Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

CAPRRESI: Ensamblaje de quimeras por inserción de sitios de enzimas de recuperación y restricción de plásmidos

doi: 10.3791/55526 Published: June 25, 2017

Summary

Aquí, se presenta el ensamblaje de quimeras mediante la recuperación de plásmidos y la inserción en el sitio de enzima de restricción (CAPRRESI), un protocolo basado en la inserción de sitios de enzimas de restricción en secuencias de ADN sinónimas y recuperación funcional de plásmidos. Este protocolo es un método rápido y de bajo costo para fusionar genes codificadores de proteínas.

Abstract

En este caso, presentamos el ensamblaje de la quimera mediante la recuperación del plásmido y la inserción del sitio de la enzima de restricción (CAPRRESI). CAPRRESI se beneficia de muchas fortalezas del método original de recuperación de plásmidos e introduce la digestión con enzimas de restricción para facilitar las reacciones de ligación de ADN (necesarias para el montaje de quimeras). Para este protocolo, los usuarios clonan genes de tipo salvaje en el mismo plásmido (pUC18 o pUC19). Después de la selección in silico de las regiones de secuencia de aminoácidos en las que deberían montarse quimeras, los usuarios obtienen todas las secuencias de ADN sinónimas que las codifican. Los scripts Perl ad hoc permiten a los usuarios determinar todas las secuencias de ADN del sinónimo. Después de este paso, otro script Perl busca sitios de enzimas de restricción en todas las secuencias de ADN sinónimas. Este análisis in silico también se realiza usando el gen de resistencia a ampicilina ( ampR ) encontrado en plásmidos pUC18 / 19. Los usuarios diseñan oligonucleótidos dentro de regiones sinónimas para interrumpir genes de tipo salvaje y ampR por PCR. Después de obtY purificación de fragmentos de ADN complementarios, se lleva a cabo la digestión con enzimas de restricción. El montaje de la quimera se logra mediante ligación de fragmentos de ADN complementarios apropiados. Los vectores pUC18 / 19 se seleccionan para CAPRRESI porque ofrecen ventajas técnicas, tales como tamaño pequeño (2,686 pares de bases), alto número de copias, características de reacción de secuenciación ventajosas y disponibilidad comercial. El uso de enzimas de restricción para el montaje de quimeras elimina la necesidad de polimerasas de ADN que producen productos de extremos romos. CAPRRESI es un método rápido y de bajo costo para fusionar genes codificadores de proteínas.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

El montaje de genes quiméricos ha sido ampliamente utilizado en biología molecular para elucidar la función de la proteína y / o para propósitos biotecnológicos. Existen diferentes métodos para fusionar genes, tales como la superposición de la amplificación del producto de PCR 1 , la recuperación 2 del plásmido, la recombinación homóloga 3 , los sistemas CRISPR-Cas9 4 , la recombinación dirigida 5 y el conjunto 6 de Gibson. Cada una de ellas ofrece diferentes ventajas técnicas; Por ejemplo, la flexibilidad del diseño de PCR superpuesto, la selección in vivo de construcciones durante la recuperación del plásmido o la alta eficiencia de los sistemas CRISPR-Cas9 y Gibson. Por otro lado, pueden surgir algunas dificultades al realizar algunos de estos métodos; Por ejemplo, los dos primeros enfoques se basan en fragmentos de ADN de extremos romos, y la ligadura de estos tipos de productos podría ser técnicamente difícil en comparación con sticKy-terminó ligadura. La recombinación dirigida puede dejar trazas de secuencias de ADN adicionales (cicatrices) en el original, como en el sistema CreloxP 5 . CRISPR-Cas9 a veces puede modificar otras regiones del genoma, además de la meta de sitio [ 4] .

Aquí, se introduce el conjunto de quimeras mediante la recuperación del plásmido y la inserción del sitio de la enzima de restricción (CAPRRESI), un protocolo para fusionar genes que codifican proteínas que combina el método de recuperación de plásmidos (PRM) con la inserción de sitios de enzimas de restricción en secuencias de ADN sinónimas, . Para asegurar la integridad de la secuencia de aminoácidos, los sitios de enzimas de restricción se insertan en secuencias de secuencia de ADN sinónimo. Entre los beneficios de CAPPRESI cabe destacar que puede realizarse con reactivos / herramientas de laboratorio comunes ( por ejemplo , enzimas, células competentes, soluciones y termociclador) y que puede dar resultados rápidos (cuando se utilizan las enzimas apropiadas). Basándose en la restricciónLos sitios de enzimas que emergen de secuencias de ADN sinónimas pueden limitar la selección de los puntos de fusión exactos dentro de las proteínas de interés. En tales casos, los genes diana deben fusionarse usando oligonucleótidos superpuestos, y los sitios de enzimas de restricción deben insertarse en el gen de resistencia del vector.

CAPRRESI consiste en siete pasos simples ( Figura 1 ): 1) selección del vector de clonación, pUC18 o pUC19 6 ; 2) análisis in silico de las secuencias de tipo salvaje a fusionar; 3) selección de las regiones de rotura para el montaje de la quimera y la interrupción del plásmido; 4) generación in silico de secuencias de ADN sinónimas que contienen sitios de enzimas de restricción; 5) clonación independiente de los genes de tipo salvaje en el plásmido seleccionado; 6) interrupción del plásmido por PCR, seguido de digestión con enzimas de restricción; Y 7) recuperación de plásmido usando ligación de ADN y transformación bacteriana. Los genes quiméricos producidos por esta técnica deben ser verificados wCon la secuenciación.

Los vectores pUC18 / 19 ofrecen ventajas técnicas para la clonación y montaje de quimeras, tales como tamaño pequeño ( es decir, 2,686 pares de bases), alto número de copias, características de reacción de secuenciación ventajosas y disponibilidad comercial 7 . Aquí, un huésped de Escherichia coli se utilizó para ensamblar y manejar las quimeras porque los cultivos bacterianos son baratos y crecen rápidamente. Teniendo en cuenta esto, será necesaria la clonación subsiguiente de los fragmentos de fusión en los plásmidos diana finales ( por ejemplo, vectores de expresión como pRK415 en bacterias o pCMV en células de mamífero).

CAPRRESI se ensayó por fusionar dos genes del factor sigma primario: E. colirpoD y Rhizobium etlisigA . Los factores sigma primarios son subunidades de ARN polimerasa responsables de la iniciación de la transcripción, y consisten en cuatro dominios ( es decir, σ1, σ2, σ3 y σ4) 8 . La longitud de la secuencia de aminoácidosH de proteínas codificadas por rpoD y sigA son 613 y 685, respectivamente. RpoD y SigA comparten 48% de identidad (98% de cobertura). Estos factores sigma primaria se dividieron en dos fragmentos complementarios entre las regiones σ2 y σ3. Se montaron dos genes quiméricos según este diseño: quimera 01 (RpoDσ1-σ2 + SigAσ3-σ4) y quimera 02 (SigAσ1-σ2 + RpoDσ3-σ4). Los productos de fusión de ADN se verificaron por secuenciación.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Protocolo CAPRRESI

NOTA: La figura 1 representa el protocolo CAPRRESI general. Esta técnica se basa en un diseño in silico y la posterior construcción de las quimeras deseadas.

  1. Selección del plásmido de clonación, pUC18 o pUC19.
    1. Seleccione el vector pUC que mejor se adapte a las demandas técnicas.
      NOTA: Ambos vectores tienen la misma secuencia, excepto la orientación del sitio de clonación múltiple. Esto es importante para el diseño de oligonucleótidos y la ruptura del plásmido de PCR.
  2. Análisis in silico de los genes de tipo salvaje y secuencias pUC18 / 19.
    1. Obtener las secuencias de ADN de los genes de tipo salvaje y guardarlos en un archivo en formato FASTA ( por ejemplo, genes.fas).
      NOTA: Las secuencias de vectores pUC18 / 19 están contenidas en el archivo pUC.fas ( Figura 1 , etapa 1).
    2. Determinar qué enzima de restricciónYmes no cortan los genes wildtype y las secuencias pUC18 / 19 ejecutando el script REsearch.pl. Alternativamente, realice una búsqueda de sitios de enzimas de restricción con una herramienta en línea ( Figura 1 , paso 2).
      1. Escriba lo siguiente en un terminal:
        Perl REsearch.pl genes.fas
        Perl REsearch.pl pUC.fas
        NOTA: Estos comandos crearán los siguientes archivos de salida: genes_lin.fas, genes_re.fas, pUC_lin.fas y pUC_re.fas.
      2. Seleccione las enzimas de restricción apropiadas para clonar los genes de tipo salvaje en el sitio de clonación múltiple del vector pUC18 / 19 elegido comparando los archivos genes_re.fas y pUC.fas. Elija la orientación del inserto relativo al gen de resistencia a ampicilina ( ampR ) del vector pUC18 / 19.
    3. Diseñar oligonucleótidos directos e inversos para amplificar la región codificante de los genes de tipo salvaje (oligonucleótidos externos). Incluir el sitio de enzima de restricción adecuado en cada extremo 5 'De los oligonucleótidos; Esto definirá la orientación del inserto.
      1. Incluir un sitio funcional de unión al ribosoma en los oligonucleótidos directos.
      2. Insertar ambos genes de tipo salvaje en la misma orientación dentro del vector.
  3. Selección de las regiones de ruptura para el ensamblaje de la quimera y la disrupción del plásmido.
    1. Obtenga la secuencia de aminoácidos de los genes wildtype y ampR ejecutando el script translate.pl ( Figura 1 , paso 3).
      1. Escriba lo siguiente en un terminal:
        Perl translate.pl genes.fas
        Perl translate.pl ampR.fas

        NOTA: Este script creará los siguientes archivos de salida: genes_aa.fas y ampR_aa.fas.
    2. Alinear globalmente las dos secuencias de aminoácidos de tipo salvaje con un software apropiado ( por ejemplo, MUSCULO) 9 .
    3. Seleccione las regiones de rotura deseadas (3-6 aminoácidos) para chimera asseEn función de la alineación de la secuencia. Guárdelos en un archivo en formato FASTA ( por ejemplo , regions.fas).
    4. Localice las secuencias de ADN que codifican los tramos de aminoácidos seleccionados en ambos genes de tipo salvaje.
  4. Generación in silico de secuencias de ADN sinónimas que contienen sitios de enzimas de restricción.
    1. Obtener todas las secuencias de ADN sinónimas que codifican para cada segmento de secuencia de aminoácidos seleccionado como regiones de ruptura ( Figura 1 , etapa 4); Estas secuencias se almacenaron en el archivo regions.fas.
      1. Escriba lo siguiente en un terminal:
        Perl synonym.pl regions.fas
        NOTA: Este script creará el archivo de salida regions_syn.fas.
    2. Búsqueda de sitios de enzimas de restricción encontrados en secuencias de ADN sinónimo.
      1. Escriba lo siguiente en un terminal: perl REsynonym.pl regions_syn.fas
        NOTA: Este script creará el archivo de salida regions_syn-re.fas.
    3. Elija una enzima de restricción que se comparta entre las secuencias sinónimas de ambos genes de tipo salvaje; Este sitio será utilizado para ensamblar quimeras a través de la digestión con enzimas de restricción. Verificar que la enzima de restricción escogida no corta ni los genes de tipo salvaje ni las secuencias de vectores pUC18 / 19.
      1. Compare las enzimas de restricción encontradas en los archivos genes_re.fas, pUC_re.fas y regions_syn-re.fas.
    4. In silico sustituye los originales por sus secuencias de ADN sinónimo en los loci correspondientes en ambos genes de tipo salvaje. Añadir secuencias de ADN sinónimo en el archivo de secuencia de tipo salvaje (genes.fas).
    5. Obtenga la secuencia de aminoácidos de los genes contenidos en el archivo genes.fas ( perl translate.pl genes.fas ).
    6. Alinear las secuencias de aminoácidos traducidas a partir de secuencias de ADN de tipo salvaje y sinónimas. Compruebe que ambas secuencias son iguales.
    7. Repita todos los pasos de esta sección con el gen ampR presente en la pUC18 / 19 vector.
      NOTA: El objetivo es interrumpir el gen ampR (archivo ampR.fas) en dos partes complementarias. La enzima de restricción seleccionada para interrumpir el gen ampR debe ser diferente de la utilizada para el ensamblaje de la quimera.
  5. La clonación independiente de los dos genes de tipo salvaje en el vector pUC18 / 19 seleccionado (Figura 1, etapa 3).
    1. Purificar el ADN de plásmido pUC18 / 19 elegido usando un kit de purificación de ADN de plásmido.
      1. Por ejemplo, transformar E. coli DH5α con el plásmido pUC18 y cultivar los transformantes durante la noche a 37 ° C sobre LB sólido-0,3 mg / ml de ampicilina (Amp). Elija una colonia transformante, inocule una nueva placa Amp de LB-0,3 mg / mL, y cultive la noche a la mañana a 37 ° C.
      2. Tomar parte del cultivo anterior y cultivarlo en líquido LB-0.3 mg / mL Amp durante 6-8 h a 37 ° C. Extraer el ADN del plásmido usando un kit.
    2. PCR amplificar los genes de tipo salvaje del ADN genómico total utilizando el appropOligonucleótidos externos externos. Utilice una ADN polimerasa de alta fidelidad, si es posible. Seleccione la DNA polimerasa que maximiza el rendimiento. Realizar la PCR de acuerdo con las directrices del fabricante y la temperatura de fusión de los oligonucleótidos.
      1. Ejecutar ciclos de PCR, dependiendo de la ADN polimerasa, tamaño del amplicón, molde y oligonucleótidos usados. Por ejemplo, para amplificar el ADN de rpoD , preparar una reacción de 50 μl: 5 μl de tampón 10x, 2 μl de MgSO4 50 mM, 1 μl de mezcla dNTP 10 mM, 2 μl de cada oligonucleótido 10 μM (Tabla 2), 2 Μl de ADN molde (ADN total de E. coli DH5α), 35,8 μl de agua ultrapura y 0,2 μl de ADN polimerasa de alta fidelidad. Se realizan los siguientes ciclos de PCR: 1 min a 94ºC para la desnaturalización inicial seguido de 30 ciclos de amplificación (30 s a 94ºC para desnaturalizar, 30 s a 60ºC para recocer los oligonucleótidos y 2 min a 68ºC extender).
      2. Disolver 1,2 g deAgarosa en 100 ml de agua doblemente destilada calentándolos en el microondas. Ensamble una bandeja de gel y un peine y póngalos en el gel horizontal. Llenar la bandeja de gel con la solución de agarosa fundida y dejar que se solidifique. Quite el peine.
      3. Coloque el gel en la cámara de electroforesis. Rellene la cámara con 1x tampón Tris-acetato-EDTA. Cargar 50 μL de productos de PCR en los pocillos de gel. Se electroforan las muestras ( por ejemplo , a 110 V durante 1 h).
      4. Después de la electroforesis, colorear el gel en 100 ml de agua doblemente destilada que contiene 100 μl de solución de bromuro de etidio a 1 mg / ml durante 10 minutos con agitación lenta. Lavar el gel en agua doblemente destilada durante otros 10 min en agitación lenta; Utilice un agitador horizontal.
        Precaución: El bromuro de etidio es un compuesto tóxico; Use guantes protectores y una capa de laboratorio de algodón.
      5. Purificar el ADN del gen de tipo salvaje de las bandas correspondientes del gel usando un kit. Visualice las bandas colocando el gel manchado en una cámara UV (Longitud de onda recomendada: 300 nm). Mantenga la exposición del gel a un mínimo. Utilice un kit de purificación de ADN y siga las instrucciones del fabricante.
        Precaución: La radiación UV es peligrosa; Use un escudo protector, gafas y una capa de laboratorio de algodón.
    3. Digest purificaron genes de tipo salvaje y pUC18 / 19 plásmido de ADN con las enzimas de restricción de acuerdo a las instrucciones del fabricante. Use enzimas de digestión rápida cuando sea posible. Por ejemplo, digerir 6 μL de ADN de pUC18 (300 ng / μl) en 10 μl de agua ultrapura, 2 μl de tampón 10X, 1 μl de enzima de restricción Kpn I y 1 μl de enzima de restricción Xba I. Dejar la reacción a 37 ° C durante 30 min.
      1. Inactivar las enzimas de restricción de acuerdo con las directrices del fabricante. Por ejemplo, inactivar la reacción de doble digestión Kpn I - Xba I a 80 ° C durante 5 min.
    4. Mezcla de inserto: vector de ADN a una velocidad volumétricaO de 3: 1. Siga las instrucciones del fabricante para una reacción de ligadura. Utilice enzimas de ligación rápida cuando sea posible (deje la reacción a 25 ° C durante 10 min).
      NOTA: Típicamente, la concentración de ADN después de la purificación utilizando los kits es lo suficientemente buena para las reacciones de digestión y ligadura. Por ejemplo, añadir 6 μl de ADN rpoD ( Kpn I- Xba I, 150 ng / μl), 3 μl de ADN pUC18 ( Kpn I- Xba I, 150 ng / μl), 10 μl de tampón 2x, 1 μl de ultrapuro Agua, y 1 μl de T4 ADN ligasa. Dejar la reacción de ligadura a 25 ° C durante 10 min.
    5. Transformar el E. coli DH5α con 2-4 μl de la reacción de ligación, como se describe en los Materiales Complementarios. Placa de las células transformadas en sólido LB / Amp / X-gal / IPTG placas. Dejar las placas durante una noche a 37ºC.
    6. Seleccione las colonias de E. coli transformantes de color blanco y pétalas en una nueva placa LB / Amp. Dejar las placas durante la noche a 37 ° C. <Li
    7. Realizar una PCR de colonias para elegir candidatos para secuenciar la reacción, como se describe en los Materiales Complementarios. Extraer el ADN del plásmido de los candidatos. Alternativamente, digerir el ADN del plásmido candidato con las mismas enzimas de restricción usadas para clonar los insertos.
    8. Secuencia de construcciones candidatas con un proveedor de servicios de secuenciación 10 . Ensamble la secuencia en silico usando un ensamblador de ADN 11 ( Figura 1 , paso 5).
  6. Interrupción del plásmido por PCR seguida por digestión con enzimas de restricción.
    1. Diseñar en silico oligonucleótidos directos e inversos en regiones de rotura para genes de tipo salvaje y ampR , respectivamente. Sustituir in silico el fragmento de tipo salvaje para su correspondiente secuencia de ADN sinónimo (obtenida en el paso 1.4).
      NOTA: Esta secuencia de ADN sinónimo contiene un sitio de enzima de restricción. Los oligonucleótidos hacia adelante y hacia atrás se solapan en tSitio de la enzima de restricción. Los oligonucleótidos deben oscilar entre 21-27 nucleótidos, terminar con una citosina o guanina, y contener un sitio de enzima de restricción. Un oligonucleótido directo tiene la misma secuencia que su región diana sobre el ADN molde. Un oligonucleótido inverso es la secuencia complementaria inversa de la región diana sobre el ADN molde.
    2. Utilizar las dos construcciones de genes de tipo salvaje como la plantilla de ADN para reacciones de PCR ( por ejemplo, pUC18 rpoD y pUC18 sigA ). Obtener dos partes complementarias de cada construcción (pUC18 rpoD σ1-σ2, pUC18 rpoD σ3-σ4, pUC18 sigA σ1-σ2, y pUC18 sigA σ3-σ4) ( Figura 1 , etapa 6).
    3. Cargar muestras de ADN en un gel de agarosa 1-1,2% [p / v]. Separar los productos de PCR de la plantilla de ADN mediante electroforesis ( por ejemplo, 110 V durante 1 h). Alternativamente, digerir las reacciones de PCR con Dpn I para romper la plantilla de ADN.
      NOTA: DpnI sólo reconoce secuencias de ADN metiladas (5'-GATC-3 ').
      1. Purificar las muestras utilizando un kit de purificación de ADN. Siga las instrucciones del fabricante.
    4. Doble digerir todos los fragmentos de ADN complementarios con las enzimas de restricción apropiadas de acuerdo con las instrucciones del fabricante. Use enzimas de restricción de digestión rápida cuando sea posible. Por ejemplo, digerir doblemente el fragmento de ADN pUC18rpoDσ1-σ2 con Afl II y Spe I usando el protocolo del fabricante. Dejar la reacción de digestión a 37 ° C durante 15 min.
    5. Inactivar las enzimas de restricción de acuerdo con las directrices del fabricante. Por ejemplo, inactivar Afl II- Spe I a 80 ° C durante 20 min.
  7. Recuperación de plásmido utilizando ligación de ADN y transformación bacteriana.
    1. Mezclar los fragmentos de ADN adecuados en una proporción volumétrica de 1: 1 para ensamblar el gen quimérico deseado ( Figura1, etapa 7).
      NOTA: De este modo, se restaura la integridad del gen ampR , produciendo una proteína funcional.
      1. Por ejemplo, mezclar 4 μL de ADN pUC18 rpoD σ1-σ2 (digerido con Afl II- Spe I, 150 ng / μl), 4 μl de ADN pUC18 sigA σ3-σ4 ( Afl II- Spe I, 150 ng / μl) 10 μl de 2x tampón, 2 μL de agua ultrapura y 1 μl de T4 DNA ligasa; La concentración de ADN después de la purificación del kit es suficiente para la digestión y posterior ligadura. Dejar la reacción de ligadura a 25 ° C durante 10 min.
    2. Transformar E. coli DH5α con 3-5 μL de la reacción de ligación del conjunto quimérico (Materiales Complementarios). Cultivar las células transformantes en LB / Amp / X-gal / IPTG placas durante la noche a 37 ° C durante la noche.
    3. Seleccione las colonias de E. coli transformantes de color blanco y pétalas en una nueva placa LB / Amp. Dejar las placas durante la noche a 37ºC.DO.
    4. Realice una PCR de colonia para elegir candidatos para una reacción de secuenciación, como se describe en los Materiales Complementarios. Visualizar las bandas en un gel de agarosa al 1-1,2% (p / v) realizando electroforesis (descrita en el paso 2.3.2.1).
    5. Cultivar culturas de candidatos positivos. Extraer ADN de plásmido de ellos utilizando un kit de purificación de ADN plasmídico.

2. Construcciones Quiméricas de Candidatos de Secuencia

  1. Asegúrese de que la calidad del ADN plasmídico es lo suficientemente buena para la reacción de secuenciación siguiendo las directrices de la secuencia del proveedor de servicios. Extraer el ADN utilizando kits de purificación. Por ejemplo, en la página de Internet de la secuencia del proveedor de servicios, preste especial atención a la concentración de ADN recomendada para las muestras. Obtener la concentración de muestras utilizando un instrumento de cuantificación de ADN.
  2. Secuencia de construcciones quiméricas candidatas con un proveedor de servicios de secuenciación 10 .
  3. Ensamblar Quencing lee con un ensamblador de ADN in silico 11 .
  4. Alinear secuencias quiméricas diseñadas ensambladas en silico usando herramientas de alineación de secuencias 9 , 12 . Verificar que el gen quimérico se fusionó satisfactoriamente.

3. Hacer Preparaciones

NOTA: Todos los pasos que involucran células vivas deben realizarse en una campana de flujo laminar limpio con el quemador Bunsen encendido.

  1. Producción de células competentes de E. coli DH5α.
    1. Para producir células compatibles con E. coli , siga los protocolos publicados 13 o vea los Materiales Complementarios . Alternativamente, utilice células competentes comercialmente disponibles.
  2. Transformación de células competentes de DH5α de E. coli .
    1. Para la transformación química de cultivos de E. coli , siga los protocolos publicadosClass = "xref"> 13 o vea los Materiales Complementarios . Alternativamente, use la electroporación para la transformación bacteriana. Si se utilizan células competentes comercialmente disponibles, siga las directrices del fabricante.
  3. Purificación de ADN genómico y plásmido de E. coli DH5α.
    1. Realizar la extracción de ácido nucleico, como se indica en los Materiales Complementarios , utilizando kits comercialmente disponibles o siguiendo protocolos publicados 13 .
  4. Realizar PCR de colonias.
    1. Utilice esta técnica para identificar las colonias transformantes candidatas para la posterior reacción de secuenciación.
      NOTA: Este método no representa una verificación final de la integridad de las secuencias. Una descripción detallada de esta técnica está disponible en los Materiales Complementarios .
  5. Preparación de las soluciones.
    1. Ver
  6. Descargue los scripts y archivos de secuencia necesarios para el protocolo CAPRRESI.
    1. Descargue archivos de banco de genes que contengan la secuencia completa del genoma de la especie deseada, extraiga la secuencia de ADN del gen elegido usando un navegador genómico y guárdelo en formato de archivo fasta. Descargue los scripts Perl necesarios para el protocolo CAPRRESI. Guarde los scripts y los archivos de secuencia en el mismo directorio.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

La figura 1 representa CAPRRESI. Usando este método, se montaron dos genes quiméricos intercambiando los dominios de dos factores sigma bacterianos primarios ( es decir, E. coli RpoD y R. etli SigA). Las secuencias de ADN de los genes rpoD y sigA se obtuvieron utilizando el Artemis Genome Browser 14 de GenBank genoma ficheros NC_000913 y NC_007761, respectivamente. La secuencia de ADN del vector pUC18 se obtuvo de la base de datos de nucleótidos del servidor NCBI. In silico análisis de los sitios de enzimas de restricción se realizaron en secuencias de ADN mediante la ejecución de REsearch.pl Perl script (véase el paso 1.2.2). Estos resultados se usaron para el diseño de oligonucleótidos (etapa 1.2.3). Los oligonucleótidos externos incluían sitios de reconocimiento para las enzimas de restricción Xba I y Kpn I para clonar genes de tipo salvaje en el sitio de clonación múltiple pUC18. El oligonucleótido hacia delante también incluía un riboAlgún sitio de unión ( Tabla 2 ). El ADN genómico se extrajo de células E. coli DH5α cultivadas en caldo LB / Nal (37ºC, 220-250 rpm) y células R. etli CFN42 cultivadas en caldo PY / Nal / CaCl2 (30ºC, 220-250 rpm ). Estas muestras se utilizaron como plantillas de ADN para la amplificación del gen de tipo salvaje (etapa 1.5.2).

Los genes de tipo salvaje se amplificaron usando una ADN polimerasa Taq de alta fidelidad, que se purificó a partir de geles de agarosa (kit de purificación de ADN), se digirió dos veces con enzimas de restricción Kpn I - Xba I y se clonó en el vector pUC18. Las células DH5α de E. coli químicamente competentes se transformaron con 5 μl de la reacción de ligación correspondiente a las construcciones de tipo salvaje pUC18 rpoD y pUC18 sigA (etapa 1.5.5). Las células transformantes se seleccionaron en placas LB / Amp / X-gal / IPTG sólidas crecidas a 37ºC. Las construcciones de tipo salvaje fueron verificadas por Sanger sequenc10 . Las lecturas de secuencias de Sanger estaban en silico ensambladas usando MIRA 11 (paso 1.5.8).

Las secuencias de aminoácidos de genes de tipo salvaje se obtuvieron mediante la ejecución del script translate.pl (paso 1.3.1). Después de alinear los genes de tipo salvaje con Clustal 12 , las regiones de aminoácidos TLV y NLR se seleccionaron sobre el gen de resistencia a la ampicilina ( ampR ) y los factores sigma primarios de tipo salvaje, respectivamente (paso 1.3.3). Estas regiones de aminoácidos se utilizaron para calcular todas las posibles secuencias de sinónimo de ADN que las codifican ejecutando el script synonym.pl (paso 1.4.1). El script REsynonym.pl buscó sitios de enzimas de restricción encontrados en las secuencias de ADN sinónimas generadas anteriormente (paso 1.4.4). Se seleccionaron aquellas regiones sinónimas que introdujeron el número más bajo de cambios en comparación con las secuencias de tipo salvaje. Para los genes de factor sigma primaria, las secuencias de tipo salvaje de RpOD (AACTTACGT) y SigA (AACCTTCGC) por AA CTTAAG G. Este último incluyó un sitio Afl II (en negrita). Para el gen ampR , se intercambió la secuencia de tipo salvaje ACGCTGGTG por su sinónimo, AC ACTAGT G. La secuencia de ADN sinónimo insertada en el gen ampR contenía un sitio Spe I (en negrita). La sustitución in silico del tipo salvaje para las secuencias sinónimas correspondientes se realizó para verificar la integridad de la secuencia y el diseño del oligonucleótido (pasos 1.2-1.4).

Los cambios en la secuencia del sinónimo se introdujeron por PCR usando los oligonucleótidos apropiados ( Tabla 2 ) y construcciones de tipo salvaje como plantillas de ADN (paso 1.5.2). Las reacciones de amplificación produjeron cuatro partes complementarias: pUC18 rpoD σ1-σ2, pUC18 rpoD σ3-σ4, pUC18 sigA σ1-σ2 y pUC18 sigA σ3-σ4. Las partes complementariasNo sólo los factores sigma, sino también los genes ampR . Las partes complementarias se purificaron usando un kit de purificación de ADN (etapa 1.6.3).

Estos fragmentos de ADN complementarios fueron digeridos dos veces con enzimas de restricción Afl II y Spe I (etapa 1.6.4). De acuerdo con el diseño de CAPRRESI, los fragmentos de ADN pUC18 rpoD σ1-σ2 se ligaron con pUC18 sigA σ3-σ4 para obtener la quimera 01 y pUC18 sigA σ1-σ2 se ligó con pUC18 rpoD σ3-σ4 para ensamblar la quimera 02 (pasos 1.7.1-1.7 .3). Las células DH5α de E. coli químicamente competentes se transformaron con 5 μl de la reacción de ligación de pUC18 chim01 y pUC18 chim02 (etapa 1.7.4). Las células transformantes se seleccionaron en placas LB / Amp / X-gal / IPTG sólidas crecidas a 37ºC (etapa 1.7.5). Las construcciones quiméricas se verificaron por secuenciación 10 de Sanger (etapa 2). Secuencia de Sanger rEads se reunieron utilizando MIRA 11 , y sus archivos resultantes se enumeran en la Tabla 3 . La Figura 2 muestra las alineaciones (realizadas usando MUSCLE) 9 de secuencias ensambladas de genes de tipo salvaje y quiméricos en las regiones de ruptura.

Figura 1
Figura 1: Visión general de CAPRRESI. Representaciones: genes (flechas gruesas), plásmidos funcionales (círculos cerrados) y oligonucleótidos (flechas finas de punta negra). Los sitios de enzimas de restricción insertados en los oligonucleótidos aparecen en colores. Abreviaturas: Wt (tipo salvaje), FWD (oligonucleótido directo), REV (oligonucleótido inverso), ampR (gen de resistencia a ampicilina), RES (sitio de enzima de restricción), RE (enzima de restricción). Por favor, haga clic aquí para ver un versi más grandeDe esta cifra.

Figura 2
Figura 2: Alineación de secuencias de genes salvajes y secuencias de genes quiméricos. Las secuencias de ADN montadas se alinearon usando MUSCULO 9 . Las secuencias se ensamblaron con MIRA 11 . Las secuencias sinónimas aparecen en negro. El sitio de reconocimiento Afl II aparece subrayado. Código de nucleótidos IUPAC: R (A o G) y K (G o T). Construcciones: rpoD (rojo), sigA (azul), quimera 01 secuencia ( rpoD σ1-σ2- sigA σ3-σ4), y quimera 02 secuencia ( sigA σ1-σ2- rpoD σ3-σ4). Haga clic aquí para ver una versión más grande de esta figura.

Solución Componentes Instrucciones
Cantidad Compuesto
Caldo Luria-Bertani (LB) 5 g extracto de levadura Disolver todos los componentes en agua. Autoclave. Guarde a temperatura ambiente hasta su uso. Para el caldo LB sólido, añadir 15 g de agar bacteriológico a la receta.
10 g Caseína peptona
10 g NaCl
Hasta 1 l Agua destilada doble
Placas LB / Amp / X-gal / IPTG 100 ml Caldo LB sólido fundido Agregue todos los componentes al caldo LB templado. Llene las placas de Petri y espere hasta que se solidifiquen. Realice los pasos en una campana de flujo laminar limpio con el quemador Bunsen encendido.
100 μl Ampicilina (Amp) [100 mg / ml]
100 μl X - gal [20 mg / ml]
50 μl Solución 1 M IPTG
Caldo de levadura de peptona (PY) 3 g extracto de levadura Disolver todos los componentes en agua. Autoclave. Guarde a temperatura ambiente hasta su uso. Para el caldo de PY sólido, añadir 15 g de agar bacteriológico a la receta. Para el cultivo de R. etli, añadir 700 μL de solución de CaCl 2 1 M antes de su uso.
5 g Caseína peptona
Hasta 1 l Agua destilada doble
Placas de PY / CaCl2 / Nal 100 ml Caldo sólido PY fundido Agregue todos los componentes al caldo PY templado. Llene las placas de Petri y espere a que se solidifiquen. Realice los pasos en una campana de flujo laminar limpio con el quemador Bunsen encendido.
700 μl Solución de CaCl _ { 2} 1 M
100 μl Ácido nalidíxico (Nal) [20 mg / ml]
Solución de cloruro cálcico (CaCl $ $) 1 M 11,1 g CaCl $ $ Disolver CaCl2 en agua. Autoclave. Almacenar a temperatura ambiente.
Hasta 100 ml Agua destilada doble
Tris - EDTA (TE) 10: 1 pH 8,0 1 ml Solución de Tris 1 M Mezclar todos los componentes. Autoclave. Almacenar a temperatura ambiente.
400 μl Solución de EDTA 0,25 M
Hasta 100 ml Agua destilada doble
TE 50:20 pH 8,0 5 ml Solución de Tris 1 M Mezclar todos los componentes. Autoclave. Guarde a temperatura ambiente. </ Td>
8 ml Solución de EDTA 0,25 M
Hasta 100 ml Agua destilada doble
TE 10: 1 solución de NaCl 10 mM 58,4 mg NaCl Disolver NaCl en TE 10: 1. Autoclave. Almacenar a temperatura ambiente.
Hasta 100 ml TE 10: 1 solución de pH 8,0
Solución de lisis I 80 mg Lisozima Disolver y mezclar todos los componentes en agua. Filtrar esterilizar utilizando un filtro de 0,22 μm. Almacenar a temperatura ambiente.
2 ml Solución de glucosa 0,5 M
400 μl Solución de EDTA 0,5 M
500 μl Solución de Tris 1 M
Hasta 20 ml Agua destilada doble esterilizada
Solución de lisis II 1,2 ml Solución de hidróxido sódico 5 M (NaOH) Disolver todos los componentes en agua. Filtrar esterilizar utilizando un filtro de 0,22 μm. Almacenar a temperatura ambiente.
3 ml Solución de dodecilsulfato de sodio al 10% (SDS)
Hasta 30 ml Agua destilada doble esterilizada
Solución de lisis III 29,4 g Acetato de potasio (CH $$ COOK) Disolver y mezclar todos los componentes en agua. Filtrar esterilizar utilizando un filtro de 0,22 μm. Almacenar a temperatura ambiente.
11,5 ml Ácido acético absoluto (CH $$ COOH)
Hasta 100 ml Agua destilada doble esterilizada
Solución de cloruro de magnesio 1 M (MgCl $ $) 9,5 g MgCl $ $ Disolver MgCl2 en wAter Autoclave. Almacenar a temperatura ambiente.
Hasta 100 ml Agua destilada doble
Solución de acetato sódico 3 M (CH $$ COONa) 24,6 g CH 3 COONa Disolver CH 3 COONa en agua. Autoclave. Almacenar a temperatura ambiente
Hasta 100 ml Agua destilada doble
Solución de SDS al 10% 10 g SDS Disolver SDS en agua con una barra de agitación magnética a baja velocidad. Autoclave. Almacenar a temperatura ambiente.
Hasta 100 ml Agua destilada doble
Solución 3 M CH 3 COOK 29,4 g CH 3 COOK Disolver CH 3 COOK en agua. Filtrar esterilizar utilizando un filtro de 0,22 μm. Almacenar a temperatura ambiente.
Hasta 100 ml Agua destilada doble esterilizada
Solución de proteinasa K 5 mg Proteinasa K Disolver la proteinasa K en una solución TE 50:20. Calentar a 37 ºC durante 1 h. Almacenar a -20 ºC.
Hasta 1 mL TE 50:20 solución de pH 8,0
Solución de RNasa 10 mg RNasa Disolver la RNasa en agua. Calentar a 95 ºC durante 10 min. Almacenar a -20 ºC.
Hasta 1 mL Agua ultrapura esterilizada
Solución de 1 M de isopropil - beta - D - tiogalactósido (IPTG) 238,3 mg IPTG Disolver IPTG en agua. Filtrar esterilizar utilizando un filtro de 0,22 μm. Almacenar a -20 ºC.
Hasta 1 mL Agua ultrapura esterilizada
20 mg Galón Disolver X-gal en agua. Filtrar esterilizar utilizando un filtro de 0,22 μm. Almacenar a -20 ºC.
Hasta 1 mL Agua ultrapura esterilizada
Fenol: cloroformo: alcohol isoamílico solución 24: 24: 1 24 ml fenol Mezclar todos los componentes. Almacenar en una botella de color ámbar a 4 ºC. ¡PRECAUCIÓN! Material Peligroso. Use gafas protectoras, guantes y ropa de laboratorio de algodón. Utilice una campana extractora. No encienda el quemador Bunsen ni ninguna otra fuente de fuego durante el manejo. Alternativa: utilizar una solución de fenol comercial: cloroformo: alcohol isoamílico 25: 24: 1
24 ml cloroformo
1 ml Alcohol isoamílico
Solución de glucosa 0,5 M 9 g gramoLucas Disolver la glucosa en agua. Filtrar esterilizar utilizando un filtro de 0,22 μm. Almacenar a temperatura ambiente.
Hasta 100 ml Agua ultrapura esterilizada
Solución de ácido etilendiaminotetraacético 0,5 M (EDTA) solución de pH 8,0 14,6 g EDTA Disolver el EDTA en agua. Ajustar el pH con solución de NaOH 5 M. Autoclave. Almacenar a temperatura ambiente.
Hasta 100 ml Agua destilada doble
0,25 M EDTA pH 8,0 solución 7,3 g EDTA Disolver el EDTA en agua. Ajustar el pH con solución de NaOH 5 M. Autoclave. Almacenar a temperatura ambiente.
Hasta 100 ml Agua destilada doble
Solución de Tris 1 M pH 8,0 12,1 g Tris Disolver Tris en agua. Ajuste el pH conÁcido clorhídrico absoluto (HCl). Autoclave. Almacenar a temperatura ambiente.
Hasta 100 ml Agua destilada doble
Solución de hidróxido sódico 5 M (NaOH) 19,9 g NaOH Disolver NaOH en agua. Almacenar a temperatura ambiente. ¡PRECAUCIÓN! Compuestos cáusticos.
Hasta 100 ml Agua destilada doble esterilizada
Solución de NaOH 0,1 M 399 mg NaOH Disolver NaOH en agua. Almacenar a temperatura ambiente.
Hasta 100 ml Agua destilada doble esterilizada
Solución madre de ácido nalidíxico (Nal) 60 mg ácido nalidíxico Disolver Nal en agua. Filtrar esterilizar utilizando un filtro de 0,22 μm. Almacenar a 4 ºC.
Hasta 3 ml 0,1 MNSolución de aOH
Ampicilina (Amp) solución madre 300 mg Ampicilina Disolver el amp en el agua. Filtrar esterilizar utilizando un filtro de 0,22 μm. Almacenar a 4 ºC.
Hasta 3 ml Agua destilada doble esterilizada
10x tampón tris - acetato - EDTA 48,4 g Tris Disolver todos los componentes en agua. Autoclave. Almacenar a temperatura ambiente.
20 ml Solución de EDTA 0,5 M
11,44 ml ácido acético glacial
Hasta 1 l Agua destilada doble

Tabla 1: Preparación de la solución. Instrucciones para la preparación de la solución.

No. Código Secuencia Longitud (nt) Caracteristicas
1 RpoD-FWD GC TCTAGA GA AGGAGA TATCATATGGAGCAAAACCCGCAGTCA 43 XbaI ; Amplificación génica de tipo salvaje y clonación de vectores
2 RoD-REV GG GGTACC TTAATCGTCCAGGAAGCTACG 29 Sitio KpnI ; Amplificación génica de tipo salvaje y clonación de vectores
3 SigA-FWD GC TCTAGA GA AGGAGA TATCATATGGCAACCAAGGTCAAAGAG 43 XbaI ; Amplificación génica de tipo salvaje y clonación de vectores
4 SigA-REV GG GGTACC TTAGCTGTCCAGAAAGCTTCT </ Td> 29 Sitio KpnI ; Amplificación génica de tipo salvaje y clonación de vectores
3 AmpR-FWD AC ACTAGT GAAAGTAAAAGAT 21 SpeI sitio insertado, sinónimo de mutación. Interrupción del gen ampR
4 AmpR-REV TC ACTAGT GTTTCTGGGTGAG 21 SpeI sitio insertado, sinónimo de mutación. Interrupción del gen ampR
5 Σ2RpoD-FWD AA CTTAAG GCTGGTTATTTCTATCGCT 27 AflII sitio insertado, mutación sinónima. Construcción de chim01-02
6 Σ2RpoD-REV GC CTTAAG TTCGCTTCAACCATCTCTT 27 AflII sitio insertado, mutación sinónima. Construcción de chim01-02
7 Σ2SigA-FWD AA CTTAAG GCTCGTCATTTCAATCGCC 27 AflII sitio insertado, mutación sinónima. Construcción de chim01-02
8 Σ2SigA-REV GC CTTAAG TTCGCTTCGACCATTTCCT 27 AflII sitio insertado, mutación sinónima. Construcción de chim01-02

Tabla 2: Secuencias de oligonucleótidos. Los sitios de enzimas de restricción aparecen subrayados. Sitio de unión al ribosoma: negrita.

Construcción Archivo de secuencia Archivo de calidad
Chimera01 Chim01_out.unpadded.fasta Chim01_out.unpadded.fasta.qual
Chim01_A3 / B3 / E2 / F2 / G2 /H2.pdf
Chimera02 Chim02_out.unpadded.fasta Chim02_out.unpadded.fasta.qual
Chim02_C3 / D3 / E3 / F3 / G3 / H3.pdf
Rpd Rpod_out.unpadded.fasta Rpod_out.unpadded.fasta.qual
Significado Siga_out.unpadded.fasta Siga_out.unpadded.fasta.qual

Tabla 3: Archivos secuenciales obtenidos con el ensamblador de MIRA y secuenciador de ADN. Las lecturas de secuenciación de Sanger de construcciones quiméricas y de tipo salvaje se ensamblaron con el software MIRA 11 usando la opción de mapeo. Los cromatogramas de secuenciación de la quimera aparecen como archivos PDF.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

CAPRRESI fue diseñado como una alternativa al PRM 2 . El PRM original es una técnica poderosa; Permite la fusión de secuencias de ADN a lo largo de cualquier parte de los genes seleccionados. Para PRM, los genes de tipo salvaje deben ser clonados en el mismo plásmido. Después de eso, los oligonucleótidos están diseñados dentro de genes de resistencia a antibióticos y de tipo salvaje encontrados en el plásmido. La ruptura del plásmido se consigue por PCR usando polimerasas de ADN de alta fidelidad de extremos romos y oligonucleótidos diseñados previamente. La ligación de productos de PCR complementarios ensambla genes quiméricos y restaura el casete de resistencia a antibióticos, dando como resultado la recuperación funcional de plásmido. PRM permite la construcción de bibliotecas de genes quiméricos en el mismo fondo de plásmido. Desafortunadamente, la ligadura de secuencias de ADN de extremos romos podría ser técnicamente ardua. El ensamblaje de quimera mediante fragmentos de PCR 1 solapados también requiere que las polimerasas de ADN produzcan productos de extremos romos yPurificación del ADN para cada reacción. Los genes quiméricos reunidos mediante esta técnica son productos de ADN lineales. La clonación de cada construcción en el vector diana podría retrasar el análisis posterior.

CAPRRESI se beneficia de muchas de las fuerzas de PRM y también simplifica la ligación de fragmentos de ADN complementarios usando sitios de enzimas de restricción en regiones de secuencia de ADN sinónimas. Por estas razones, CAPRRESI no requiere de polimerasas de ADN de extremos romos. El uso de secuencias de ADN sinónimo restringe los sitios de fusión para el ensamblaje de la quimera, pero mejora la eficacia de la ligadura. Otra importante modificación introducida en CAPRRESI es que las quimeras se ensamblan y se manipulan en vectores pUC18 / 19. Estos vectores poseen varias características ventajosas, como se ha indicado anteriormente. El ADN quimérico podría obtenerse propagando el vector de construcción en huéspedes de E. coli . La clonación subsiguiente de genes quiméricos en el plásmido final ( por ejemplo , un vector de expresión) es a vecesnecesario.

CAPRRESI también se basa en el manejo in silico de secuencias de ADN y aminoácidos. Los scripts Perl ad hoc permiten la selección de las enzimas de restricción apropiadas para clonar genes de tipo salvaje, el cálculo de todas las secuencias de ADN sinónimas correspondientes a regiones de rotura (para el ensamblaje de quimeras) y la identificación de enzimas de restricción para simplificar la recuperación de plásmidos. Dadas estas condiciones, CAPRRESI es una alternativa para fusionar genes codificadores de proteínas. Los pasos críticos del protocolo CAPRRESI son: 1) la selección de regiones de ruptura y 2) la purificación de productos de PCR. Las regiones de ruptura son tramos en los que se calculan secuencias sinónimas, produciendo sitios de enzimas de restricción que no se encuentran en secuencias de tipo salvaje. El uso de sitios de enzima de restricción para el montaje de quimeras elimina la necesidad de polimerasas de ADN que producen productos de extremos romos y facilita la reacción de ligación. No todas las regiones tendrán sitios de enzimas de restricción utilizables; FoPor esta razón, se recomienda mover las regiones de ruptura por un aminoácido a la vez hasta que se encuentre el mejor estiramiento de secuencia. Si el diseño in silico no permite el movimiento de las regiones de ruptura o los tramos de secuencia carecen de secuencias de ADN sinónimas con sitios de enzimas de restricción adecuados, se recomienda fusionar genes diana usando oligonucleótidos superpuestos y introducir secuencias de ADN sinónimas en el gen de resistencia a ampicilina (Encontrado en el vector) solamente. De esta manera, los genes se pueden fusionar en cualquier parte y la recuperación del plásmido se basa en la ligación de un sitio único (digerido con sólo una enzima de restricción). La flexibilidad de CAPPRESI permite que se realice en combinación con otras técnicas.

La purificación de productos de PCR se realiza para eliminar el ADN molde, disminuyendo las posibilidades de contaminación del plásmido parental después de la ligadura de fragmentos de ADN complementarios. El cumplimiento de estos dos pasos críticos mejora(El número de construcciones ensambladas correctamente), permitiendo que CAPRRESI se realice con células de E. coli químicamente competentes (CaCl2) o electrocompetentes. El primer tipo de células competentes representa la fuente más barata de cultivos de E. coli , empleados para la transformación bacteriana en la mayoría de los laboratorios. Debido a todas las características mostradas anteriormente, CAPRRESI representa una opción útil para ensamblar quimeras.

Además, CAPRRESI podría trabajar en combinación con fragmentos de PCR solapantes o técnicas de recuperación de plásmidos. Por ejemplo, en lugar de insertar dos secuencias de sinónimo por porción de ADN complementaria, la región de rotura deseada (sobre los genes de tipo salvaje objetivo) podría usar oligonucleótidos solapantes para fusionar secuencias intermedias. La introducción de secuencias sinónimas podría limitarse al gen ampR de los vectores pUC18 / 19, lo que conduce al uso de una única enzima de restricción para restaurar los plasmiD integridad. Estas futuras aplicaciones podrían fortalecer CAPRRESI al permitir la fusión de cualquier tipo de secuencias de ADN ( es decir, no sólo genes codificadores de proteínas), sin comprometer la eficacia de la ligadura.

Con el fin de probar CAPRRESI, dos factores quiméricos sigma se reunieron mediante el intercambio de regiones de dos tipos de wildtype sigma factor genes: rpoD ( E. coli ) y sigA ( R. etli ). Todos los factores sigma primarios conocidos tienen cuatro dominios, σ1 a σ4 8 . La quimera 01 consiste en RpoDσ1-σ2 y SigAσ3-σ4, mientras que la quimera 02 tiene SigAσ1-σ2 y RpoDσ3-σ4. La integridad de las construcciones quiméricas se verificó mediante la secuenciación 10 de Sanger ( Figura 2 ).

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores declaran que no tienen intereses financieros en competencia.

Acknowledgments

Este trabajo fue apoyado por el Consejo Nacional de Ciencia y Tecnología, CONACYT, México (otorgamiento número 154833) y la Universidad Nacional Autónoma de México. Los autores desean agradecer a Víctor González, Rosa I. Santamaría, Patricia Bustos y Soledad Juárez por su asesoramiento administrativo y técnico.

Materials

Name Company Catalog Number Comments
Platinum Taq DNA polymerase High Fidelity Thermo Fisher 11304011 Produces a mix of blunt/3’-A overhang ended PCR products
High pure plasmid isolation kit Roche 11754785001 Used for all plasmid purification reactions
High pure PCR product purification kit Roche 11732676001 Used for all PCR purification reactions from agarose gels
AflII restriction enzyme New England Biolabs R0520L Recognizes sequence 5’-CTTAAG-3’ and cuts at 37 °C
KpnI-HF restriction enzyme New England Biolabs R3142L Recognizes sequence 5’-GGTACC-3’ and cuts at 37 °C
SpeI-HF restriction enzyme New England Biolabs R3133L Recognizes sequence 5’-ACTAGT-3’ and cuts at 37 °C
XbaI restriction enzyme New England Biolabs R0145L Recognizes sequence 5’-TCTAGA-3’ and cuts at 37 °C
Ampicillin sodium salt Sigma Aldrich A0166-5G Antibiotics
Nalidixic acid Sigma Aldrich N8878-5G Antibiotics
Yeast Extract Sigma Aldrich Y1625-1KG Bacterial cell culture
Casein peptone Sigma Aldrich 70171-500G Bacterial cell culture
NaCl Sigma Aldrich S9888-1KG Sodium chloride
Agar Sigma Aldrich 05040-1KG Bacterial cell culture
XbaI restriction enzyme Thermo Fisher FD0684 Fast digest XbaI enzyme
KpnI restriction enzyme Thermo Fisher FD0524 Fast digest KpnI enzyme
Quick Ligation Kit New England Biolabs M2200S Fast DNA ligation kit
AflII restriction enzyme Thermo Fisher FD0834 Fast digest AflII enzyme
SpeI restriction enzyme Thermo Fisher FD1253 Fast digest SpeI enzyme

DOWNLOAD MATERIALS LIST

References

  1. Horton, R. M., Hunt, H. D., Ho, S. N., Pullen, J. K., Pease, L. R. Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene. 77, (1), 61-68 (1989).
  2. Vos, M. J., Kampinga, H. H. A PCR amplification strategy for unrestricted generation of chimeric genes. Anal. Biochem. 380, (2), 338-340 (2008).
  3. Hawkins, N. C., Garriga, G., Beh, C. T. Creating Precise GFP Fusions in Plasmids Using Yeast Homologous Recombination. Biotechniques. 34, (1), 1-5 (2003).
  4. Sander, J. D., Joung, J. K. CRISPR-Cas systems for editing, regulating and targeting genomes. Nat Biotechnol. 32, (4), 347-355 (2014).
  5. Nagy, A. Cre recombinase: The universal reagent for genome tailoring. Genesis. 26, (2), 99-109 (2000).
  6. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods. 6, (5), 343-345 (2009).
  7. Norrander, J., Kempe, T., Messing, J. Construction of improved M13 vectors using oligodeoxynucleotide-directed mutagenesis. Gene. 26, (1), 101-106 (1983).
  8. Gruber, T. M., Gross, C. A. Multiple sigma subunits and the partitioning of bacterial transcription space. Annu Rev Microbiol. 57, 441-466 (2003).
  9. Edgar, R. C. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 32, (5), 1792-1797 (2004).
  10. Macrogen Inc. Seoul, Rep. Of Korea. Available from: http://dna.macrogen.com/eng/index.jsp (2016).
  11. Chevreux, B. MIRA: an automated genome and EST assembler. Available from: http://www.chevreux.org/thesis/index.html 1-161 (2005).
  12. Thompson, J. D., Gibson, T. J., Higgins, D. G. Multiple sequence alignment using ClustalW and ClustalX. Curr Protoc Bioinformatics. Chapter 2 (Unit 2.3) 1-22 (2002).
  13. Sambrook, J., Russell, D. W. Molecular Cloning: A laboratory manual. CSHLP. (2001).
  14. Rutherford, K., et al. Artemis: sequence visualization and annotation. Bioinformatics. 16, (10), 944-945 (2000).
CAPRRESI: Ensamblaje de quimeras por inserción de sitios de enzimas de recuperación y restricción de plásmidos
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Santillán, O., Ramírez-Romero, M. A., Dávila, G. CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion. J. Vis. Exp. (124), e55526, doi:10.3791/55526 (2017).More

Santillán, O., Ramírez-Romero, M. A., Dávila, G. CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion. J. Vis. Exp. (124), e55526, doi:10.3791/55526 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter