY buljong Legg til alle komponenter til temperert PY-kjøttkraft. Fyll Petriskålene og vent til de stivner. Utfør trinnene i en ren laminær hette med Bunsen-brenneren på.
700 μl 1 M CaCl2 løsning
100 μl Nalidixinsyre (Nal) [20 mg / ml]
1 M kalsiumklorid (CaCl2) løsning 11,1 g CaCl2 Oppløs CaCl 2 i vann. Autoklav. Oppbevares ved romtemperatur.
Opp til 100 ml Dobbelt destillert vann
Tris-EDTA (TE) 10: 1 pH 8,0 1 ml 1 M Tris løsning Bland alle komponenter. Autoklav. Oppbevares ved romtemperatur.
400 μl 0,25 M EDTA-løsning
Opp til 100 ml Dobbelt destillert vann
TE 50:20 pH 8,0 5 ml 1 M Tris løsning Bland alle komponenter. Autoklav. Oppbevares ved romtemperatur. </ Td>
8 ml 0,25 M EDTA-løsning
Opp til 100 ml Dobbelt destillert vann
TE 10: 1 10 mM NaCl-oppløsning 58,4 mg NaCl Oppløs NaCl i TE 10: 1. Autoklav. Oppbevares ved romtemperatur.
Opp til 100 ml TE 10: 1 pH 8,0 løsning
Lysisløsning I 80 mg lysozym Oppløs og bland alle komponenter i vann. Filtrer steriliser ved hjelp av et 0,22 μm filter. Oppbevares ved romtemperatur.
2 ml 0,5 M glukoseoppløsning
400 μl 0,5 M EDTA-løsning
500 μl 1 M Tris løsning
Opptil 20 ml Sterilisert dobbeltdestillert vann
Lysisløsning II 1,2 ml 5 M natriumhydroksyd (NaOH) løsning Oppløs alle komponentene i vann. Filtrer steriliser ved hjelp av et 0,22 μm filter. Oppbevares ved romtemperatur.
3 ml 10% natriumdodecylsulfat (SDS) løsning
Opptil 30 ml Sterilisert dobbeltdestillert vann
Lysisløsning III 29,4 g Kaliumacetat (CH3 COOK) Oppløs og bland alle komponenter i vann. Filtrer steriliser ved hjelp av et 0,22 μm filter. Oppbevares ved romtemperatur.
11,5 ml Absolutt eddiksyre (CH3COOH)
Opp til 100 ml Sterilisert dobbeltdestillert vann
1 M magnesiumklorid (MgCl2) løsning 9,5 g MgCl2 Oppløs MgCl2 i water. Autoklav. Oppbevares ved romtemperatur.
Opp til 100 ml Dobbelt destillert vann
3 M natriumacetat (CH3COONa) løsning 24,6 g CH 3 COONa Oppløs CH 3 COONa i vann. Autoklav. Oppbevares ved romtemperatur
Opp til 100 ml Dobbelt destillert vann
10% SDS løsning 10 g SDS Oppløs SDS i vann med magnetisk omrøringsstang ved lav hastighet. Autoklav. Oppbevares ved romtemperatur.
Opp til 100 ml Dobbelt destillert vann
3 M CH 3 COOK løsning 29,4 g CH 3 COOK Oppløs CH 3 COOK i vann. Filtrer steriliser ved hjelp av et 0,22 μm filter. Oppbevares ved romtemperatur. Opp til 100 ml Sterilisert dobbeltdestillert vann
Proteinase K-løsning 5 mg Proteinase K Oppløs proteinase K i TE 50:20 løsning. Varm ved 37 ºC i 1 time. Oppbevares ved -20 ºC.
Opptil 1 ml TE 50:20 pH 8,0 løsning
RNase-oppløsning 10 mg RNase Oppløs RNase i vann. Varme ved 95 ºC i 10 min. Oppbevares ved -20 ºC.
Opptil 1 ml Sterilisert ultrapure vann
1 M isopropyl-P-D-tiogalaktosid (IPTG) løsning 238,3 mg IPTG Oppløs IPTG i vann. Filtrer steriliser ved hjelp av et 0,22 μm filter. Oppbevares ved -20 ºC.
Opptil 1 ml Sterilisert ultrapure vann
20 mg X-gal Oppløs X-gal i vann. Filtrer steriliser ved hjelp av et 0,22 μm filter. Oppbevares ved -20 ºC.
Opptil 1 ml Sterilisert ultrapure vann
Fenol: kloroform: isoamylalkohol 24: 24: 1 løsning 24 ml fenol Bland alle komponenter. Oppbevares i en gult kapslet flaske ved 4 ºC. FORSIKTIGHET! Farlig materiale. Bruk vernebriller, hansker og bomullslaboratorium. Bruk en avtrekksdeksel. Ikke slå Bunsen-brenneren eller annen brannkilde under håndtering. Alternativ: bruk kommersiell fenol: kloroform: isoamylalkohol 25: 24: 1 løsning
24 ml kloroform
1 ml Isoamylalkohol
0,5 M glukoseoppløsning 9 g glucose Oppløs glukose i vann. Filtrer steriliser ved hjelp av et 0,22 μm filter. Oppbevares ved romtemperatur.
Opp til 100 ml Sterilisert ultrapure vann
0,5 M etylendiamintetraeddiksyre (EDTA) pH 8,0-løsning 14,6 g EDTA Oppløs EDTA i vann. Juster pH med 5 M NaOH løsning. Autoklav. Oppbevares ved romtemperatur.
Opp til 100 ml Dobbelt destillert vann
0,25 M EDTA pH 8,0-løsning 7,3 g EDTA Oppløs EDTA i vann. Juster pH med 5 M NaOH løsning. Autoklav. Oppbevares ved romtemperatur.
Opp til 100 ml Dobbelt destillert vann
1 M Tris pH 8,0 løsning 12,1 g Tris Oppløs Tris i vann. Juster pH medAbsolutt saltsyre (HCI). Autoklav. Oppbevares ved romtemperatur.
Opp til 100 ml Dobbelt destillert vann
5 M natriumhydroksyd (NaOH) løsning 19,9 g NaOH Oppløs NaOH i vann. Oppbevares ved romtemperatur. FORSIKTIGHET! Caustisk forbindelse.
Opp til 100 ml Sterilisert dobbeltdestillert vann
0,1 M NaOH-oppløsning 399 mg NaOH Oppløs NaOH i vann. Oppbevares ved romtemperatur.
Opp til 100 ml Sterilisert dobbeltdestillert vann
Nalidixsyre (Nal) stamløsning 60 mg Nalidixinsyre Oppløs Nal i vann. Filtrer steriliser ved hjelp av et 0,22 μm filter. Oppbevares ved 4 ºC.
Opptil 3 ml 0,1 MNAOH-oppløsning
Ampicillin (Amp) stamløsning 300 mg ampicillin Oppløs amp i vann. Filtrer steriliser ved hjelp av et 0,22 μm filter. Oppbevares ved 4 ºC.
Opptil 3 ml Sterilisert dobbeltdestillert vann
10x tris-acetat-EDTA buffer 48,4 g Tris Oppløs alle komponentene i vann. Autoklav. Oppbevares ved romtemperatur.
20 ml 0,5 M EDTA-løsning
11,44 ml Iseddik
Opptil 1 liter Dobbelt destillert vann

Tabell 1: Løsningspreparat. Instruksjoner for løsning av oppløsning.

Nei. Kode Sekvens Lengde (nt) Egenskaper
1 RpoD-FWD GC TCTAGA GA AGGAGA TATCATATGGAGCAAAACCCGCAGTCA 43 Xbal sted; Vildtype-genforsterkning og vektorkloning
2 Rød-REV GG GGTACC TTAATCGTCCAGGAAGCTACG 29 Kpnl- sted; Vildtype-genforsterkning og vektorkloning
3 SIGA-FWD GC TCTAGA GA AGGAGA TATCATATGGCAACCAAGGTCAAAGAG 43 Xbal sted; Vildtype-genforsterkning og vektorkloning
4 SIGA-REV GG GGTACC TTAGCTGTCCAGAAAGCTTCT </ Td> 29 Kpnl- sted; Vildtype-genforsterkning og vektorkloning
3 AmpR-FWD AC ACTAGT GAAAGTAAAAGAT 21 SpeI- nettsted satt inn, synonym mutasjon. Forstyrrelse av ampR- genet
4 AmpR-REV TC ACTAGT GTTTCTGGGTGAG 21 SpeI- nettsted satt inn, synonym mutasjon. Forstyrrelse av ampR- genet
5 σ2RpoD-FWD AA CTTAAG GCTGGTTATTTCTATCGCT 27 AflII- sted satt inn, synonym mutasjon. Bygging av chim01-02
6 σ2RpoD-REV GC CTTAAG TTCGCTTCAACCATCTCTT 27 AflII- sted satt inn, synonym mutasjon. Bygging av chim01-02
7 σ2SigA-FWD AA CTTAAG GCTCGTCATTTCAATCGCC 27 AflII- sted satt inn, synonym mutasjon. Bygging av chim01-02
8 σ2SigA-REV GC CTTAAG TTCGCTTCGACCATTTCCT 27 AflII- sted satt inn, synonym mutasjon. Bygging av chim01-02

Tabell 2: Oligonukleotidsekvenser. Restriktionsenzymsteder ser understreket ut. Ribosom bindingssted: fet.

Konstruksjon Sequence-fil Kvalitetsfil
chimera01 chim01_out.unpadded.fasta chim01_out.unpadded.fasta.qual
chim01_A3 / B3 / E2 / F2 / G2 /H2.pdf
chimera02 chim02_out.unpadded.fasta chim02_out.unpadded.fasta.qual
chim02_C3 / D3 / E3 / F3 / G3 / H3.pdf
rpoD rpod_out.unpadded.fasta rpod_out.unpadded.fasta.qual
Siga siga_out.unpadded.fasta siga_out.unpadded.fasta.qual

Tabell 3: Sekvensfiler oppnådd med MIRA assembler og DNA sequencer. Sanger-sekvensering leser fra kimære og wildtype-konstruksjoner ble satt sammen med MIRA 11- programvare ved hjelp av kartleggingsalternativet. Kromatogrammer av kimær-sekvensering vises som PDF-filer.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

CAPRRESI ble designet som et alternativ til PRM 2 . Den opprinnelige PRM er en kraftig teknikk; Det tillater fusjon av DNA-sekvenser langs hvilken som helst del av de valgte gener. For PRM bør wildtype-gener klones inn i det samme plasmidet. Deretter er oligonukleotider konstruert inne i wildtype- og antibiotikaresistensgener funnet på plasmidet. Plasmidforstyrrelse oppnås ved PCR ved bruk av stump-endede, høyfidelis-DNA-polymeraser og tidligere utformede oligonukleotider. Ligeringen av komplementære PCR-produkter samler kimære gener og gjenoppretter antibiotikaresistenskassetten, noe som resulterer i funksjonell plasmidutvinning. PRM muliggjør konstruksjon av kimære genbiblioteker på den samme plasmidbakgrunn. Dessverre kan ligeringen av stump-endede DNA-sekvenser være teknisk vanskelig. Chimera-montering ved overlappende PCR-fragmenter 1 krever også at DNA-polymeraser gir stump-endede produkter ogDNA-rensing for hver reaksjon. De kimære gener som er sammenstilt ved denne teknikken er lineære DNA-produkter. Kloning av hver konstruksjon i målvektoren kunne forsinke ytterligere analyse.

CAPRRESI drar nytte av mange av styrken til PRM og forenkler også ligeringen av komplementære DNA-fragmenter ved å bruke restriksjonsenzymsteder på synonym-DNA-sekvensområder. Av disse grunner krever CAPRRESI ikke stump DNA-polymeraser. Bruken av synonym-DNA-sekvenser begrenser fusjonssteder for kimærsammenstilling, men forbedrer ligeringseffektiviteten. En annen viktig modifikasjon innført i CAPRRESI er at kimærene er samlet og håndtert i pUC18 / 19 vektorer. Disse vektorene har flere fordelaktige egenskaper, som tidligere nevnt. Kimært DNA kunne oppnås ved å propagere konstruksjonsvektoren i E. coli- verter. Etterfølgende kloning av kimære gener i det endelige plasmidet ( f.eks . En ekspresjonsvektor) er noen gangerpåkrevd.

CAPRRESI er også avhengig av silikahåndtering av DNA- og aminosyresekvenser. Ad hoc Perl-skript muliggjør valget av de passende restriksjonsenzymer for å klone vildtype-gener, beregningen av alle synonym-DNA-sekvenser som svarer til pauseområder (for kimærenhet) og identifikasjon av restriksjonsenzymer for å forenkle plasmidutvinning. Gitt disse betingelsene, CAPRRESI er et alternativ for fusing proteinkoding gener. Kritiske trinn i CAPRRESI-protokollen er: 1) valget av bruddområder og 2) rensingen av PCR-produkter. Brytegrupper er strekker hvor synonyme sekvenser beregnes, og produserer restriktionsenzymsteder som ikke finnes på wildtype-sekvenser. Bruken av restriktionsenzymsteder for kimærsammensetning eliminerer behovet for DNA-polymeraser som gir stumpende produkter og letter ligeringsreaksjonen. Ikke alle regioner vil ha brukbare restriktionsenzymsteder; foAv denne grunn anbefales det å flytte bryteområder med en aminosyre om gangen til den beste sekvensen er funnet. Hvis silikondesignet ikke tillater bevegelse av brytningsområdene eller sekvensstrinnene mangler synonym-DNA-sekvenser med egnede restriktionsenzymsteder, anbefales det å smelte målgener ved bruk av overlappende oligonukleotider og å introdusere synonym-DNA-sekvenser i ampicillinresistensgenet (Funnet på vektoren) bare. På denne måten kan genene smeltes på hvilken som helst del, og plasmidutvinningen er avhengig av ligering av ett unikt sted (fordøyd med bare ett restriksjonsenzym). Fleksibiliteten til CAPPRESI gjør at den kan utføres i kombinasjon med andre teknikker.

Rensingen av PCR-produkter utføres for å eliminere mal-DNA, noe som reduserer sjansene for foreldreplasmidforurensning etter ligering av komplementære DNA-fragmenter. Å oppfylle disse to kritiske trinnene forbedrer bacTerial transformasjonseffektivitet (antall korrekt monterte konstruksjoner), slik at CAPRRESI kan utføres med enten kjemisk kompetent (CaCl2) eller elektrokompetente E. coli- celler. Den første typen kompetente celler representerer den billigste kilden til E. coli kulturer, anvendt for bakteriell transformasjon i de fleste laboratorier. På grunn av alle funksjonene som er vist tidligere, representerer CAPRRESI et nyttig alternativ for montering av kimærer.

Videre kan CAPRRESI fungere i kombinasjon med overlappende PCR-fragmenter eller plasmidgjenvinningsteknikker. For eksempel, i stedet for å sette inn to synonyme sekvenser per komplementær DNA-del, kunne det ønskede bryteområde (på mål-wildtype-genene) bruke overlappende oligonukleotider for å smelte mellomliggende sekvenser. Innføringen av synonym-sekvenser kan begrenses til ampR- genet av pUC18 / 19 vektorer, hvilket fører til bruk av bare ett restriksjonsenzym for å gjenopprette plasmiD integritet. Disse fremtidige applikasjonene kunne styrke CAPRRESI ved å tillate sammensmeltning av alle typer DNA-sekvenser ( dvs. ikke bare proteinkoding-gener), uten å svekke effektiviseringen av ligering.

For å teste CAPRRESI ble to kimære sigmafaktorer samlet ved å bytte regioner av to villtype primære sigmafaktorgener: rpoD ( E. coli ) og sigA ( R. etli ). Alle kjente primære sigmafaktorer har fire domener, σ1 til σ4 8 . Chimera 01 består av RpoDσ1-σ2 og SigAσ3-σ4, mens chimera 02 har SigAσ1-σ2 og RpoDσ3-σ4. Integriteten til de kimære konstruksjonene ble verifisert ved Sanger-sekvensering 10 ( figur 2 ).

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne erklærer at de ikke har konkurrerende økonomiske interesser.

Acknowledgments

Dette arbeidet ble støttet av Consejo Nacional de Ciencia og Tecnología, CONACYT, México (stipendnummer 154833) og Universidad Nacional Autónoma de México. Forfatterne ønsker å takke Víctor González, Rosa I. Santamaría, Patricia Bustos og Soledad Juárez for deres administrative og tekniske råd.

Materials

Name Company Catalog Number Comments
Platinum Taq DNA polymerase High Fidelity Thermo Fisher 11304011 Produces a mix of blunt/3’-A overhang ended PCR products
High pure plasmid isolation kit Roche 11754785001 Used for all plasmid purification reactions
High pure PCR product purification kit Roche 11732676001 Used for all PCR purification reactions from agarose gels
AflII restriction enzyme New England Biolabs R0520L Recognizes sequence 5’-CTTAAG-3’ and cuts at 37 °C
KpnI-HF restriction enzyme New England Biolabs R3142L Recognizes sequence 5’-GGTACC-3’ and cuts at 37 °C
SpeI-HF restriction enzyme New England Biolabs R3133L Recognizes sequence 5’-ACTAGT-3’ and cuts at 37 °C
XbaI restriction enzyme New England Biolabs R0145L Recognizes sequence 5’-TCTAGA-3’ and cuts at 37 °C
Ampicillin sodium salt Sigma Aldrich A0166-5G Antibiotics
Nalidixic acid Sigma Aldrich N8878-5G Antibiotics
Yeast Extract Sigma Aldrich Y1625-1KG Bacterial cell culture
Casein peptone Sigma Aldrich 70171-500G Bacterial cell culture
NaCl Sigma Aldrich S9888-1KG Sodium chloride
Agar Sigma Aldrich 05040-1KG Bacterial cell culture
XbaI restriction enzyme Thermo Fisher FD0684 Fast digest XbaI enzyme
KpnI restriction enzyme Thermo Fisher FD0524 Fast digest KpnI enzyme
Quick Ligation Kit New England Biolabs M2200S Fast DNA ligation kit
AflII restriction enzyme Thermo Fisher FD0834 Fast digest AflII enzyme
SpeI restriction enzyme Thermo Fisher FD1253 Fast digest SpeI enzyme

DOWNLOAD MATERIALS LIST

References

  1. Horton, R. M., Hunt, H. D., Ho, S. N., Pullen, J. K., Pease, L. R. Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene. 77, (1), 61-68 (1989).
  2. Vos, M. J., Kampinga, H. H. A PCR amplification strategy for unrestricted generation of chimeric genes. Anal. Biochem. 380, (2), 338-340 (2008).
  3. Hawkins, N. C., Garriga, G., Beh, C. T. Creating Precise GFP Fusions in Plasmids Using Yeast Homologous Recombination. Biotechniques. 34, (1), 1-5 (2003).
  4. Sander, J. D., Joung, J. K. CRISPR-Cas systems for editing, regulating and targeting genomes. Nat Biotechnol. 32, (4), 347-355 (2014).
  5. Nagy, A. Cre recombinase: The universal reagent for genome tailoring. Genesis. 26, (2), 99-109 (2000).
  6. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods. 6, (5), 343-345 (2009).
  7. Norrander, J., Kempe, T., Messing, J. Construction of improved M13 vectors using oligodeoxynucleotide-directed mutagenesis. Gene. 26, (1), 101-106 (1983).
  8. Gruber, T. M., Gross, C. A. Multiple sigma subunits and the partitioning of bacterial transcription space. Annu Rev Microbiol. 57, 441-466 (2003).
  9. Edgar, R. C. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 32, (5), 1792-1797 (2004).
  10. Macrogen Inc. Seoul, Rep. Of Korea. Available from: http://dna.macrogen.com/eng/index.jsp (2016).
  11. Chevreux, B. MIRA: an automated genome and EST assembler. Available from: http://www.chevreux.org/thesis/index.html 1-161 (2005).
  12. Thompson, J. D., Gibson, T. J., Higgins, D. G. Multiple sequence alignment using ClustalW and ClustalX. Curr Protoc Bioinformatics. Chapter 2 (Unit 2.3) 1-22 (2002).
  13. Sambrook, J., Russell, D. W. Molecular Cloning: A laboratory manual. CSHLP. (2001).
  14. Rutherford, K., et al. Artemis: sequence visualization and annotation. Bioinformatics. 16, (10), 944-945 (2000).
CAPRRESI: Chimera Assembly ved Plasmid Recovery og Restriction Enzyme Site Insertion
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Santillán, O., Ramírez-Romero, M. A., Dávila, G. CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion. J. Vis. Exp. (124), e55526, doi:10.3791/55526 (2017).More

Santillán, O., Ramírez-Romero, M. A., Dávila, G. CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion. J. Vis. Exp. (124), e55526, doi:10.3791/55526 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter