Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

CAPRRESI: Chimären Assembly durch Plasmid Recovery und Restriktion Enzym Site Insertion

doi: 10.3791/55526 Published: June 25, 2017

Summary

Hier präsentieren wir die Chimären-Assemblierung durch Plasmid-Wiedergewinnung und Restriktionsenzym-Insertion (CAPRRESI), ein Protokoll, das auf der Insertion von Restriktionsenzymstellen in Synonym-DNA-Sequenzen und funktionelle Plasmid-Recovery basiert. Dieses Protokoll ist eine schnelle und kostengünstige Methode zum Fixieren von Protein-kodierenden Genen.

Abstract

Hier präsentieren wir die Chimären-Assemblierung durch Plasmid-Wiedergewinnung und Restriktionsenzym-Insertion (CAPRRESI). CAPRRESI profitiert von vielen Stärken der ursprünglichen Plasmid-Wiedergewinnungsmethode und führt eine Restriktionsenzym-Verdauung ein, um DNA-Ligationsreaktionen zu erleichtern (erforderlich für die Chimären-Assemblierung). Für dieses Protokoll klonieren Benutzer Wildtyp-Gene in das gleiche Plasmid (pUC18 oder pUC19). Nach der in Silico- Selektion von Aminosäuresequenzregionen, in denen Chimären zusammengesetzt werden sollen, erhalten die Benutzer alle Synonym-DNA-Sequenzen, die sie codieren. Ad-hoc Perl-Skripte ermöglichen es Benutzern, alle Synonym-DNA-Sequenzen zu bestimmen. Nach diesem Schritt sucht ein anderes Perl-Skript nach Einschränkungsenzytsites auf allen Synonym-DNA-Sequenzen. Diese in der Silico- Analyse wird auch unter Verwendung des Ampicillin-Resistenzgens ( ampR ), das auf pUC18 / 19-Plasmiden gefunden wurde, durchgeführt. Benutzer entwickeln Oligonukleotide in Synonymregionen, um Wildtyp- und AmpR- Gene durch PCR zu stören. Nach obtAining und reinigen komplementäre DNA-Fragmente, Restriktionsenzym-Verdauung wird erreicht. Die Chimärenanordnung wird durch Ligieren geeigneter komplementärer DNA-Fragmente erreicht. PUC18 / 19-Vektoren sind für CAPRRESI ausgewählt, weil sie technische Vorteile wie kleine Größe (2.686 Basenpaare), hohe Kopienzahl, vorteilhafte Sequenzierungsreaktionsmerkmale und kommerzielle Verfügbarkeit bieten. Die Verwendung von Restriktionsenzymen für die Chimärenanordnung eliminiert die Notwendigkeit von DNA-Polymerasen, die stumpfendige Produkte ergeben. CAPRRESI ist eine schnelle und kostengünstige Methode zur Fusion von Protein-kodierenden Genen.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Die chimäre Gen-Assemblierung wurde in der Molekularbiologie weit verbreitet, um die Proteinfunktion und / oder für biotechnologische Zwecke zu erhellen. Es gibt verschiedene Verfahren zum Fixieren von Genen, wie etwa die überlappende PCR-Produktverstärkung 1 , die Plasmidrückgewinnung 2 , die homologe Rekombination 3 , die CRISPR-Cas9-Systeme 4 , die ortsgerichtete Rekombination 5 und die Gibson-Anordnung 6 . Jeder von ihnen bietet verschiedene technische Vorteile. Zum Beispiel die Flexibilität der überlappenden PCR-Konstruktion, die in vivo Auswahl von Konstruktionen während der Plasmid-Wiedergewinnung oder die hohe Effizienz von CRISPR-Cas9- und Gibson-Systemen. Auf der anderen Seite können einige Schwierigkeiten auftreten, während einige dieser Methoden durchgeführt werden; Zum Beispiel beruhen die ersten beiden Ansätze auf stumpfendigen DNA-Fragmenten, und die Ligation dieser Art von Produkten könnte technisch anspruchsvoll im Vergleich zu Stic seinKy-ended ligation. Die ortsgerichtete Rekombination kann Spuren von zusätzlichen DNA-Sequenzen (Narben) auf dem Original hinterlassen, wie im Cre- loxP- System 5 . CRISPR-Cas9 kann manchmal auch andere Genomregionen zusätzlich zum Zielort 4 modifizieren.

Hier stellen wir eine Chimären-Assemblierung durch Plasmid-Wiedergewinnung und Restriktionsenzym-Insertion (CAPRRESI) vor, ein Protokoll zum Fixieren von Protein-kodierenden Genen, das die Plasmid-Recovery-Methode (PRM) mit der Insertion von Restriktionsenzymstellen auf Synonym-DNA-Sequenzen kombiniert, wodurch die Ligationseffizienz erhöht wird . Um die Aminosäuresequenz-Integrität zu gewährleisten, werden Restriktionsenzymstellen auf Synonym-DNA-Sequenz-Strecken eingefügt. Zu den Vorteilen von CAPPRESI gehören, dass es mit gewöhnlichen Laborreagenzien / -werkzeugen ( z. B. Enzymen, kompetenten Zellen, Lösungen und Thermocyclern) durchgeführt werden kann und dass es schnelle Ergebnisse liefern kann (wenn die entsprechenden Enzyme verwendet werden). Unter Berufung auf BeschränkungEnzym-Stellen, die aus Synonym-DNA-Sequenzen hervorgehen, können die Auswahl der exakten Fusionspunkte innerhalb der interessierenden Proteine ​​einschränken. In solchen Fällen sollten Zielgene unter Verwendung von überlappenden Oligonukleotiden fusioniert werden, und Restriktionsenzymstellen sollten auf das Resistenzgen des Vektors insertiert werden.

CAPRRESI besteht aus sieben einfachen Schritten ( Abbildung 1 ): 1) Auswahl des Klonierungsvektors, pUC18 oder pUC19 6 ; 2) bei der Silico- Analyse der zu fusionierenden Wildtyp-Sequenzen; 3) Auswahl von Bruchregionen zur Chimärenanordnung und Plasmidstörung; 4) in der Silico- Erzeugung von Synonym-DNA-Sequenzen, die Restriktionsenzymstellen enthalten; 5) unabhängiges Klonieren der Wildtyp-Gene in das ausgewählte Plasmid; 6) Plasmidstörung durch PCR, gefolgt von Restriktionsenzymverdauung; Und 7) Plasmid-Wiedergewinnung unter Verwendung von DNA-Ligation und Bakterien-Transformation. Chimäre Gene, die durch diese Technik hergestellt wurden, sollten überprüft werdenIth Sequenzierung.

Die pUC18 / 19-Vektoren bieten technische Vorteile für die Klonierung und Chimärenmontage, wie z. B. kleine Größe ( dh 2.686 Basenpaare), hohe Kopienzahl, vorteilhafte Sequenzreaktionsmerkmale und kommerzielle Verfügbarkeit 7 . Hier wurde ein Escherichia coli- Wirt verwendet, um die Chimären zu montieren und zu behandeln, weil Bakterienkulturen billig sind und schnell wachsen. Angesichts dieser Tatsache wird die anschließende Klonierung der Fusionsfragmente in die endgültigen Zielplasmide benötigt ( zB Expressionsvektoren als pRK415 in Bakterien oder pCMV in Säugetierzellen).

CAPRRESI wurde auf die Verschmelzung von zwei primären Sigma-Faktor-Genen getestet: E. colirpoD und Rhizobium etlisigA . Primäre Sigma-Faktoren sind RNA-Polymerase-Untereinheiten, die für die Transkriptionsinitiierung verantwortlich sind, und sie bestehen aus vier Domänen ( dh σ1, σ2, σ3 und σ4) 8 . Die Aminosäuresequenz lengtH von von rpoD und sigA kodierten Proteinen sind 613 bzw. 685. RpoD und SigA teilen 48% Identität (98% Deckung). Diese primären Sigma-Faktoren wurden in zwei komplementäre Fragmente zwischen den Regionen σ2 und σ3 aufgeteilt. Zwei chimäre Gene wurden nach diesem Entwurf zusammengesetzt: Chimäre 01 (RpoDσ1-σ2 + SigAσ3-σ4) und Chimäre 02 (SigAσ1-σ2 + RpoDσ3-σ4). DNA-Fusionsprodukte wurden durch Sequenzierung verifiziert.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. CAPRRESI-Protokoll

HINWEIS: Abbildung 1 stellt das gesamte CAPRRESI-Protokoll dar. Diese Technik basiert auf einem Silico- Design und dem darauffolgenden Aufbau der gewünschten Chimären.

  1. Auswahl des Klonierungsplasmids, pUC18 oder pUC19.
    1. Wählen Sie den pUC-Vektor aus, der am besten zu technischen Anforderungen passt.
      HINWEIS: Beide Vektoren haben die gleiche Sequenz, mit Ausnahme der Orientierung der multiplen Klonierungsstelle. Dies ist wichtig für die Konstruktion von Oligonukleotiden und die PCR-Plasmidstörung.
  2. In der Silico- Analyse der Wildtyp-Gene und pUC18 / 19-Sequenzen.
    1. Erhalten Sie die DNA-Sequenzen der Wildtyp-Gene und speichern Sie sie in einer FASTA-Formatdatei ( zB genes.fas).
      HINWEIS: Die Sequenzen von pUC18 / 19-Vektoren sind in der Datei pUC.fas enthalten ( Abbildung 1 , Schritt 1).
    2. Bestimmen Sie, welche Einschränkung enzYmes schneiden nicht die Wildtyp-Gene und pUC18 / 19 Sequenzen, indem sie das REsearch.pl-Skript ausführen. Alternativ können Sie eine Restriktionsenzym-Site-Suche mit einem Online-Tool durchführen ( Abbildung 1 , Schritt 2).
      1. Geben Sie Folgendes in ein Terminal ein:
        Perl REsearch.pl genes.fas
        Perl REsearch.pl pUC.fas
        HINWEIS: Diese Befehle werden die folgenden Ausgabedateien erstellen: genes_lin.fas, genes_re.fas, pUC_lin.fas und pUC_re.fas.
      2. Wählen Sie die geeigneten Restriktionsenzyme für die Klonierung der Wildtyp-Gene in die multiple Klonierungsstelle des ausgewählten pUC18 / 19-Vektors aus, indem Sie die Dateien genes_re.fas und pUC.fas vergleichen. Wählen Sie die Orientierung des Inserts relativ zum Ampicillinresistenzgen ( ampR ) des pUC18 / 19-Vektors.
    3. Entwerfen Sie Vorwärts- und Umkehr-Oligonukleotide, um die kodierende Region der Wildtyp-Gene (externe Oligonukleotide) zu amplifizieren. Füge die richtige Restriktionsenzym-Stelle an jedem 5'-Ende einDer Oligonukleotide; Damit wird die Einfügungsorientierung festgelegt.
      1. Eine funktionelle Ribosomenbindungsstelle in die vorderen Oligonukleotide einschließen.
      2. Legen Sie beide Wildtyp-Gene in die gleiche Orientierung innerhalb des Vektors ein.
  3. Auswahl der Bruchregionen zur Chimärenmontage und Plasmidstörung.
    1. Erhalten Sie die Aminosäuresequenz des Wildtyps und der Amp- Gene, indem Sie das translate.pl-Skript ausführen ( Abbildung 1 , Schritt 3).
      1. Geben Sie Folgendes in ein Terminal ein:
        Perl translate.pl genes.fas
        Perl übersetzen.pl ampR.fas

        HINWEIS: Dieses Skript erstellt die folgenden Ausgabedateien: genes_aa.fas und ampR_aa.fas.
    2. Globale Ausrichtung der beiden Wildtyp-Aminosäuresequenzen mit einer entsprechenden Software ( zB MUSCLE) 9 .
    3. Wählen Sie die gewünschten Break-Regionen (3-6 Aminosäuren) für Chimären-AsseMbly basierend auf der Sequenzausrichtung. Speichern Sie sie in eine Datei im FASTA-Format ( zB , regions.fas).
    4. Lokalisieren Sie die DNA-Sequenzen, die für die ausgewählten Aminosäure-Strecken auf beiden Wildtyp-Genen kodieren.
  4. In der Silico- Generation von Synonym-DNA-Sequenzen, die Restriktionsenzymstellen enthalten.
    1. Erhalten Sie alle Synonym-DNA-Sequenzen, die für jede Aminosäuresequenz-Strecke, die als brechende Regionen ausgewählt wurde, kodieren ( Abbildung 1 , Schritt 4); Diese Sequenzen wurden in den Regionen gespeichert.
      1. Geben Sie Folgendes in ein Terminal ein:
        Perl synonym.pl regions.fas
        HINWEIS: Dieses Skript erstellt die Ausgabedatei regions_syn.fas.
    2. Suche nach Restriktionsenzymsites auf Synonym DNA Sequenzen gefunden.
      1. Geben Sie Folgendes in ein Terminal ein: perl REsynonym.pl regions_syn.fas
        HINWEIS: Dieses Skript erstellt die Ausgabedatei regions_syn-re.fas.
    3. Wähle ein Restriktionsenzym, das zwischen Synonymsequenzen beider Wildtypgene geteilt wird; Diese Seite wird verwendet, um Chimären über Restriktionsenzym-Verdauung zusammenzusetzen. Vergewissern Sie sich, dass das gewählte Restriktionsenzym weder die Wildtyp-Gene noch die pUC18 / 19-Vektorsequenzen schneidet.
      1. Vergleichen Sie die Restriktionsenzyme, die auf den Dateien genes_re.fas, pUC_re.fas und regions_syn-re.fas gefunden wurden.
    4. In silico ersetzen die Originale für ihre Synonym-DNA-Sequenzen an den entsprechenden Loci auf beiden Wildtyp-Genen. Anfügen Synonym DNA-Sequenzen in die Wildtyp-Sequenz-Datei (genes.fas).
    5. Holen Sie sich die Aminosäuresequenz von Genen, die auf den genes.fas file ( perl translate.pl genes.fas ) enthalten sind.
    6. Ausrichten der aus Wildtyp und Synonym DNA Sequenzen übersetzten Aminosäuresequenzen. Vergewissern Sie sich, dass beide Sequenzen gleich sind.
    7. Wiederholen Sie alle Schritte dieses Abschnitts mit dem ampR- Gen, das auf der pU vorhanden istC18 / 19-Vektor.
      HINWEIS: Ziel ist es, das ampR- Gen (file ampR.fas) in zwei komplementäre Teile zu stören. Das Restriktionsenzym, das ausgewählt wurde, um das ampR- Gen zu stören, sollte sich von dem unterscheiden, das für die Chimärenanordnung verwendet wird.
  5. Unabhängiges Klonieren der beiden Wildtyp-Gene in den ausgewählten pUC18 / 19-Vektor (Abbildung 1, Schritt 3).
    1. Reinigen Sie die gewählte pUC18 / 19-Plasmid-DNA unter Verwendung eines Plasmid-DNA-Reinigungskits.
      1. Zum Beispiel transformieren Sie E. coli DH5α mit pUC18-Plasmid und wachsen die Transformanten über Nacht bei 37 ° C auf festem LB-0,3 mg / ml Ampicillin (Amp). Wählen Sie eine Transformantenkolonie, inokulieren Sie eine neue LB-0,3 mg / mL Amp-Platte und wachsen sie über Nacht bei 37 ° C.
      2. Nehmen Sie Teil der vorherigen Kultur und wachsen Sie es in flüssigem LB-0,3 mg / mL Amp für 6-8 h bei 37 ° C. Extrahieren Sie die Plasmid-DNA mit einem Kit.
    2. PCR amplifizieren Wildtyp-Gene aus der gesamten genomischen DNA unter Verwendung der AppropExterne Oligonukleotide ausführen. Verwenden Sie, wenn möglich, eine hochauflösende DNA-Polymerase. Wählen Sie die DNA-Polymerase, die die Ausbeute maximiert. Führen Sie die PCR gemäß den Richtlinien des Herstellers und der Schmelztemperatur der Oligonukleotide durch.
      1. Führen Sie PCR-Zyklen, abhängig von der DNA-Polymerase, der Amplikongröße, der Schablone und den verwendeten Oligonukleotiden. Um beispielsweise die RpoD- DNA zu amplifizieren, wird eine 50 & mgr; l Reaktion: 5 & mgr; l 10 × Puffer, 2 & mgr; l 50 mM MgSO 4 , 1 & mgr; l 10 mM dNTP-Mischung, 2 & mgr; l jedes 10 & mgr; M Oligonukleotids (Tabelle 2), 2 hergestellt & Mgr; l der Matrizen-DNA ( E. coli DH5 & agr; Gesamt-DNA), 35,8 & mgr; l ultrareines Wasser und 0,2 & mgr; l hochflexible DNA-Polymerase. Führen Sie die folgenden PCR-Zyklen aus: 1 min bei 94 ° C für die anfängliche Denaturierung, gefolgt von 30 Zyklen der Amplifikation (30 s bei 94 ° C bis denaturieren, 30 s bei 60 ° C, um die Oligonukleotide zu glühen, und 2 min bei 68 ° C erweitern).
      2. Lösen 1,2 gAgarose in 100 ml doppelt destilliertem Wasser durch Erhitzen in der Mikrowelle. Montieren Sie ein Gel-Tablett und kämmen Sie sie und legen Sie sie in die horizontale Gel-Zaubernden. Füllen Sie das Gel Tablett mit der geschmolzenen Agarose-Lösung und lassen Sie es verfestigen. Kamm entfernen
      3. Legen Sie das Gel in die Elektrophoresekammer. Füllkammer mit 1x Tris-Acetat-EDTA-Puffer 50 μl PCR-Produkte in die Gel-Vertiefungen geben. Elektrophorese die Proben ( z . B. bei 110 V für 1 h).
      4. Nach der Elektrophorese färben Sie das Gel in 100 ml doppelt destilliertem Wasser, das 100 μl 1 mg / ml Ethidiumbromidlösung für 10 min mit langsamem Schütteln enthält. Waschen Sie das Gel in doppelt destilliertem Wasser für weitere 10 Minuten in langsamen Schütteln; Verwenden Sie einen horizontalen Shaker.
        Achtung: Ethidiumbromid ist eine toxische Verbindung; Tragen Schutzhandschuhe und ein Baumwoll-Laborkittel.
      5. Reinigen Sie Wildtyp-Gen-DNA aus den entsprechenden Banden des Gels unter Verwendung eines Kits. Visualisieren Sie die Bänder, indem Sie das gefärbte Gel in eine UV-Kammer stellen (Empfohlene Wellenlänge: 300 nm). Halten Sie die Exposition des Gels auf ein Minimum. Verwenden Sie ein DNA-Reinigungskit und folgen Sie den Anweisungen des Herstellers.
        Achtung: UV-Strahlung ist gefährlich; Tragen einen Schutzschild, eine Brille und einen Baumwoll-Laborkittel.
    3. Digest gereinigte Wildtyp-Gene und pUC18 / 19-Plasmid-DNA mit den Restriktionsenzymen gemäß den Anweisungen des Herstellers. Verwenden Sie schnell Verdauungsenzyme, wenn möglich. Zum Beispiel werden 6 & mgr; l pUC18-DNA (300 ng / & mgr; l) in 10 & mgr ; l ultrareines Wasser, 2 & mgr ; l 10 × Puffer, 1 & mgr ; l Kpn I-Restriktionsenzym und 1 & mgr ; l Xba I-Restriktionsenzym verdaut . Die Reaktion bei 37 ° C für 30 min ablassen.
      1. Inaktivieren Sie die Restriktionsenzyme gemäß den Richtlinien des Herstellers. Zum Beispiel wird die Doppelverdauungsreaktion Kpn I- Xba I bei 80 ° C für 5 min inaktiviert.
    4. Mischen Sie den Einsatz: Vektor-DNA bei einer volumetrischen RatiO von 3: 1. Befolgen Sie die Anweisungen des Herstellers für eine Ligationsreaktion. Benutzen Sie schnell Ligationsenzyme, wenn möglich (lassen Sie die Reaktion bei 25 ° C für 10 min).
      HINWEIS: In der Regel ist die DNA-Konzentration nach der Reinigung unter Verwendung der Kits gut genug für die Verdauung und Ligationsreaktionen. Zum Beispiel fügen Sie 6 μl rpoD DNA ( Kpn I- Xba I, 150 ng / μL), 3 μl pUC18 DNA ( Kpn I- Xba I, 150 ng / μL), 10 μl 2x Puffer, 1 μl hochreines, hinzu Wasser und 1 & mgr; l T4-DNA-Ligase. Lassen Sie die Ligationsreaktion bei 25 ° C für 10 min.
    5. Verwandeln Sie das E. coli DH5 & agr; mit 2-4 & mgr; l der Ligationsreaktion, wie in den ergänzenden Materialien beschrieben. Stellen Sie die transformierten Zellen in feste LB / Amp / X-gal / IPTG-Platten. Lassen Sie die Teller über Nacht bei 37 ° C.
    6. Wählen Sie weiß gefärbte Transformanten E. coli Kolonien und streifen sie auf eine neue LB / Amp Platte. Lassen Sie die Teller über Nacht bei 37 ° C/ Li>
    7. Führen Sie eine Kolonie-PCR, um Kandidaten für die Sequenzierung der Reaktion zu wählen, wie in den ergänzenden Materialien beschrieben. Extrakt Plasmid-DNA aus Kandidaten. Alternativ, Digest-Kandidaten-Plasmid-DNA mit den gleichen Restriktionsenzymen, die für die Klonierung der Inserts verwendet wurden.
    8. Sequenzkandidatenkonstruktionen mit einem Sequenzdienstleister 10 . Montieren Sie die Sequenz in Silico unter Verwendung eines DNA-Assemblers 11 ( Abbildung 1 , Schritt 5).
  6. Plasmidstörung durch PCR, gefolgt von Restriktionsenzymverdauung.
    1. Design in Silico- Vorwärts- und Reverse-Oligonukleotiden an Bruchregionen für Wildtyp- und AmpR- Gene. Ersetzen Sie in silico das Wildtyp-Fragment für seine entsprechende Synonym-DNA-Sequenz (erhalten in Schritt 1.4).
      HINWEIS: Diese Synonym-DNA-Sequenz enthält eine Restriktionsenzym-Site. Vorwärts- und umgekehrte Oligonukleotide überlappen bei tEr Restriktionsenzym-Stelle. Oligonukleotide sollten von 21-27 Nukleotiden reichen, mit einem Cytosin oder Guanin enden und eine Restriktionsenzym-Stelle enthalten. Ein Vorwärts-Oligonukleotid hat die gleiche Sequenz wie seine Zielregion auf der Matrizen-DNA. Ein umgekehrtes Oligonukleotid ist die umgekehrte komplementäre Sequenz des Zielbereichs auf der Matrizen-DNA.
    2. Verwenden Sie die beiden Wildtyp-Genkonstruktionen als DNA-Matrize für PCR-Reaktionen ( zB pUC18 rpoD und pUC18 sigA ). Erhalten Sie zwei komplementäre Teile jeder Konstruktion (pUC18 rpoD σ1-σ2, pUC18 rpoD σ3-σ4, pUC18 sigA σ1-σ2 und pUC18 sigA σ3-σ4) ( Abbildung 1 , Schritt 6).
    3. Laden Sie DNA-Proben in ein Agarosegel 1-1.2% [w / v]. Trennen Sie die PCR-Produkte aus der DNA-Matrize durch Elektrophorese ( zB 110 V für 1 h). Alternativ, verdauen Sie die PCR-Reaktionen mit Dpn I, um die DNA-Vorlage zu brechen.
      HINWEIS : DpnI-Enzym erkennt nur methylierte DNA-Sequenzen (5'-GATC-3 ').
      1. Reinigen Sie die Proben mit einem DNA-Reinigungskit. Befolgen Sie die Richtlinien des Herstellers.
    4. Verdoppeln Sie alle komplementären DNA-Fragmente mit den entsprechenden Restriktionsenzymen gemäß den Anweisungen des Herstellers. Verwenden Sie schnell-digest Restriktionsenzyme, wenn möglich. Zum Beispiel verdoppeln Sie das pUC18rpoDσ1-σ2-DNA-Fragment mit Afl II und Spe I mit dem Protokoll des Herstellers. Die Verdauungsreaktion bei 37 ° C für 15 min ablassen.
    5. Inaktivieren Sie die Restriktionsenzyme gemäß den Richtlinien des Herstellers. Zum Beispiel wird Afl II- Spe I bei 80 ° C für 20 min inaktiviert.
  7. Plasmidrückgewinnung unter Verwendung von DNA-Ligation und bakterieller Transformation.
    1. Mischen Sie die richtigen DNA-Fragmente in einem volumetrischen 1: 1-Verhältnis, um das gewünschte chimäre Gen zusammenzusetzen ( Abb1, Schritt 7).
      HINWEIS: Auf diese Weise wird die Integrität des ampR- Gens wiederhergestellt, wodurch ein funktionelles Protein erzeugt wird.
      1. Zum Beispiel werden 4 μl pUC18 rpoD σ1-σ2 DNA (verdaut mit Afl II- Spe I, 150 ng / μL), 4 μl pUC18 sigA σ3-σ4 DNA ( Afl II- Spe I, 150 ng / μL) 10 & mgr; l 2 × Puffer, 2 & mgr; l ultrareines Wasser und 1 & mgr; l T4-DNA-Ligase; Die DNA-Konzentration nach der Kit-Reinigung ist gut genug für die Verdauung und die anschließende Ligation. Lassen Sie die Ligationsreaktion bei 25 ° C für 10 min.
    2. Transformieren Sie E. coli DH5 & agr; mit 3-5 & mgr; l der Chimärenanordnung Ligationsreaktion (Ergänzungsmaterialien). Die Transformanten in LB / Amp / X-gal / IPTG-Platten über Nacht bei 37 ° C über Nacht wachsen lassen.
    3. Wählen Sie weiß gefärbte Transformanten E. coli Kolonien und streifen sie auf eine neue LB / Amp Platte. Lassen Sie die Teller über Nacht bei 37° C
    4. Führen Sie eine Kolonie-PCR aus, um Kandidaten für eine Sequenzierungsreaktion auszuwählen, wie in den ergänzenden Materialien beschrieben. Visualisierung von Banden in einem 1: 2% (w / v) Agarosegel durch Durchführung der Elektrophorese (beschrieben in Schritt 2.3.2.1).
    5. Wachsen Kulturen von positiven Kandidaten. Extrahieren Sie Plasmid-DNA aus ihnen unter Verwendung eines Plasmid-DNA-Reinigungskits.

2. Sequenzkandidaten Chimäre Konstruktionen

  1. Stellen Sie sicher, dass die Qualität der Plasmid-DNA für die Sequenzierungsreaktion gut genug ist, indem Sie Richtlinien des Sequenzdienstanbieters befolgen. Extrahieren von DNA unter Verwendung von Reinigungskits. Zum Beispiel, auf der Internetseite des Sequenzdienstleisters, besonderes Augenmerk auf die empfohlene DNA-Konzentration für die Proben. Erhalten Sie die Konzentration der Proben mit einem DNA-Quantifizierungsinstrument.
  2. Sequenzkandidaten chimäre Konstruktionen mit einem Sequenzierungsdienstleister 10 .
  3. Montieren se Quencing liest mit einem in silico DNA assembler 11 .
  4. Ausgerichtet versus in silico- entworfenen chimären Sequenzen unter Verwendung von Sequenz-Ausrichtungswerkzeugen 9 , 12 . Vergewissern Sie sich, dass das chimäre Gen erfolgreich verschmolzen wurde.

3. Vorbereitung machen

HINWEIS: Alle Schritte, die lebende Zellen beinhalten, sollten in einer sauberen laminaren Strömungshaube mit dem Bunsenbrenner durchgeführt werden.

  1. Herstellung von E. coli DH5α-kompetenten Zellen.
    1. Um E. coli- kompetente Zellen zu produzieren, folgen den veröffentlichten Protokollen 13 oder sehen die Ergänzungsmaterialien . Alternativ verwenden Sie handelsübliche, kompetente Zellen.
  2. Transformieren von E. coli DH5α-kompetenten Zellen.
    1. Für die chemische Umwandlung von E. coli- Kulturen folgen die veröffentlichten ProtokolleClass = "xref"> 13 oder siehe Ergänzungsmaterialien . Alternativ kann man Elektroporation zur Bakterienumwandlung verwenden. Wenn handelsübliche kompetente Zellen verwendet werden, folgen Sie den Richtlinien des Herstellers.
  3. Reinigende Genom- und Plasmid-DNA aus E. coli DH5α.
    1. Führen Sie die Nucleinsäureextraktion, wie in den Ergänzungsmaterialien angegeben , unter Verwendung von handelsüblichen Kits oder nach veröffentlichten Protokollen 13 durch .
  4. Führen Sie Kolonie PCR.
    1. Verwenden Sie diese Technik, um Kandidaten-Transformanten-Kolonien für die nachfolgende Sequenzierungsreaktion zu identifizieren.
      HINWEIS: Diese Methode stellt keine abschließende Überprüfung der Integrität der Sequenzen dar. Eine detaillierte Beschreibung dieser Technik gibt es in den Ergänzungsmaterialien .
  5. Vorbereitung der Lösungen.
    1. Sehen
  6. Laden Sie die für das CAPRRESI-Protokoll benötigten Skripts und Sequenzdateien herunter.
    1. Laden Sie Genbank-Dateien mit der vollständigen Genomsequenz der gewünschten Spezies, extrahieren Sie die DNA-Sequenz des ausgewählten Gens mit einem Genom-Browser und speichern Sie sie im Fasta-Dateiformat. Laden Sie die für das CAPRRESI-Protokoll benötigten Perl-Skripte herunter. Speichern Sie die Scripts und die Sequenzdateien im selben Verzeichnis.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Abbildung 1 zeigt CAPRRESI. Unter Verwendung dieses Verfahrens wurden zwei chimäre Gene durch Austausch der Domänen von zwei bakteriellen primären Sigma-Faktoren ( dh E. coli RpoD und R. etli SigA) zusammengesetzt. Die DNA-Sequenzen der rpoD- und sigA- Gene wurden unter Verwendung des Artemis Genome Browser 14 aus den GenBank-Genom-Dateien NC_000913 bzw. NC_007761 erhalten. Die DNA-Sequenz des pUC18-Vektors wurde aus der Nukleotid-Datenbank des NCBI-Servers erhalten. In Silico- Analysen von Restriktionsenzymstellen wurden auf DNA-Sequenzen durch Ausführen des REsearch.pl Perl-Skripts durchgeführt (siehe Schritt 1.2.2). Diese Ergebnisse wurden für die Oligonukleotid-Konstruktion verwendet (Schritt 1.2.3). Externe Oligonukleotide enthielten Erkennungsstellen für XbaI- und KpnI- Restriktionsenzyme, um Wildtyp-Gene in die pUC18-multiple Klonierungsstelle zu klonieren. Das Vorwärts-Oligonukleotid enthielt auch ein RiboEinige Bindungsstelle ( Tabelle 2 ). Genomische DNA wurde aus E. coli- DH5 & agr; -Zellen extrahiert, die in LB / Nal-Brühe (37 ° C, 220-250 U / min) und R. etli CFN42-Zellen, die in PY / Nal / CaCl 2 -Grie (30 ° C, 220-250 U / min) ). Diese Proben wurden als DNA-Matrizen für die Wildtyp-Genamplifikation verwendet (Schritt 1.5.2).

Wildtyp-Gene wurden unter Verwendung einer Taq- High-Fidelity-DNA-Polymerase amplifiziert, die aus Agarosegelen (DNA-Reinigungskit) gereinigt, mit KpnI- XbaI- Restriktionsenzymen verdoppelt und in den pUC18-Vektor kloniert wurde. Chemisch kompetente E. coli DH5α-Zellen wurden mit 5 μl der Ligationsreaktion entsprechend den Wildtyp-Konstruktionen pUC18 rpoD und pUC18 sigA (Schritt 1.5.5) transformiert. Transformante Zellen wurden auf festen LB / Amp / X-gal / IPTG-Platten, die bei 37 ° C gezüchtet wurden, ausgewählt. Wildtyp-Konstruktionen wurden durch Sanger-Sequenz überprüft10 . Sanger Sequenz liest sich in Silico zusammengebaut mit MIRA 11 (Schritt 1.5.8).

Aminosäuresequenzen aus Wildtyp-Genen wurden durch Ausführen des translate.pl-Skripts erhalten (Schritt 1.3.1). Nach dem Ausrichten von Wildtyp-Genen mit Clustal 12 wurden die Aminosäure-Regionen TLV und NLR auf dem Ampicillin-Resistenzgen ( ampR ) bzw. den Wildtyp-Primär-Sigma-Faktoren ausgewählt (Schritt 1.3.3). Diese Aminosäure-Regionen wurden für die Berechnung aller möglichen DNA-Synonym-Sequenzen verwendet, die sie codieren, indem sie das synonym.pl-Skript ausführen (Schritt 1.4.1). Das REsynonym.pl-Skript suchte nach Restriktionsenzymsites, die auf den zuvor erzeugten Synonym-DNA-Sequenzen gefunden wurden (Schritt 1.4.2). Die Synonymregionen, die die niedrigste Anzahl von Änderungen im Vergleich zu den Wildtypsequenzen eingeführt haben, wurden ausgewählt. Für die primären Sigma-Faktor-Gene sind Wildtyp-Sequenzen von RpOD (AACTTACGT) und SigA (AACCTTCGC) wurden gegen AA CTTAAG G ausgetauscht . Letzteres enthielt eine Afl II-Stelle (fett). Für das ampR- Gen wurde die Wildtyp-Sequenz ACGCTGGTG gegen ihr Synonym AC ACTAGT G ausgetauscht . Die Synonym-DNA-Sequenz, die in das ampR- Gen insertiert wurde, enthielt eine Spe I-Stelle (fett). Die in Silico- Substitution des Wildtyps für die entsprechenden Synonym-Sequenzen wurden durchgeführt, um die Sequenzintegrität und das Oligonukleotid-Design zu überprüfen (Schritte 1.2-1.4).

Synonym-Sequenzänderungen wurden durch PCR unter Verwendung der entsprechenden Oligonukleotide ( Tabelle 2 ) und Wildtyp-Konstruktionen als DNA-Matrizen eingeführt (Schritt 1.5.2). Amplifikationsreaktionen erzeugten vier komplementäre Teile: pUC18 rpoD σ1-σ2, pUC18 rpoD σ3-σ4, pUC18 sigA σ1-σ2 und pUC18 sigA σ3-σ4. Die komplementären Teile disNicht nur Sigma-Faktoren, sondern auch die ampR- Gene. Ergänzende Teile wurden mit einem DNA-Reinigungskit gereinigt (Schritt 1.6.3).

Diese komplementären DNA-Fragmente wurden mit AflII- und SpeI- Restriktionsenzymen doppelt verdaut (Schritt 1.6.4). Nach dem CAPRRESI-Design wurden die DNA-Fragmente pUC18 rpoD σ1-σ2 mit pUC18 sigA σ3-σ4 ligiert, um die Chimäre 01 zu erhalten, und pUC18 sigA σ1-σ2 wurde mit pUC18 rpoD σ3-σ4 ligiert, um die Chimäre 02 zu bilden (Schritte 1.7.1-1.7 .3). Chemisch kompetente E. coli DH5α-Zellen wurden mit 5 μl der Ligationsreaktion von pUC18 chim01 und pUC18 chim02 transformiert (Schritt 1.7.4). Transformante Zellen wurden auf festen LB / Amp / X-gal / IPTG-Platten ausgewählt, die bei 37 ° C gezüchtet wurden (Schritt 1.7.5). Chimäre Konstruktionen wurden durch Sanger-Sequenzierung 10 (Schritt 2) verifiziert. Sangerfolge rEads wurden mit MIRA 11 zusammengebaut , und die resultierenden Dateien sind in Tabelle 3 aufgelistet. Fig. 2 zeigt die Ausrichtungen (durchgeführt unter Verwendung von MUSCLE) 9 von zusammengesetzten Sequenzen von Wildtyp- und chimären Genen in brechenden Regionen.

Abbildung 1
Abbildung 1: CAPRRESI-Übersicht. Darstellungen: Gene (dicke Pfeile), funktionelle Plasmide (geschlossene Kreise) und Oligonukleotide (dünne, schwarz markierte Pfeile). In Oligonukleotide eingefügte Restriktionsenzymstellen erscheinen in Farben. Abkürzungen: Wt (Wildtyp), FWD (Vorwärts-Oligonukleotid), REV (Reverse-Oligonukleotid), AmpR (Ampicillin-Resistenzgen), RES (Restriktionsenzym-Stelle), RE (Restriktionsenzym). Bitte klicken Sie hier, um eine größere Versi zu sehenVon dieser Figur.

Figur 2
Abbildung 2: Ausrichtung von zusammengesetzten Wildtyp- und chimären Gensequenzen. Zusammengesetzte DNA-Sequenzen wurden mit MUSCLE 9 ausgerichtet . Sequenzen wurden mit MIRA 11 zusammengebaut . Synonym-Sequenzen erscheinen in schwarz. Die Afl II-Erkennungsstelle wird unterstrichen. IUPAC-Nukleotid-Code: R (A oder G) und K (G oder T). Konstruktionen: rpoD (rot), sigA (blau), Chimäre 01 Sequenz ( rpoD σ1 - σ2 - sigA σ3 - σ4) und Chimäre 02 Sequenz ( sigA σ1 - σ2 - rpoD σ3 - σ4). Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

Lösung Komponenten Anleitung
Anzahl Verbindung
Luria-Bertani (LB) Brühe 5 g Hefeextrakt Alle Komponenten in Wasser auflösen. Autoklav Lagerung bei Raumtemperatur bis zum Gebrauch. Für feste LB-Brühe fügen Sie dem Rezept 15 g bakteriologischer Agar hinzu.
10 g Casein-Pepton
10 g NaCl
Bis zu 1 l Doppelt destilliertes Wasser
LB / Amp / X-gal / IPTG Platten 100 ml Geschmolzene feste LB-Brühe Füge alle Komponenten der temperierten LB-Brühe hinzu. Füllen Sie Petrischalen und warten Sie, bis sie sich verfestigen. Führen Sie Schritte in einer sauberen laminaren Strömungshaube mit dem Bunsenbrenner an.
100 & mgr; l Ampicillin (Ampere) [100 mg / ml]
100 & mgr; l X-gal [20 mg / ml]
50 & mgr; l 1 M IPTG Lösung
Pepton-Hefe (PY) Brühe 3 g Hefeextrakt Alle Komponenten in Wasser auflösen. Autoklav Lagerung bei Raumtemperatur bis zum Gebrauch. Für feste PY-Brühe fügen Sie dem Rezept 15 g bakteriologischer Agar hinzu. Für die R. etli-Kultur werden vor der Verwendung 700 μl 1 M CaCl 2 -Lösung zugegeben.
5 g Casein-Pepton
Bis zu 1 l Doppelt destilliertes Wasser
PY / CaCl 2 / Nal-Platten 100 ml Geschmolzene feste PY-Brühe Füge alle Komponenten zu temperieren PY Brühe. Füllen Sie die Petrischalen und warten Sie, bis sie sich verfestigen. Führen Sie Schritte in einer sauberen laminaren Strömungshaube mit dem Bunsenbrenner an.
700 & mgr; l 1 M CaCl 2 -Lösung
100 & mgr; l Nalidixinsäure (Nal) [20 mg / ml]
1 M Calciumchlorid (CaCl 2 ) -Lösung 11,1 g CaCl & sub2; CaCl 2 in Wasser auflösen. Autoklav Bei Raumtemperatur lagern.
Bis zu 100 mL Doppelt destilliertes Wasser
Tris-EDTA (TE) 10: 1 pH 8,0 1 mL 1 M Tris-Lösung Alle Komponenten mischen. Autoklav Bei Raumtemperatur lagern.
400 & mgr; l 0,25 M EDTA-Lösung
Bis zu 100 mL Doppelt destilliertes Wasser
TE 50:20 pH 8,0 5 ml 1 M Tris-Lösung Alle Komponenten mischen. Autoklav Bei Raumtemperatur lagern/ Td>
8 ml 0,25 M EDTA-Lösung
Bis zu 100 mL Doppelt destilliertes Wasser
TE 10: 1 10 mM NaCl-Lösung 58,4 mg NaCl NaCl in TE 10: 1 auflösen. Autoklav Bei Raumtemperatur lagern.
Bis zu 100 mL TE 10: 1 pH 8,0 Lösung
Lyse-Lösung I 80 mg Lysozym Alle Komponenten in Wasser auflösen und mischen. Filter sterilisieren mit einem 0,22 μm Filter. Bei Raumtemperatur lagern.
2 ml 0,5 M Glucoselösung
400 & mgr; l 0,5 M EDTA-Lösung
500 & mgr; l 1 M Tris-Lösung
Bis zu 20 mL Sterilisiertes, doppelt destilliertes Wasser
Lyse-Lösung II 1,2 ml 5 M Natriumhydroxid (NaOH) -Lösung Alle Komponenten in Wasser auflösen. Filter sterilisieren mit einem 0,22 μm Filter. Bei Raumtemperatur lagern.
3 ml 10% Natriumdodecylsulfat (SDS) -Lösung
Bis zu 30 mL Sterilisiertes, doppelt destilliertes Wasser
Lyse-Lösung III 29,4 g Kaliumacetat (CH & sub3; COOK) Alle Komponenten in Wasser auflösen und mischen. Filter sterilisieren mit einem 0,22 μm Filter. Bei Raumtemperatur lagern.
11,5 ml Absolute Essigsäure (CH & sub3; COOH)
Bis zu 100 mL Sterilisiertes, doppelt destilliertes Wasser
1 M Magnesiumchlorid (MgCl & sub2;) Lösung 9,5 g MgCl & sub2; MgCl 2 in w lösenAter Autoklav Bei Raumtemperatur lagern.
Bis zu 100 mL Doppelt destilliertes Wasser
3 M Natriumacetat (CH & sub3; COONa) -Lösung 24,6 g CH 3 COONa CH 3 COONa in Wasser auflösen. Autoklav Bei Raumtemperatur lagern
Bis zu 100 mL Doppelt destilliertes Wasser
10% SDS-Lösung 10 g SDS SDS in Wasser mit einem Magnetrührstab bei niedriger Geschwindigkeit auflösen. Autoklav Bei Raumtemperatur lagern.
Bis zu 100 mL Doppelt destilliertes Wasser
3 M CH 3 COOK Lösung 29,4 g CH 3 KOCH CH 3 COOK in Wasser auflösen. Filter sterilisieren mit einem 0,22 μm Filter. Bei Raumtemperatur lagern. Bis zu 100 mL Sterilisiertes, doppelt destilliertes Wasser
Proteinase K-Lösung 5 mg Proteinase K Auflösen der Proteinase K in TE 50:20 Lösung. Hitze bei 37 ºC für 1 h. Bei -20 ºC aufbewahren.
Bis zu 1 mL TE 50:20 pH 8,0 Lösung
RNase-Lösung 10 mg RNase RNase in Wasser auflösen. Bei 95 ºC für 10 min erhitzen. Bei -20 ºC aufbewahren.
Bis zu 1 mL Sterilisiertes Reinstwasser
1 M Isopropyl-β-D-thiogalactosid (IPTG) -Lösung 238,3 mg IPTG IPTG in Wasser auflösen. Filter sterilisieren mit einem 0,22 μm Filter. Bei -20 ºC aufbewahren.
Bis zu 1 mL Sterilisiertes Reinstwasser
20 mg X-gal X-gal in Wasser auflösen. Filter sterilisieren mit einem 0,22 μm Filter. Bei -20 ºC aufbewahren.
Bis zu 1 mL Sterilisiertes Reinstwasser
Phenol: Chloroform: Isoamylalkohol 24: 24: 1 Lösung 24 ml Phenol Alle Komponenten mischen. In einer bernsteinfarbenen Flasche bei 4 ºC aufbewahren. VORSICHT! Gefahrgut. Schutzbrille, Handschuhe und Baumwoll-Laborkleid tragen. Verwenden Sie eine Abzugshaube. NICHT den Bunsenbrenner oder eine andere Feuerquelle während der Handhabung einschalten. Alternative: handelsübliches Phenol verwenden: Chloroform: Isoamylalkohol 25: 24: 1 Lösung
24 ml Chloroform
1 mL Isoamylalkohol
0,5 M Glucoselösung 9 g GLucose Glukose in Wasser auflösen. Filter sterilisieren mit einem 0,22 μm Filter. Bei Raumtemperatur lagern.
Bis zu 100 mL Sterilisiertes Reinstwasser
0,5 M Ethylendiamintetraessigsäure (EDTA) pH 8,0 Lösung 14,6 g EDTA EDTA in Wasser auflösen. PH mit 5 M NaOH-Lösung einstellen. Autoklav Bei Raumtemperatur lagern.
Bis zu 100 mL Doppelt destilliertes Wasser
0,25 M EDTA pH 8,0 Lösung 7,3 g EDTA EDTA in Wasser auflösen. PH mit 5 M NaOH-Lösung einstellen. Autoklav Bei Raumtemperatur lagern.
Bis zu 100 mL Doppelt destilliertes Wasser
1 M Tris pH 8,0 Lösung 12,1 g Tris Tris in Wasser auflösen. Stellen Sie den pH-Wert mitAbsolute Salzsäure (HCl). Autoklav Bei Raumtemperatur lagern.
Bis zu 100 mL Doppelt destilliertes Wasser
5 M Natriumhydroxid (NaOH) -Lösung 19,9 g NaOH NaOH in Wasser auflösen. Bei Raumtemperatur lagern. VORSICHT! Ätzmittel.
Bis zu 100 mL Sterilisiertes, doppelt destilliertes Wasser
0,1 M NaOH-Lösung 399 mg NaOH NaOH in Wasser auflösen. Bei Raumtemperatur lagern.
Bis zu 100 mL Sterilisiertes, doppelt destilliertes Wasser
Nalidixinsäure (Nal) Stammlösung 60 mg Nalidixinsäure Nal in Wasser auflösen. Filter sterilisieren mit einem 0,22 μm Filter. Bei 4 ºC aufbewahren.
Bis zu 3 mL 0,1 MNAOH-Lösung
Ampicillin (Amp) Stammlösung 300 mg Ampicillin Amp in Wasser auflösen. Filter sterilisieren mit einem 0,22 μm Filter. Bei 4 ºC aufbewahren.
Bis zu 3 mL Sterilisiertes, doppelt destilliertes Wasser
10x Tris-acetat-EDTA-Puffer 48,4 g Tris Alle Komponenten in Wasser auflösen. Autoklav Bei Raumtemperatur lagern.
20 ml 0,5 M EDTA-Lösung
11,44 ml Eisessig
Bis zu 1 l Doppelt destilliertes Wasser

Tabelle 1: Lösungsvorbereitung. Anleitung zur Lösungsvorbereitung.

Nein. Code Sequenz Länge (nt) Eigenschaften
1 RpoD-FWD GC TCTAGA GA AGGAGA TATCATATGGAGCAAAACCCGCAGTCA 43 XbaI- Stelle; Wildtyp-Gen-Amplifikation und Vektor-Klonierung
2 RoD-REV GG GGTACC TTAATCGTCCAGGAAGCTACG 29 KpnI- Stelle; Wildtyp-Gen-Amplifikation und Vektor-Klonierung
3 SigA-FWD GC TCTAGA GA AGGAGA TATCATATGGCAACCAAGGTCAAAGAG 43 XbaI- Stelle; Wildtyp-Gen-Amplifikation und Vektor-Klonierung
4 SigA-REV GG GGTACC TTAGCTGTCCAGAAAGCTTCT </ Td> 29 KpnI- Stelle; Wildtyp-Gen-Amplifikation und Vektor-Klonierung
3 AmpR-FWD AC ACTAGT GAAAGTAAAAGAT 21 SpeI- Seite eingefügt, Synonym-Mutation. Störung des ampR- Gens
4 AmpR-REV TC ACTAGT GTTTCTGGGTGAG 21 SpeI- Seite eingefügt, Synonym-Mutation. Störung des ampR- Gens
5 Σ2RpoD-FWD AA CTTAAG GCTGGTTATTTCTATCGCT 27 AflII- Seite eingefügt, Synonym-Mutation. Bau von chim01-02
6 Σ2RpoD-REV GC CTTAAG TTCGCTTCAACCATCTCTT 27 AflII- Seite eingefügt, Synonym-Mutation. Bau von chim01-02
7 Σ2SigA-FWD AA CTTAAG GCTCGTCATTTCAATCGCC 27 AflII- Seite eingefügt, Synonym-Mutation. Bau von chim01-02
8 Σ2SigA-REV GC CTTAAG TTCGCTTCGACCATTTCCT 27 AflII- Seite eingefügt, Synonym-Mutation. Bau von chim01-02

Tabelle 2: Oligonukleotidsequenzen. Restriktionsenzymstellen werden unterstrichen. Ribosomenbindungsstelle: fett.

Bau Sequenzdatei Qualitätsdatei
Chimera01 Chim01_out.unpadded.fasta Chim01_out.unpadded.fasta.qual
Chim01_A3 / B3 / E2 / F2 / G2 /H2.pdf
Chimera02 Chim02_out.unpadded.fasta Chim02_out.unpadded.fasta.qual
Chim02_C3 / D3 / E3 / F3 / G3 / H3.pdf
RpoD Rpod_out.unpadded.fasta Rpod_out.unpadded.fasta.qual
SigA Siga_out.unpadded.fasta Siga_out.unpadded.fasta.qual

Tabelle 3: Sequenzdateien, die mit dem MIRA-Assembler und dem DNA-Sequenzer erhalten wurden. Sanger Sequenzierung liest aus chimären und Wildtyp-Konstruktionen wurden mit MIRA 11 Software mit der Mapping-Option zusammengestellt. Chromatogramme der chimären Sequenzierung erscheinen als PDF-Dateien.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

CAPRRESI wurde als Alternative zum PRM 2 konzipiert . Die ursprüngliche PRM ist eine leistungsfähige Technik; Es ermöglicht die Verschmelzung von DNA-Sequenzen entlang eines beliebigen Teils der ausgewählten Gene. Für PRM sollten Wildtyp-Gene in das gleiche Plasmid kloniert werden. Danach werden Oligonukleotide innerhalb von Wildtyp- und Antibiotika-Resistenzgenen, die auf dem Plasmid gefunden wurden, entworfen. Die Plasmidstörung wird durch PCR unter Verwendung von stumpfendigen, hochauflösenden DNA-Polymerasen und zuvor entworfenen Oligonukleotiden erreicht. Die Ligation von komplementären PCR-Produkten setzt chimäre Gene ein und stellt die Antibiotika-Resistenzkassette wieder her, was zu einer funktionellen Plasmidrückgewinnung führt. PRM ermöglicht den Aufbau chimärer Genbibliotheken auf demselben Plasmidhintergrund. Leider könnte die Ligation von stumpfendigen DNA-Sequenzen technisch anstrengend sein. Die Chimärenanordnung durch überlappende PCR-Fragmente 1 erfordert auch, dass DNA-Polymerasen stumpfendige Produkte liefern undDNA-Reinigung für jede Reaktion. Die chimären Gene, die durch diese Technik zusammengesetzt sind, sind lineare DNA-Produkte. Das Klonen jeder Konstruktion in den Zielvektor könnte eine weitere Analyse verzögern.

CAPRRESI profitiert von vielen Stärken von PRM und vereinfacht auch die Ligation komplementärer DNA-Fragmente unter Verwendung von Restriktionsenzymstellen auf Synonym-DNA-Sequenzregionen. Aus diesen Gründen erfordert CAPRRESI keine stumpfendigen DNA-Polymerasen. Die Verwendung von Synonym-DNA-Sequenzen beschränkt Fusionsstellen für die Chimären-Assembly, erhöht aber die Ligationseffizienz. Eine weitere wichtige Modifikation, die in CAPRRESI eingeführt wird, ist, dass Chimären in pUC18 / 19-Vektoren zusammengebaut und behandelt werden. Diese Vektoren besitzen, wie bereits erwähnt, mehrere vorteilhafte Merkmale. Chimäre DNA konnte durch Vermehrung des Konstruktionsvektors in E. coli- Wirten erhalten werden. Die anschließende Klonierung von chimären Genen in das endgültige Plasmid ( z . B. ein Expressionsvektor) ist manchmalerforderlich.

CAPRRESI beruht auch auf der Silico- Handhabung von DNA- und Aminosäuresequenzen. Ad-hoc- Perl-Skripte ermöglichen die Auswahl der geeigneten Restriktionsenzyme, um Wildtyp-Gene zu klonieren, die Berechnung aller Synonym-DNA-Sequenzen, die den Break-Regionen entsprechen (für die Chimären-Assemblierung) und die Identifizierung von Restriktionsenzymen zur Vereinfachung der Plasmid-Wiedergewinnung. Unter diesen Bedingungen ist CAPRRESI eine Alternative zum Fixieren von Protein-kodierenden Genen. Kritische Schritte des CAPRRESI-Protokolls sind: 1) die Auswahl der brechenden Regionen und 2) die Reinigung von PCR-Produkten. Brechende Regionen sind Strecken, wo Synonymsequenzen berechnet werden, wodurch Restriktionsenzymstellen erzeugt werden, die auf Wildtypsequenzen nicht gefunden werden. Die Verwendung von Restriktionsenzymstellen für die Chimärenanordnung eliminiert die Notwendigkeit von DNA-Polymerasen, die stumpfendige Produkte ergeben und die Ligationsreaktion erleichtert. Nicht alle Regionen haben nutzbare Restriktionsenzymstellen; FoAus diesem Grund empfiehlt es sich, die Bruchregionen um eine Aminosäure zu einer Zeit zu bewegen, bis die beste Sequenzdehnung gefunden wird. Wenn das in Silico- Design die Bewegung der brechenden Regionen nicht zulässt oder die Sequenzstrecken keine Synonym-DNA-Sequenzen mit geeigneten Restriktionsenzymstellen aufweisen, empfiehlt es sich, Zielgene mit überlappenden Oligonukleotiden zu verschmelzen und Synonyme DNA-Sequenzen in das Ampicillin-Resistenzgen einzuführen (Nur auf dem Vektor gefunden). Auf diese Weise können die Gene an jedem beliebigen Teil verschmolzen werden, und die Plasmidgewinnung beruht auf der Ligation einer einzigen Stelle (verdaut mit nur einem Restriktionsenzym). Die Flexibilität von CAPPRESI ermöglicht es, in Kombination mit anderen Techniken durchgeführt zu werden.

Die Reinigung von PCR-Produkten wird durchgeführt, um Templat-DNA zu eliminieren, wodurch die Chancen der parentalen Plasmid-Kontamination nach der Ligation komplementärer DNA-Fragmente verringert werden. Die Erfüllung dieser beiden kritischen Schritte verbessert bac(Die Anzahl der korrekt zusammengebauten Konstruktionen), so dass CAPRRESI entweder mit chemisch kompetenten (CaCl 2 ) oder elektrokompetenten E. coli- Zellen durchgeführt werden kann. Die erste Art von kompetenten Zellen stellt die billigste Quelle von E. coli- Kulturen dar, die für die bakterielle Transformation in den meisten Laboratorien eingesetzt wird. Wegen all der vorgestellten Merkmale stellt CAPRRESI eine sinnvolle Option für die Montage von Chimären dar.

Darüber hinaus könnte CAPRRESI in Kombination mit überlappenden PCR-Fragmenten oder Plasmid-Recovery-Techniken arbeiten. Beispielsweise könnten anstelle der Implementierung von zwei Synonym-Sequenzen pro komplementärem DNA-Anteil die gewünschte brechende Region (auf den Ziel-Wildtyp-Genen) überlappende Oligonukleotide verwenden, um intervenierende Sequenzen zu verschmelzen. Die Einführung von Synonymsequenzen könnte auf das ampR- Gen von pUC18 / 19-Vektoren beschränkt werden, was zur Verwendung von nur einem Restriktionsenzym führt, um Plasmi wiederherzustellenD Integrität. Diese zukünftigen Anwendungen könnten CAPRRESI stärken, indem sie die Verschmelzung jeglicher Art von DNA-Sequenzen ( dh nicht nur Protein-kodierende Gene) ermöglichen, ohne die Ligationseffizienz zu beeinträchtigen.

Um CAPRRESI zu testen, wurden zwei chimäre Sigma-Faktoren durch Austausch von Regionen von zwei Wildtyp-Primär-Sigma-Faktor-Genen zusammengesetzt: rpoD ( E. coli ) und sigA ( R. etli ). Alle bekannten primären Sigma-Faktoren enthalten vier Domänen, σ1 bis σ4 8 . Chimäre 01 besteht aus RpoDσ1-σ2 und SigAσ3-σ4, während Chimäre 02 SigAσ1-σ2 und RpoDσ3-σ4 hat. Die Integrität der chimären Konstruktionen wurde durch die Sanger-Sequenzierung 10 ( Abbildung 2 ) bestätigt.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren erklären, dass sie keine konkurrierenden finanziellen Interessen haben.

Acknowledgments

Diese Arbeit wurde von Consejo Nacional de Ciencia y Tecnología, CONACYT, México (Stipendium 154833) und Universidad Nacional Autónoma de México unterstützt. Die Autoren danken Víctor González, Rosa I. Santamaría, Patricia Bustos und Soledad Juárez für ihre administrativen und technischen Beratung.

Materials

Name Company Catalog Number Comments
Platinum Taq DNA polymerase High Fidelity Thermo Fisher 11304011 Produces a mix of blunt/3’-A overhang ended PCR products
High pure plasmid isolation kit Roche 11754785001 Used for all plasmid purification reactions
High pure PCR product purification kit Roche 11732676001 Used for all PCR purification reactions from agarose gels
AflII restriction enzyme New England Biolabs R0520L Recognizes sequence 5’-CTTAAG-3’ and cuts at 37 °C
KpnI-HF restriction enzyme New England Biolabs R3142L Recognizes sequence 5’-GGTACC-3’ and cuts at 37 °C
SpeI-HF restriction enzyme New England Biolabs R3133L Recognizes sequence 5’-ACTAGT-3’ and cuts at 37 °C
XbaI restriction enzyme New England Biolabs R0145L Recognizes sequence 5’-TCTAGA-3’ and cuts at 37 °C
Ampicillin sodium salt Sigma Aldrich A0166-5G Antibiotics
Nalidixic acid Sigma Aldrich N8878-5G Antibiotics
Yeast Extract Sigma Aldrich Y1625-1KG Bacterial cell culture
Casein peptone Sigma Aldrich 70171-500G Bacterial cell culture
NaCl Sigma Aldrich S9888-1KG Sodium chloride
Agar Sigma Aldrich 05040-1KG Bacterial cell culture
XbaI restriction enzyme Thermo Fisher FD0684 Fast digest XbaI enzyme
KpnI restriction enzyme Thermo Fisher FD0524 Fast digest KpnI enzyme
Quick Ligation Kit New England Biolabs M2200S Fast DNA ligation kit
AflII restriction enzyme Thermo Fisher FD0834 Fast digest AflII enzyme
SpeI restriction enzyme Thermo Fisher FD1253 Fast digest SpeI enzyme

DOWNLOAD MATERIALS LIST

References

  1. Horton, R. M., Hunt, H. D., Ho, S. N., Pullen, J. K., Pease, L. R. Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene. 77, (1), 61-68 (1989).
  2. Vos, M. J., Kampinga, H. H. A PCR amplification strategy for unrestricted generation of chimeric genes. Anal. Biochem. 380, (2), 338-340 (2008).
  3. Hawkins, N. C., Garriga, G., Beh, C. T. Creating Precise GFP Fusions in Plasmids Using Yeast Homologous Recombination. Biotechniques. 34, (1), 1-5 (2003).
  4. Sander, J. D., Joung, J. K. CRISPR-Cas systems for editing, regulating and targeting genomes. Nat Biotechnol. 32, (4), 347-355 (2014).
  5. Nagy, A. Cre recombinase: The universal reagent for genome tailoring. Genesis. 26, (2), 99-109 (2000).
  6. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods. 6, (5), 343-345 (2009).
  7. Norrander, J., Kempe, T., Messing, J. Construction of improved M13 vectors using oligodeoxynucleotide-directed mutagenesis. Gene. 26, (1), 101-106 (1983).
  8. Gruber, T. M., Gross, C. A. Multiple sigma subunits and the partitioning of bacterial transcription space. Annu Rev Microbiol. 57, 441-466 (2003).
  9. Edgar, R. C. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 32, (5), 1792-1797 (2004).
  10. Macrogen Inc. Seoul, Rep. Of Korea. Available from: http://dna.macrogen.com/eng/index.jsp (2016).
  11. Chevreux, B. MIRA: an automated genome and EST assembler. Available from: http://www.chevreux.org/thesis/index.html 1-161 (2005).
  12. Thompson, J. D., Gibson, T. J., Higgins, D. G. Multiple sequence alignment using ClustalW and ClustalX. Curr Protoc Bioinformatics. Chapter 2 (Unit 2.3) 1-22 (2002).
  13. Sambrook, J., Russell, D. W. Molecular Cloning: A laboratory manual. CSHLP. (2001).
  14. Rutherford, K., et al. Artemis: sequence visualization and annotation. Bioinformatics. 16, (10), 944-945 (2000).
CAPRRESI: Chimären Assembly durch Plasmid Recovery und Restriktion Enzym Site Insertion
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Santillán, O., Ramírez-Romero, M. A., Dávila, G. CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion. J. Vis. Exp. (124), e55526, doi:10.3791/55526 (2017).More

Santillán, O., Ramírez-Romero, M. A., Dávila, G. CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion. J. Vis. Exp. (124), e55526, doi:10.3791/55526 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter