Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

CAPRRESI: Assemblage de la chimère par insertion de plasmides et restriction Enzyme Site Insertion

doi: 10.3791/55526 Published: June 25, 2017

Summary

Ici, nous présentons l'assemblage de la chimère par récupération du plasmide et l'insertion du site enzymatique de restriction (CAPRRESI), un protocole basé sur l'insertion des sites d'enzymes de restriction dans des séquences d'ADN synonymes et une récupération fonctionnelle du plasmide. Ce protocole est une méthode rapide et peu coûteuse pour fusionner des gènes codant pour des protéines.

Abstract

Ici, nous présentons l'assemblage de la chimère par récupération du plasmide et l'insertion du site enzymatique de restriction (CAPRRESI). CAPRRESI bénéficie de nombreuses forces de la méthode de récupération du plasmide d'origine et introduit une digestion enzymatique de restriction pour faciliter les réactions de ligature d'ADN (requises pour l'assemblage de la chimère). Pour ce protocole, les utilisateurs clonent des gènes de type sauvage dans le même plasmide (pUC18 ou pUC19). Après la sélection in silico des régions de séquence d'acides aminés où les chimères doivent être assemblées, les utilisateurs obtiennent toutes les séquences d'ADN synonymes qui les codent. Les scripts ad hoc Perl permettent aux utilisateurs de déterminer toutes les séquences d'ADN synonymes. Après cette étape, un autre script Perl recherche des sites d'enzymes de restriction sur toutes les séquences d'ADN synonymes. Cette analyse in silico est également effectuée en utilisant le gène de résistance à l'ampicilline ( ampR ) trouvé sur les plasmides pUC18 / 19. Les utilisateurs conçoivent des oligonucléotides dans des régions synonymes pour perturber les gènes de type sauvage et ampR par PCR. Après obtL'administration et la purification de fragments d'ADN complémentaires, la digestion enzymatique de restriction est réalisée. L'assemblage de la chimère est réalisé en ligant des fragments d'ADN complémentaires appropriés. Les vecteurs pUC18 / 19 sont sélectionnés pour CAPRRESI car ils offrent des avantages techniques, tels que la petite taille (2,686 paires de bases), le nombre élevé de copies, les caractéristiques de réaction de séquençage avantageuses et la disponibilité commerciale. L'utilisation d'enzymes de restriction pour l'assemblage de chimères élimine la nécessité d'ADN polymerases produisant des produits à extrémités franches. CAPRRESI est une méthode rapide et peu coûteuse pour fusionner des gènes codant pour des protéines.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

L'assemblage de gènes chimériques a été largement utilisé dans la biologie moléculaire pour élucider la fonction protéique et / ou à des fins biotechnologiques. Différents procédés existent pour fusionner des gènes, tels que l'amplification de produit de PCR 1 , la récupération de plasmide 2 , la recombinaison homologue 3 , les systèmes CRISPR-Cas9 4 , la recombinaison 5 dirigée par site et l'assemblage 6 de Gibson. Chacun de ces avantages offre différents avantages techniques; Par exemple, la flexibilité de la conception de la PCR en chevauchement, la sélection in vivo des constructions lors de la récupération du plasmide ou la haute efficacité des systèmes CRISPR-Cas9 et Gibson. En revanche, certaines difficultés peuvent survenir lors de l'exécution de certaines de ces méthodes; Par exemple, les deux premières approches s'appuient sur des fragments d'ADN à extrémités franches, et la ligature de ces types de produits pourrait être techniquement difficile par rapport à SticLigature ky-terminée. La recombinaison dirigée par le site peut laisser des traces de séquences supplémentaires d'ADN (cicatrices) sur l'original, comme dans le système Cre- LoxP 5 . CRISPR-Cas9 peut parfois modifier d'autres régions génomiques en plus du site cible 4 .

Ici, nous introduisons l'assemblage de chimère par récupération de plasmide et insertion de site d'enzyme de restriction (CAPRRESI), un protocole pour fusionner des gènes codant pour des protéines qui combinent la méthode de récupération de plasmide (PRM) avec l'insertion de sites d'enzymes de restriction sur des séquences d'ADN synonyme, améliorant l'efficacité de ligature . Pour assurer l'intégrité de la séquence d'acides aminés, les sites d'enzymes de restriction sont insérés sur des tronçons de séquence d'ADN synonyme. Parmi les avantages de CAPPRESI, il est possible de le faire en utilisant des réactifs / outils de laboratoire ordinaires ( par exemple , enzymes, cellules compétentes, solutions et thermocycleurs) et qu'il peut donner des résultats rapides (lorsque les enzymes appropriées sont utilisées). S'appuyant sur la restrictionLes sites enzymatiques issus des séquences d'ADN synonymes peuvent limiter la sélection des points de fusion exacts à l'intérieur des protéines d'intérêt. Dans de tels cas, les gènes cibles doivent être fusionnés en utilisant des oligonucléotides se chevauchant, et les sites d'enzymes de restriction doivent être insérés sur le gène de résistance du vecteur.

CAPRRESI se compose de sept étapes simples ( Figure 1 ): 1) sélection du vecteur de clonage, pUC18 ou pUC19 6 ; 2) analyse in silico des séquences de type sauvage à fusionner; 3) sélection des régions de rupture pour l'assemblage de la chimère et la rupture des plasmides; 4) génération in silico de séquences d'ADN synonymes contenant des sites d'enzymes de restriction; 5) clonage indépendant des gènes de type sauvage dans le plasmide sélectionné; 6) rupture de plasmide par PCR, suivie d'une digestion par une enzyme de restriction; Et 7) la récupération du plasmide en utilisant une ligature d'ADN et une transformation bactérienne. Les gènes chimériques produits par cette technique devraient être vérifiés wAvec séquençage.

Les vecteurs pUC18 / 19 offrent des avantages techniques pour le clonage et l'assemblage des chimères, tels que la petite taille ( c.-à-d., 2,686 paires de bases), le nombre élevé de copies, les caractéristiques de réaction de séquençage avantageuses et la disponibilité commerciale 7 . Ici, un hôte Escherichia coli a été utilisé pour assembler et manipuler les chimères parce que les cultures bactériennes sont bon marché et se développent rapidement. Compte tenu de cela, le clonage ultérieur des fragments de fusion dans les plasmides cible finaux sera nécessaire ( par exemple, les vecteurs d'expression comme pRK415 dans des bactéries ou pCMV dans des cellules de mammifères).

CAPRRESI a été testé pour la fusion de deux principaux gènes du facteur sigma: E. colirpoD et Rhizobium etlisigA . Les facteurs de sigma primaires sont des sous-unités de l'ARN polymérase responsables de l'initiation de la transcription, et elles sont constituées de quatre domaines ( c'est-à-dire σ1, σ2, σ3 et σ4) 8 . La séquence d'acides aminés lengtH de protéines codées par rpoD et sigA sont respectivement 613 et 685. RpoD et SigA partagent 48% d'identité (98% de couverture). Ces principaux facteurs sigma ont été divisés en deux fragments complémentaires entre les régions σ2 et σ3. Deux gènes chimériques ont été assemblés selon cette conception: la chimère 01 (RpoDσ1-σ2 + SigAσ3-σ4) et la chimère 02 (SigAσ1-σ2 + RpoDσ3-σ4). Les produits de fusion d'ADN ont été vérifiés par séquençage.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Protocole CAPRRESI

NOTE: La figure 1 représente le protocole CAPRRESI global. Cette technique est basée sur une conception in silico et la construction ultérieure des chimères désirées.

  1. Sélection du plasmide de clonage, pUC18 ou pUC19.
    1. Sélectionnez le vecteur pUC qui correspond le mieux aux exigences techniques.
      NOTE: Les deux vecteurs ont la même séquence, à l'exception de l'orientation du site de clonage multiple. Ceci est important pour la conception des oligonucléotides et la rupture du plasmide PCR.
  2. Analyse in silico des gènes de type sauvage et pUC18 / 19 séquences.
    1. Obtenez les séquences d'ADN des gènes de type sauvage et enregistrez-les dans un fichier au format FASTA ( p. Ex. Genes.fas).
      NOTE: Les séquences des vecteurs pUC18 / 19 sont contenues dans le fichier pUC.fas ( Figure 1 , étape 1).
    2. Déterminer quelle restriction enzYmes ne coupent pas les gènes de type sauvage et les séquences pUC18 / 19 en exécutant le script REsearch.pl. Sinon, effectuer une recherche de site d'enzyme de restriction avec un outil en ligne ( Figure 1 , étape 2).
      1. Tapez ce qui suit dans un terminal:
        Perl REsearch.pl genes.fas
        Perl REsearch.pl pUC.fas
        REMARQUE: ces commandes créeront les fichiers de sortie suivants: genes_lin.fas, genes_re.fas, pUC_lin.fas et pUC_re.fas.
      2. Sélectionnez les enzymes de restriction appropriées pour cloner les gènes de type sauvage dans le site de clonage multiple du vecteur pUC18 / 19 choisi en comparant les fichiers genes_re.fas et pUC.fas. Choisissez l'orientation de l'insert par rapport au gène de résistance à l'ampicilline ( ampR ) du vecteur pUC18 / 19.
    3. Concevez des oligonucleotides avant et arrière pour amplifier la région codante des gènes de type sauvage (oligonucléotides externes). Inclure le site de l'enzyme de restriction approprié à chaque extrémité 5 'Des oligonucléotides; Cela définira l'orientation de l'insertion.
      1. Inclure un site de liaison au ribosome fonctionnel dans les oligonucléotides vers l'avant.
      2. Insérez les deux gènes de type sauvage dans la même orientation à l'intérieur du vecteur.
  3. Sélection des régions de rupture pour l'assemblage de la chimère et la rupture des plasmides.
    1. Obtenez la séquence d'acides aminés des gènes de type sauvage et d' ampR en exécutant le script translate.pl ( Figure 1 , étape 3).
      1. Tapez ce qui suit dans un terminal:
        Perl translate.pl genes.fas
        Perl translate.pl ampR.fas

        REMARQUE: Ce script créera les fichiers de sortie suivants: genes_aa.fas et ampR_aa.fas.
    2. Aligner globalement les deux séquences d'acides aminés de type sauvage avec un logiciel approprié ( par exemple, MUSCLE) 9 .
    3. Sélectionnez les zones de rupture souhaitées (3-6 acides aminés) pour la chimèreEn fonction de l'alignement des séquences. Enregistrez-les dans un fichier au format FASTA ( p . Ex . , Regions.fas).
    4. Localisez les séquences d'ADN qui codent pour les étiages d'acides aminés sélectionnés sur les deux gènes de type sauvage.
  4. Production in silico de séquences d'ADN synonymes contenant des sites d'enzymes de restriction.
    1. Obtenir toutes les séquences d'ADN synonymes qui codent pour chaque séquence de séquence d'acides aminés sélectionnée en régions de rupture ( Figure 1 , étape 4); Ces séquences ont été stockées dans le fichier regions.fas.
      1. Tapez ce qui suit dans un terminal:
        Perl synonym.pl regions.fas
        REMARQUE: ce script créera le fichier de sortie region_syn.fas.
    2. Recherchez des sites d'enzymes de restriction trouvés sur des séquences d'ADN synonymes.
      1. Tapez ce qui suit dans un terminal: perl REsynonym.pl regions_syn.fas
        REMARQUE: Ce script créera le fichier de sortie region_syn-re.fas.
    3. Choisissez une enzyme de restriction qui est partagée entre les séquences de synonymes des deux gènes de type sauvage; Ce site sera utilisé pour assembler des chimères via la digestion enzymatique de restriction. Vérifiez que l'enzyme de restriction choisie ne coupe ni les gènes de type sauvage ni les séquences vectorielles pUC18 / 19.
      1. Comparez les enzymes de restriction trouvées sur les fichiers genes_re.fas, pUC_re.fas et regions_syn-re.fas.
    4. In silico substitue les originaux par leurs séquences d'ADN synonymes aux loci correspondants sur les deux gènes de type sauvage. Ajouter des séquences d'ADN synonymes dans le fichier de séquence de type sauvage (genes.fas).
    5. Obtenez la séquence d'acides aminés des gènes contenue dans le fichier genes.fas ( perl translate.pl genes.fas ).
    6. Alignez les séquences d'acides aminés traduites à partir de séquences d'ADN de type sauvage et synonyme. Vérifiez que les deux séquences sont les mêmes.
    7. Répétez toutes les étapes de cette section avec le gène ampR présent sur le pUC18 / 19 vecteur.
      NOTE: L'objectif est de perturber le gène ampR (fichier ampR.fas) en deux parties complémentaires. L'enzyme de restriction choisie pour perturber le gène ampR doit être différente de celle utilisée pour l'assemblage de la chimère.
  5. Le clonage indépendant des deux gènes de type sauvage dans le vecteur pUC18 / 19 sélectionné (Figure 1, étape 3).
    1. Purifier l'ADN plasmidique pUC18 / 19 choisi en utilisant un kit de purification d'ADN plasmidique.
      1. Par exemple, transformer E. coli DH5a avec du plasmide pUC18 et faire pousser les transformants pendant une nuit à 37 ° C sur une ampicilline LB-0,3 mg / ml solide (Amp). Choisissez une colonie transformante, inoculez une nouvelle plaque ampère LB-0.3 mg / mL et développez-la pendant une nuit à 37 ° C.
      2. Faites partie de la culture précédente et développez-la dans un mélange liquide de LB-0.3 mg / mL pour 6-8 h à 37 ° C. Extraire l'ADN plasmidique en utilisant un kit.
    2. La PCR amplifie les gènes de type sauvage de l'ADN génomique total en utilisant la méthode appropriéeRiat des oligonucléotides externes. Utiliser une polymérase d'ADN haute fidélité si possible. Sélectionnez l'ADN polymérase qui maximise le rendement. Effectuer la PCR selon les directives du fabricant et la température de fusion des oligonucléotides.
      1. Exécuter des cycles de PCR, en fonction de l'ADN polymérase, de la taille d'amplicon, du gabarit et des oligonucléotides utilisés. Par exemple, pour amplifier l'ADN de rpoD , préparer une réaction de 50 μL: 5 μL de tampon 10x, 2 μl de MgSO4 50 mM, 1 μL de mélange 10 mM de dNTP, 2 μL de chaque oligonucléotide 10 μM (Tableau 2), 2 ΜL d'ADN modèle (ADN total de E. coli DH5α), 35,8 μl d'eau ultra-pure et 0,2 μl d'ADN polymerase haute fidélité. Exécutez les cycles de PCR suivants: 1 min à 94 ° C pour la dénaturation initiale suivie de 30 cycles d'amplification (30 s à 94 ° C pour dénaturer, 30 s à 60 ° C pour recuit des oligonucléotides et 2 min à 68 ° C étendre).
      2. Dissoudre 1,2 g deAgarose dans 100 ml d'eau double-distillée en les chauffant au micro-ondes. Assembler un plateau de gel et peigner et les mettre dans la roulette horizontale de gel. Remplissez le bac en gel avec la solution d'agarose fondue et laissez-le solidifier. Retirez le peigne.
      3. Placez le gel dans la chambre d'électrophorèse. Remplir la chambre avec 1x tampon Tris-acétate-EDTA. Chargez 50 μL de produits de PCR dans les puits de gel. Électrophorèse des échantillons ( p . Ex ., À 110 V pendant 1 h).
      4. Après l'électrophorèse, tachez le gel dans 100 ml d'eau double distillée contenant 100 μL de solution de bromure d'éthidium 1 mg / ml pendant 10 minutes avec un tremblement lent. Laver le gel dans de l'eau double-distillée pendant encore 10 minutes en agitant lentement; Utilisez un agitateur horizontal.
        Attention: Le bromure d'éthidium est un composé toxique; Porter des gants de protection et un manteau de laboratoire en coton.
      5. Purifier l'ADN du gène de type sauvage des bandes correspondantes du gel en utilisant un kit. Visualiser les bandes en plaçant le gel coloré dans une chambre UV (Longueur d'onde recommandée: 300 nm). Gardez l'exposition du gel au minimum. Utilisez un kit de purification d'ADN et suivez les instructions du fabricant.
        Attention: le rayonnement UV est dangereux; Porter un bouclier protecteur, des lunettes et un manteau de laboratoire en coton.
    3. Les gènes de type sauvage purifiés Digest et l'ADN plasmidique pUC18 / 19 avec les enzymes de restriction selon les instructions du fabricant. Utiliser des enzymes de digestion rapide lorsque cela est possible. Par exemple, digérer 6 μl d'ADN de pUC18 (300 ng / μL) dans 10 μL d'eau ultrapure, 2 μl de tampon 10X, 1 μl d'enzyme de restriction Kpn I et 1 μl d'enzyme de restriction Xba I. Laisser la réaction à 37 ° C pendant 30 min.
      1. Inactive les enzymes de restriction conformément aux directives du fabricant. Par exemple, inactiver la réaction à double digestion Kpn I- Xba I à 80 ° C pendant 5 min.
    4. Insert de mélange: ADN de vecteur à un rati volumétriqueO de 3: 1. Suivez les instructions du fabricant pour une réaction de ligature. Utiliser des enzymes de ligature rapide lorsque cela est possible (laisser la réaction à 25 ° C pendant 10 minutes).
      NOTE: Typiquement, la concentration d'ADN après purification à l'aide des kits est suffisante pour la digestion et les réactions de ligature. Par exemple, ajouter 6 μl d'ADN rpoD ( Kpn I- Xba I, 150 ng / μL), 3 μl d'ADN pUC18 ( Kpn I- Xba I, 150 ng / μL), 10 μL de 2x tampon, 1 μL d'ultrapure Eau et 1 μl d'ADN ligase T4. Laisser la réaction de ligature à 25 ° C pendant 10 min.
    5. Transformer le DH5α de E. coli avec 2-4 μL de la réaction de ligature, comme décrit dans les Matériaux Complémentaires. Placer les cellules transformées dans des plaques solides LB / Amp / X-gal / IPTG. Laissez les plaques pendant la nuit à 37 ° C.
    6. Sélectionnez les colonies de E. coli transformantes de couleur blanche et faites-les sur une nouvelle plaque LB / Amp. Laissez les plaques pendant une nuit à 37 ° C. </ Li>
    7. Effectuer une PCR de colonie pour choisir les candidats pour séquencer la réaction, comme décrit dans les Matériaux Complémentaires. Extraire l'ADN plasmidique des candidats. Alternativement, digérer l'ADN plasmidique candidat avec les mêmes enzymes de restriction utilisées pour le clonage des inserts.
    8. Constructions candidates séquentielles avec un fournisseur de services de séquençage 10 . Assembler la séquence en silico à l' aide d'un assembleur d'ADN 11 ( Figure 1 , étape 5).
  6. Interruption du plasmide par PCR suivie d'une digestion par une enzyme de restriction.
    1. Concevez des oligonucléotides avant et arrière silico dans les régions de rupture pour les gènes de type sauvage et ampR , respectivement. Remplacer en silico le fragment de type sauvage pour sa séquence d'ADN synonyme correspondante (obtenue à l'étape 1.4).
      NOTE: Cette séquence d'ADN de synonyme contient un site d'enzyme de restriction. Les oligonucleotides avant et arrière se chevauchent à tLe site de l'enzyme de restriction. Les oligonucléotides devraient aller de 21 à 27 nucleotides, se terminer par une cytosine ou une guanine et contenir un site d'enzyme de restriction. Un oligonucléotide direct a la même séquence que sa région cible sur l'ADN matrice. Un oligonucléotide inverse est la séquence complémentaire inverse de la région cible sur l'ADN matrice.
    2. Utilisez les deux constructions de gènes de type sauvage comme modèle d'ADN pour les réactions de PCR ( p. Ex. PUC18 rpoD et pUC18 sigA ). Obtenez deux parties complémentaires de chaque construction (pUC18 rpoD σ1-σ2, pUC18 rpoD σ3-σ4, pUC18 sigA σ1-σ2 et pUC18 sigA σ3-σ4) ( Figure 1 , étape 6).
    3. Charger des échantillons d'ADN dans un gel d'agarose 1-1.2% [w / v]. Séparez les produits de PCR du matrice d'ADN par électrophorèse ( par exemple, 110 V pendant 1 h). Alternativement, digérer les réactions de PCR avec Dpn I pour briser le modèle d'ADN.
      REMARQUE: DpnL'enzyme I reconnaît uniquement les séquences d'ADN méthylées (5'-GATC-3 ').
      1. Purifier les échantillons en utilisant un kit de purification d'ADN. Suivez les directives du fabricant.
    4. Doublement digérer tous les fragments d'ADN complémentaires avec les enzymes de restriction appropriées selon les instructions du fabricant. Utiliser des enzymes de restriction de digestion rapide lorsque cela est possible. Par exemple, double-digérer le fragment d'ADN pUC18rpoDσ1-σ2 avec Afl II et Spe I en utilisant le protocole du fabricant. Laisser la réaction de digestion à 37 ° C pendant 15 minutes.
    5. Inactive les enzymes de restriction conformément aux directives du fabricant. Par exemple, inactive Afl II- Spe I à 80 ° C pendant 20 min.
  7. Récupération de plasmide en utilisant la ligature d'ADN et la transformation bactérienne.
    1. Mélanger les fragments d'ADN appropriés dans un rapport volumétrique 1: 1 pour assembler le gène chimère désiré ( Figure1, étape 7).
      NOTE: De cette façon, l'intégrité du gène ampR est restaurée, produisant une protéine fonctionnelle.
      1. Par exemple, mélanger 4 μL d' ADN de pUC18 rpoD σ1-σ2 (digéré avec Afl II- Spe I, 150 ng / μL), 4 μl d' ADN de pUC18 sigA σ3-σ4 ( Afl II- Spe I, 150 ng / μL), 10 μL de 2x de tampon, 2 μl d'eau ultrapure et 1 μl de T4 ADN ligase; La concentration d'ADN après la purification du kit est suffisante pour la digestion et la ligature subséquente. Laisser la réaction de ligature à 25 ° C pendant 10 min.
    2. Transformer E. coli DH5a avec 3-5 μL de la réaction de ligature de l'assemblage chimère (Matériaux supplémentaires). Cultiver les cellules transformantes dans des plaques LB / Amp / X-gal / IPTG pendant une nuit à 37 ° C pendant la nuit.
    3. Sélectionnez les colonies de E. coli transformantes de couleur blanche et faites-les sur une nouvelle plaque LB / Amp. Laisser les plaques du jour au lendemain au 37° C.
    4. Effectuer une PCR de colonie pour choisir les candidats pour une réaction de séquençage, comme décrit dans les Matériaux Complémentaires. Visualiser les bandes dans un gel d'agarose 1-1.2% (p / v) en effectuant une électrophorèse (décrit à l'étape 2.3.2.1).
    5. Développer les cultures à partir de candidats positifs. Extraire l'ADN plasmidique à partir d'eux en utilisant un kit de purification d'ADN plasmidique.

2. Constructions Chimériques Candidat de Séquence

  1. Assurez-vous que la qualité de l'ADN plasmidique est suffisante pour la réaction de séquençage en suivant les directives du fournisseur de service séquentiel. Extraire l'ADN en utilisant des kits de purification. Par exemple, sur la page Internet du fournisseur de services de séquences, prêtez une attention particulière à la concentration d'ADN recommandée pour les échantillons. Obtenir la concentration des échantillons en utilisant un instrument de quantification de l'ADN.
  2. Constructions chimères candidates séquentielles avec un fournisseur de services de séquençage 10 .
  3. Assembler se Quéntue les lectures avec un moniteur d'ADN in silico 11 .
  4. Alignez des séquences chimères assemblées par rapport à des séquences chimériques en silico en utilisant des outils d'alignement de séquence 9 , 12 . Vérifiez que le gène chimère a été fusionné avec succès.

3. Faire des préparatifs

REMARQUE: Toutes les étapes impliquant des cellules vivantes doivent être effectuées dans une hotte à flux laminaire propre avec le brûleur Bunsen.

  1. Production de cellules E. coli DH5α compétentes.
    1. Pour produire des cellules compatibles avec E. coli , suivre les protocoles publiés 13 ou voir les Matériaux Complémentaires . Alternativement, utilisez des cellules compétentes disponibles dans le commerce.
  2. Transformer les cellules E. coli DH5α-compétentes.
    1. Pour la transformation chimique des cultures de E. coli , suivre les protocoles publiésClass = "xref"> 13 ou voir les Matériaux Complémentaires . Alternativement, utiliser l'électroporation pour la transformation bactérienne. Si des cellules compétentes disponibles dans le commerce sont utilisées, suivez les directives du fabricant.
  3. ADN génomique purifiant et plasmide provenant de E. coli DH5a.
    1. Effectuer l'extraction d'acide nucléique, comme indiqué dans les Matériaux supplémentaires , en utilisant des kits disponibles dans le commerce ou après les protocoles publiés 13 .
  4. Effectuer la PCR des colonies.
    1. Utilisez cette technique pour identifier les colonies de transformants candidats pour une réaction de séquençage ultérieure.
      REMARQUE: cette méthode ne représente pas une vérification finale de l'intégrité des séquences. Une description détaillée de cette technique est disponible dans les Matériaux Complémentaires .
  5. Préparation des solutions.
    1. Voir
  6. Téléchargez les scripts et les fichiers de séquence requis pour le protocole CAPRRESI.
    1. Téléchargez les fichiers de banques de gènes contenant la séquence complète du génome des espèces souhaitées, extrayez la séquence d'ADN du gène choisi en utilisant un navigateur génome et enregistrez-le au format de fichier fasta. Téléchargez les scripts Perl requis pour le protocole CAPRRESI. Enregistrez les scripts et les fichiers de séquence dans le même répertoire.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

La figure 1 représente CAPRRESI. En utilisant cette méthode, deux gènes chimériques ont été assemblés en échangeant les domaines de deux facteurs sigma primaires bactériens ( c'est-à-dire E. coli RpoD et R. etli SigA). Les séquences d'ADN des gènes rpoD et sigA ont été obtenues en utilisant le navigateur Artemis Genome 14 à partir des fichiers génomiques GenBank NC_000913 et NC_007761, respectivement. La séquence d'ADN du vecteur pUC18 a été obtenue à partir de la base de données nucléotidiques du serveur NCBI. Les analyses in silico des sites d'enzymes de restriction ont été effectuées sur des séquences d'ADN en exécutant le script Permet REsearch.pl (voir l'étape 1.2.2). Ces résultats ont été utilisés pour la conception d'oligonucléotides (étape 1.2.3). Les oligonucléotides externes comprenaient des sites de reconnaissance pour les enzymes de restriction Xba I et Kpn I pour cloner des gènes de type sauvage dans le site de clonage multiple pUC18. L'oligonucléotide avant comprenait également un riboUn site de liaison ( tableau 2 ). L'ADN génomique a été extrait de cellules E. coli DH5a cultivées dans du bouillon LB / Nal (37 ° C, 220-250 tr / min) et des cellules R. etli CFN42 cultivées dans du bouillon PY / Nal / CaCl 2 (30 ° C, 220-250 tr / min ). Ces échantillons ont été utilisés comme modèles d'ADN pour l'amplification du gène de type sauvage (étape 1.5.2).

Les gènes de type Wildtype ont été amplifiés à l'aide d'une ADN polymérase Taq à haute fidélité, qui a été purifiée à partir de gels d'agarose (kit de purification d'ADN), à double digestion avec des enzymes de restriction Kpn I- Xba I et a été clone dans le vecteur pUC18. Les cellules DH5a de E. coli chimiquement compétentes ont été transformées avec 5 μL de la réaction de ligature correspondant aux constructions de type sauvage pUC18 rpoD et pUC18 sigA (étape 1.5.5). Les cellules transformantes ont été sélectionnées sur des plaques solides LB / Amp / X-gal / IPTG cultivées à 37 ° C. Les constructions de type Wildtype ont été vérifiées par Sanger sequenc10 . Les lectures de séquence de Sanger étaient en silico assemblées à l'aide de MIRA 11 (étape 1.5.8).

Les séquences d'acides aminés à partir de gènes de type sauvage ont été obtenues en exécutant le script translate.pl (étape 1.3.1). Après avoir aligné les gènes de type sauvage avec Clustal 12 , les régions d'acides aminés TLV et NLR ont été sélectionnées respectivement sur le facteur de résistance à l'ampicilline ( ampR ) et les facteurs sigma primaires de type sauvage (étape 1.3.3). Ces régions d'acides aminés ont été utilisées pour calculer toutes les séquences de synonymes d'ADN possibles qui les codent en exécutant le script synonym.pl (étape 1.4.1). Le script REsynonym.pl a cherché des sites d'enzymes de restriction trouvés sur les séquences d'ADN de synonyme précédemment générées (étape 1.4.2). Les régions synonymes qui ont introduit le plus petit nombre de modifications par rapport aux séquences de type sauvage ont été sélectionnées. Pour les principaux gènes du facteur sigma, les séquences de type sauvage de RpOD (AACTTACGT) et SigA (AACCTTCGC) ont été échangés contre AA CTTAAG G. Ce dernier a inclus un site Afl II (gras). Pour le gène ampR , la séquence de type sauvage ACGCTGGTG a été échangée contre son synonyme, AC ACTAGT G. La séquence d'ADN synonyme insérée dans le gène ampR contenait un site Spe I (gras). La substitution in silico du type sauvage pour les séquences de synonymes correspondantes a été effectuée pour vérifier l'intégrité de la séquence et la conception des oligonucléotides (étapes 1.2-1.4).

Des modifications de séquence de synonyme ont été introduites par PCR en utilisant les oligonucléotides appropriés ( Tableau 2 ) et les constructions de type sauvage comme modèles d'ADN (étape 1.5.2). Les réactions d'amplification ont produit quatre parties complémentaires: pUC18 rpoD σ1-σ2, pUC18 rpoD σ3-σ4, pUC18 sigA σ1-σ2 et pUC18 sigA σ3-σ4. Les parties complémentaires disA rompu non seulement les facteurs sigma, mais aussi les ampli gènes. Les parties complémentaires ont été purifiées à l'aide d'un kit de purification d'ADN (étape 1.6.3).

Ces fragments d'ADN complémentaires ont été digérés par deux enzymes de restriction Afl II et Spe I (étape 1.6.4). Selon le profil CAPRRESI, les fragments d'ADN pUC18 rpoD σ1-σ2 ont été ligaturés avec pUC18 sigA σ3-σ4 pour obtenir la chimère 01 et pUC18 sigA σ1-σ2 a été ligaturé avec pUC18 rpoD σ3-σ4 pour assembler la chimère 02 (étapes 1.7.1-1.7 .3). Les cellules DH5a de E. coli chimiquement compétentes ont été transformées avec 5 μL de la réaction de ligature de pUC18 chim01 et pUC18 chim02 (étape 1.7.4). Les cellules transformantes ont été sélectionnées sur des plaques solides LB / Amp / X-gal / IPTG cultivées à 37 ° C (étape 1.7.5). Les constructions chimériques ont été vérifiées par Sanger séquençage 10 (étape 2). Sanger sequence rLes eads ont été assemblés à l'aide de MIRA 11 , et ses fichiers résultants sont listés dans le tableau 3 . La figure 2 montre les alignements (effectués en utilisant MUSCLE) 9 des séquences assemblées de gènes sauvages et chimères dans les régions de rupture.

Figure 1
Figure 1: vue d'ensemble de CAPRRESI. Représentations: gènes (flèches épaisses), plasmides fonctionnels (cercles fermés) et oligonucléotides (flèches fines et à pointe noire). Les sites d'enzyme de restriction insérés dans les oligonucléotides apparaissent dans les couleurs. Abréviations: Wt (type sauvage), FWD (oligonucléotide vers l'avant), REV (oligonucléotide inverse), ampR (gène de résistance à l'ampicilline), RES (site d'enzyme de restriction), RE (enzyme de restriction). Cliquez ici pour voir un plus grand versiSur cette figure.

Figure 2
Figure 2: Alignement de séquences de gènes de type sauvage et chimères assemblées. Les séquences d'ADN assemblées ont été alignées à l'aide de MUSCLE 9 . Les séquences ont été assemblées avec MIRA 11 . Les séquences de synonym apparaissent en noir. Le site de reconnaissance Afl II apparaît souligné. Code de nucléotide IUPAC: R (A ou G) et K (G ou T). Constructions: rpoD (rouge), sigA (bleu), séquence chimère 01 ( rpoD σ1-σ2- sigA σ3-σ4) et séquence chimère 02 ( sigA σ1-σ2- rpoD σ3-σ4). Cliquez ici pour voir une version plus grande de ce chiffre.

Solution Composants Instructions
Quantité Composé
Bouillon Luria-Bertani (LB) 5 g extrait de levure Dissoudre tous les composants dans l'eau. Autoclave. Conserver à température ambiante jusqu'à utilisation. Pour un bouillon LB solide, ajouter 15 g d'agar bactériologique à la recette.
10 g Peptone de caséine
10 g NaCl
Jusqu'à 1 L Eau distillée double
LB / Amp / X-gal / IPTG 100 mL Bouillon LB solide fondu Ajouter tous les composants au bouillon de LB tempéré. Remplissez les boîtes de Petri et attendez qu'elles se solidifient. Effectuer des étapes dans une hotte à flux laminaire propre avec le brûleur Bunsen.
100 μL Ampicilline (Amp) [100 mg / ml]
100 μL X-gal [20 mg / ml]
50 μL Solution 1T IPTG
Bouillon de levure de peptone (PY) 3 g extrait de levure Dissoudre tous les composants dans l'eau. Autoclave. Conserver à température ambiante jusqu'à utilisation. Pour un bouillon PY solide, ajouter 15 g d'agar bactériologique à la recette. Pour la culture de R. etli, ajouter 700 μL de solution de CaCl 2 1 M avant l'utilisation.
5 g Peptone de caséine
Jusqu'à 1 L Eau distillée double
Plaques PY / CaCl 2 / Nal 100 mL Bouillon PY solide fondu Ajouter tous les composants au calin PY tempéré. Remplissez les boîtes de Petri et attendez qu'elles se solidifient. Effectuer des étapes dans une hotte à flux laminaire propre avec le brûleur Bunsen.
700 μL Solution de CaCl 2 1 M
100 μL Acide nalidixique (Nal) [20 mg / mL]
Solution de chlorure de calcium 1 M (CaCl 2 ) 11,1 g CaCl 2 Dissoudre le CaCl 2 dans l'eau. Autoclave. Ranger à température ambiante.
Jusqu'à 100 mL Eau distillée double
Tris-EDTA (TE) 10: 1 pH 8,0 1 mL Solution Tris 1 M Mélangez tous les composants. Autoclave. Ranger à température ambiante.
400 μL Solution EDTA 0,25 M
Jusqu'à 100 mL Eau distillée double
TE 50:20 pH 8,0 5 mL Solution Tris 1 M Mélangez tous les composants. Autoclave. Conserver à température ambiante. </ Td>
8 mL Solution EDTA 0,25 M
Jusqu'à 100 mL Eau distillée double
TE 10: 1 solution 10 mM de NaCl 58,4 mg NaCl Dissoudre NaCl dans TE 10: 1. Autoclave. Ranger à température ambiante.
Jusqu'à 100 mL TE 10: 1 pH 8,0 solution
Solution de lyse I 80 mg Lysozyme Dissoudre et mélanger tous les composants dans l'eau. Filtrer la stérilisation à l'aide d'un filtre de 0,22 μm. Ranger à température ambiante.
2 mL Solution de glucose 0,5 M
400 μL Solution EDTA 0,5 M
500 μL Solution Tris 1 M
Jusqu'à 20 mL Eau stérilisée à double distillation
Solution de lyse II 1,2 ml Solution 5 M d'hydroxyde de sodium (NaOH) Dissoudre tous les composants dans l'eau. Filtrer la stérilisation à l'aide d'un filtre de 0,22 μm. Ranger à température ambiante.
3 mL 10% de solution de dodécylsulfate de sodium (SDS)
Jusqu'à 30 mL Eau stérilisée à double distillation
Solution de lyse III 29,4 g Acétate de potassium (CH3 COOK) Dissoudre et mélanger tous les composants dans l'eau. Filtrer la stérilisation à l'aide d'un filtre de 0,22 μm. Ranger à température ambiante.
11,5 ml Acide acétique absolu (CH3COOH)
Jusqu'à 100 mL Eau stérilisée à double distillation
Solution de chlorure de magnésium 1 M (MgCl 2 ) 9,5 g MgCl 2 Dissoudre MgCl 2 en wAter. Autoclave. Ranger à température ambiante.
Jusqu'à 100 mL Eau distillée double
Solution d'acétate de sodium 3 M (CH3 COONa) 24,6 g CH 3 COONa Dissoudre CH3 COONa dans l'eau. Autoclave. Ranger à température ambiante
Jusqu'à 100 mL Eau distillée double
Solution SDS 10% 10 g SDS Dissoudre le SDS dans l'eau avec une barre d'agitation magnétique à basse vitesse. Autoclave. Ranger à température ambiante.
Jusqu'à 100 mL Eau distillée double
Solution 3 M CH 3 COOK 29,4 g CH 3 COOK Dissoudre CH3 COOK dans l'eau. Filtrer la stérilisation à l'aide d'un filtre de 0,22 μm. Ranger à température ambiante. Jusqu'à 100 mL Eau stérilisée à double distillation
Solution de protéinase K 5 mg Proteinase K Dissoudre la protéinase K dans la solution TE 50:20. Chauffer à 37 ° C pendant 1 heure. Conserver à -20 ° C.
Jusqu'à 1 mL TE 50:20 pH 8,0 solution
Solution RNase 10 mg RNase Dissoudre la RNase dans l'eau. Chauffer à 95 ºC pendant 10 min. Conserver à -20 ° C.
Jusqu'à 1 mL Eau ultrapure stérilisée
Solution de 1 M isopropyl-β-D-thiogalactoside (IPTG) 238,3 mg IPTG Dissoudre l'IPTG dans l'eau. Filtrer la stérilisation à l'aide d'un filtre de 0,22 μm. Conserver à -20 ° C.
Jusqu'à 1 mL Eau ultrapure stérilisée
20 mg X-gal Dissoudre le X-gal dans l'eau. Filtrer la stérilisation à l'aide d'un filtre de 0,22 μm. Conserver à -20 ° C.
Jusqu'à 1 mL Eau ultrapure stérilisée
Phénol: chloroforme: alcool isoamylique 24: 24: 1 solution 24 mL phénol Mélangez tous les composants. Stocker dans une bouteille à couverture ambrée à 4 ºC. MISE EN GARDE! Matériel dangereux. Portez des lunettes de protection, des gants et une robe de laboratoire en coton. Utilisez un capot d'extraction. NE PAS allumer le brûleur Bunsen ou toute autre source d'incendie pendant la manipulation. Alternative: utiliser du phénol commercial: chloroforme: alcool isoamylique solution 25: 24: 1
24 mL chloroforme
1 mL Alcool isoamylique
Solution de glucose 0,5 M 9 g gLucose Dissoudre le glucose dans l'eau. Filtrer la stérilisation à l'aide d'un filtre de 0,22 μm. Ranger à température ambiante.
Jusqu'à 100 mL Eau ultrapure stérilisée
Acide éthylènediaminetétracétique 0,5 M (EDTA) pH 8,0 solution 14,6 g EDTA Dissoudre l'EDTA dans l'eau. Ajuster le pH avec une solution de NaOH 5 M. Autoclave. Ranger à température ambiante.
Jusqu'à 100 mL Eau distillée double
Solution 0,25 M EDTA pH 8,0 7,3 g EDTA Dissoudre l'EDTA dans l'eau. Ajuster le pH avec une solution de NaOH 5 M. Autoclave. Ranger à température ambiante.
Jusqu'à 100 mL Eau distillée double
Solution 1 M Tris pH 8,0 12,1 g Tris Dissoudre le Tris dans l'eau. Ajuster le pH avecAcide chlorhydrique absolu (HCl). Autoclave. Ranger à température ambiante.
Jusqu'à 100 mL Eau distillée double
Solution 5 M d'hydroxyde de sodium (NaOH) 19,9 g NaOH Dissoudre le NaOH dans l'eau. Ranger à température ambiante. MISE EN GARDE! Composé caustique.
Jusqu'à 100 mL Eau stérilisée à double distillation
Solution de NaOH 0,1 M 399 mg NaOH Dissoudre le NaOH dans l'eau. Ranger à température ambiante.
Jusqu'à 100 mL Eau stérilisée à double distillation
Solution d'acide d'acide nalidixique (Nal) 60 mg Acide nalidixique Dissoudre Nal dans l'eau. Filtrer la stérilisation à l'aide d'un filtre de 0,22 μm. Conserver à 4 ºC.
Jusqu'à 3 mL 0,1 MNSolution aOH
Solution stock ampicilline (Amp) 300 mg Ampicilline Dissoudre l'ampli dans l'eau. Filtrer la stérilisation à l'aide d'un filtre de 0,22 μm. Conserver à 4 ºC.
Jusqu'à 3 mL Eau stérilisée à double distillation
10x tris-acétate-EDTA tampon 48,4 g Tris Dissoudre tous les composants dans l'eau. Autoclave. Ranger à température ambiante.
20 ml Solution EDTA 0,5 M
11,44 ml l'acide acétique glacial
Jusqu'à 1 L Eau distillée double

Tableau 1: Préparation de la solution. Instructions pour la préparation de la solution.

Non. Code Séquence Longueur (nt) Caractéristiques
1 RpoD-FWD GC TCTAGA GA AGGAGA TATCATATGGAGCAAAACCCGCAGTCA 43 Site XbaI ; Amplification génétique de type sauvage et clonage vectoriel
2 RoD-REV GG GGTACC TTAATCGTCCAGGAAGCTACG 29 Site KpnI ; Amplification génétique de type sauvage et clonage vectoriel
3 SigA-FWD GC TCTAGA GA AGGAGA TATCATATGGCAACCAAGGTCAAAGAG 43 Site XbaI ; Amplification génétique de type sauvage et clonage vectoriel
4 SigA-REV GG GGTACC TTAGCTGTCCAGAAAGCTTCT </ Td> 29 Site KpnI ; Amplification génétique de type sauvage et clonage vectoriel
3 AmpR-FWD AC ACTAGT GAAAGTAAAAGAT 21 Site implanté, mutation de synonyme. Perturbation du gène ampR
4 AmpR-REV TC ACTAGT GTTTCTGGGTGAG 21 Site implanté, mutation de synonyme. Perturbation du gène ampR
5 Σ2RpoD-FWD AA CTTAAG GCTGGTTATTTCTATCGCT 27 Site AflII inséré, mutation synonyme. Construction de chim01-02
6 Σ2RpoD-REV GC CTTAAG TTCGCTTCAACCATCTCTT 27 Site AflII inséré, mutation synonyme. Construction de chim01-02
7 Σ2SigA-FWD AA CTTAAG GCTCGTCATTTCAATCGCC 27 Site AflII inséré, mutation synonyme. Construction de chim01-02
8 Σ2SigA-REV GC CTTAAG TTCGCTTCGACCATTTCCT 27 Site AflII inséré, mutation synonyme. Construction de chim01-02

Tableau 2: séquences oligonucléotidiques. Les sites d'enzymes de restriction apparaissent soulignés. Site de liaison aux ribosomes: gras.

Construction Fichier de séquence Fichier de qualité
Chimera01 Chim01_out.unpadded.fasta Chim01_out.unpadded.fasta.qual
Chim01_A3 / B3 / E2 / F2 / G2 /H2.pdf
Chimera02 Chim02_out.unpadded.fasta Chim02_out.unpadded.fasta.qual
Chim02_C3 / D3 / E3 / F3 / G3 / H3.pdf
RpoD Rpod_out.unpadded.fasta Rpod_out.unpadded.fasta.qual
SigA Suite_out.unpadded.fasta Suite_out.unpadded.fasta.qual

Tableau 3: Fichiers de séquence obtenus avec l'assembleur MIRA et le séquenceur d'ADN. Les lectures séquentielles de Sanger provenant de constructions chimériques et de type sauvage ont été assemblées avec le logiciel MIRA 11 à l'aide de l'option de cartographie. Les chromatogrammes du séquençage des chimères apparaissent sous forme de fichiers PDF.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

CAPRRESI a été conçu comme une alternative au PRM 2 . Le PRM original est une technique puissante; Il permet la fusion des séquences d'ADN le long de n'importe quelle partie des gènes sélectionnés. Pour PRM, les gènes de type sauvage doivent être clones dans le même plasmide. Ensuite, les oligonucléotides sont conçus dans des gènes de résistance de type sauvage et antibiotiques trouvés sur le plasmide. La rupture des plasmides est obtenue par PCR en utilisant des ADN polymérases à extrémités franches et à haute résolution et des oligonucléotides précédemment conçus. La ligature de produits de PCR complémentaires rassemble des gènes chimériques et rétablit la cassette de résistance aux antibiotiques, ce qui entraîne une récupération fonctionnelle du plasmide. PRM permet la construction de bibliothèques de gènes chimériques sur le même fond plasmidique. Malheureusement, la ligature des séquences d'ADN franches peut être techniquement difficile. L'assemblage de la chimère par des fragments de PCR 1 se chevauchant demande également que les polymerases d'ADN produisent des produits à extrémités franches etPurification de l'ADN pour chaque réaction. Les gènes chimériques assemblés par cette technique sont des produits ADN linéaires. Le clonage de chaque construction dans le vecteur cible pourrait retarder une analyse plus approfondie.

CAPRRESI bénéficie de nombreuses forces de PRM et simplifie également la ligature de fragments d'ADN complémentaires en utilisant des sites d'enzymes de restriction sur des régions de séquences d'ADN synonymes. Pour ces raisons, CAPRRESI ne nécessite pas d'ADN polymérase à extrémités franches. L'utilisation de séquences d'ADN synonymes restreint les sites de fusion pour l'assemblage de la chimère mais améliore l'efficacité de la ligature. Une autre modification importante introduite dans CAPRRESI est que les chimères sont assemblées et manipulées dans des vecteurs pUC18 / 19. Ces vecteurs possèdent plusieurs caractéristiques avantageuses, comme indiqué précédemment. L'ADN chimérique peut être obtenu en propagant le vecteur de construction chez les hôtes E. coli . Le clonage ultérieur de gènes chimériques dans le plasmide final ( par exemple , un vecteur d'expression) est parfoisChamps obligatoires.

CAPRRESI repose également sur la manipulation in silico des séquences d'ADN et d'acides aminés. Les scripts Perl ad hoc permettent de sélectionner les enzymes de restriction appropriées pour cloner les gènes de type sauvage, le calcul de toutes les séquences d'ADN synonymes correspondant aux régions de rupture (pour l'assemblage de la chimère) et l'identification des enzymes de restriction pour simplifier la récupération du plasmide. Compte tenu de ces conditions, CAPRRESI est une alternative pour la fusion des gènes codant pour les protéines. Les étapes critiques du protocole CAPRRESI sont: 1) la sélection des régions de rupture et 2) la purification des produits de PCR. Les régions en rupture sont des tronçons où les séquences de synonymes sont calculées, produisant des sites d'enzymes de restriction qui ne se trouvent pas sur des séquences de type sauvage. L'utilisation de sites d'enzymes de restriction pour l'assemblage de la chimère élimine la nécessité d'ADN polymerases qui produisent des produits à extrémités franches et facilite la réaction de ligature. Toutes les régions ne disposent pas de sites d'enzymes de restriction utilisables; FoPour cette raison, il est recommandé de déplacer les régions de rupture par un acide aminé à la fois jusqu'à ce que le meilleur tronçon de séquence soit trouvé. Si la conception in silico ne permet pas le mouvement des régions de rupture ou les tronçons de séquence manquent de séquences d'ADN synonymes avec des sites d'enzymes de restriction appropriés, il est recommandé de fusionner des gènes cibles en utilisant des oligonucléotides se chevauchant et d'introduire des séquences d'ADN synonymes dans le gène de résistance à l'ampicilline (Trouvé sur le vecteur) seulement. De cette façon, les gènes peuvent être fusionnés à n'importe quelle partie et la récupération du plasmide repose sur la ligature d'un site unique (digéré avec une seule enzyme de restriction). La flexibilité de CAPPRESI permet de l'effectuer en combinaison avec d'autres techniques.

La purification des produits de PCR est effectuée pour éliminer l'ADN modèle, ce qui diminue les chances de contamination par un plasmide parental après la ligature de fragments d'ADN complémentaires. La réalisation de ces deux étapes critiques améliore le bacEfficacité de transformation tertiaire (le nombre de constructions correctement assemblées), ce qui permet à CAPRRESI d'être réalisé avec des cellules de E. coli chimiquement compétentes (CaCl 2 ) ou électrocompétentes. Le premier type de cellules compétentes représente la source la moins chère des cultures de E. coli , employées pour la transformation bactérienne dans la plupart des laboratoires. En raison de toutes les fonctionnalités présentées précédemment, CAPRRESI représente une option utile pour l'assemblage de chimères.

En outre, CAPRRESI pourrait fonctionner en combinaison avec des fragments de PCR superposés ou des techniques de récupération de plasmides. Par exemple, au lieu d'insérer deux séquences de synonymes par portion d'ADN complémentaire, la région de rupture souhaitée (sur les gènes de type sauvage cible) pourrait utiliser des oligonucleotides se chevauchant pour fusionner des séquences intermédiaires. L'introduction de séquences de synonymes pourrait être limitée au gène ampR des vecteurs pUC18 / 19, conduisant à l'utilisation d'une seule enzyme de restriction pour restaurer le plasmideD intégrité. Ces applications futures pourraient renforcer CAPRRESI en permettant la fusion de tout type de séquences d'ADN ( c'est-à-dire non seulement des gènes codant pour des protéines), sans compromettre l'efficacité de la ligature.

Afin de tester CAPRRESI, deux facteurs sigma chimériques ont été assemblés en échangeant des régions de deux gènes du facteur sigma primaire de type sauvage: rpoD ( E. coli ) et sigA ( R. etli ). Tous les facteurs sigma primaires connus tiennent quatre domaines, σ1 à σ4 8 . La chimère 01 consiste en RpoDσ1-σ2 et SigAσ3-σ4, tandis que la chimère 02 a SigAσ1-σ2 et RpoDσ3-σ4. L'intégrité des constructions chimères a été vérifiée par Sanger séquençage 10 ( Figure 2 ).

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs déclarent qu'ils n'ont pas d'intérêts financiers concurrents.

Acknowledgments

Ce travail a été soutenu par le Conseil national de la science et la technologie, le CONACYT, le Mexique (numéro de subvention 154833) et l'Université nationale autonome du Mexique. Les auteurs souhaitent remercier Víctor González, Rosa I. Santamaría, Patricia Bustos et Soledad Juárez pour leurs conseils administratifs et techniques.

Materials

Name Company Catalog Number Comments
Platinum Taq DNA polymerase High Fidelity Thermo Fisher 11304011 Produces a mix of blunt/3’-A overhang ended PCR products
High pure plasmid isolation kit Roche 11754785001 Used for all plasmid purification reactions
High pure PCR product purification kit Roche 11732676001 Used for all PCR purification reactions from agarose gels
AflII restriction enzyme New England Biolabs R0520L Recognizes sequence 5’-CTTAAG-3’ and cuts at 37 °C
KpnI-HF restriction enzyme New England Biolabs R3142L Recognizes sequence 5’-GGTACC-3’ and cuts at 37 °C
SpeI-HF restriction enzyme New England Biolabs R3133L Recognizes sequence 5’-ACTAGT-3’ and cuts at 37 °C
XbaI restriction enzyme New England Biolabs R0145L Recognizes sequence 5’-TCTAGA-3’ and cuts at 37 °C
Ampicillin sodium salt Sigma Aldrich A0166-5G Antibiotics
Nalidixic acid Sigma Aldrich N8878-5G Antibiotics
Yeast Extract Sigma Aldrich Y1625-1KG Bacterial cell culture
Casein peptone Sigma Aldrich 70171-500G Bacterial cell culture
NaCl Sigma Aldrich S9888-1KG Sodium chloride
Agar Sigma Aldrich 05040-1KG Bacterial cell culture
XbaI restriction enzyme Thermo Fisher FD0684 Fast digest XbaI enzyme
KpnI restriction enzyme Thermo Fisher FD0524 Fast digest KpnI enzyme
Quick Ligation Kit New England Biolabs M2200S Fast DNA ligation kit
AflII restriction enzyme Thermo Fisher FD0834 Fast digest AflII enzyme
SpeI restriction enzyme Thermo Fisher FD1253 Fast digest SpeI enzyme

DOWNLOAD MATERIALS LIST

References

  1. Horton, R. M., Hunt, H. D., Ho, S. N., Pullen, J. K., Pease, L. R. Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene. 77, (1), 61-68 (1989).
  2. Vos, M. J., Kampinga, H. H. A PCR amplification strategy for unrestricted generation of chimeric genes. Anal. Biochem. 380, (2), 338-340 (2008).
  3. Hawkins, N. C., Garriga, G., Beh, C. T. Creating Precise GFP Fusions in Plasmids Using Yeast Homologous Recombination. Biotechniques. 34, (1), 1-5 (2003).
  4. Sander, J. D., Joung, J. K. CRISPR-Cas systems for editing, regulating and targeting genomes. Nat Biotechnol. 32, (4), 347-355 (2014).
  5. Nagy, A. Cre recombinase: The universal reagent for genome tailoring. Genesis. 26, (2), 99-109 (2000).
  6. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods. 6, (5), 343-345 (2009).
  7. Norrander, J., Kempe, T., Messing, J. Construction of improved M13 vectors using oligodeoxynucleotide-directed mutagenesis. Gene. 26, (1), 101-106 (1983).
  8. Gruber, T. M., Gross, C. A. Multiple sigma subunits and the partitioning of bacterial transcription space. Annu Rev Microbiol. 57, 441-466 (2003).
  9. Edgar, R. C. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 32, (5), 1792-1797 (2004).
  10. Macrogen Inc. Seoul, Rep. Of Korea. Available from: http://dna.macrogen.com/eng/index.jsp (2016).
  11. Chevreux, B. MIRA: an automated genome and EST assembler. Available from: http://www.chevreux.org/thesis/index.html 1-161 (2005).
  12. Thompson, J. D., Gibson, T. J., Higgins, D. G. Multiple sequence alignment using ClustalW and ClustalX. Curr Protoc Bioinformatics. Chapter 2 (Unit 2.3) 1-22 (2002).
  13. Sambrook, J., Russell, D. W. Molecular Cloning: A laboratory manual. CSHLP. (2001).
  14. Rutherford, K., et al. Artemis: sequence visualization and annotation. Bioinformatics. 16, (10), 944-945 (2000).
CAPRRESI: Assemblage de la chimère par insertion de plasmides et restriction Enzyme Site Insertion
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Santillán, O., Ramírez-Romero, M. A., Dávila, G. CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion. J. Vis. Exp. (124), e55526, doi:10.3791/55526 (2017).More

Santillán, O., Ramírez-Romero, M. A., Dávila, G. CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion. J. Vis. Exp. (124), e55526, doi:10.3791/55526 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter