Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

कैप्रेशेसी: प्लिमिड रिकवरी एंड प्रतिबंध एन्जाइम साइट इनर्सरेशन द्वारा कल्पना विधानसभा

doi: 10.3791/55526 Published: June 25, 2017

Summary

यहां, हम प्लाज्मिड रिकवरी और प्रतिबंध एंजाइम साइट प्रविष्टि (सीएपीआरएआरआईआई) द्वारा चीमेरा विधानसभा को प्रस्तुत करते हैं, एक प्रतिलिपि एंजाइम साइटों को समानार्थक डीएनए दृश्यों और कार्यात्मक प्लाज्मिड वसूली में प्रवेश के आधार पर प्रोटोकॉल। यह प्रोटोकॉल प्रोटीन-कोडन जीन को फ्यूज़ करने के लिए एक तेज़ और कम लागत वाला तरीका है।

Abstract

यहां, हम प्लाज्मड वसूली और प्रतिबंध एंजाइम साइट प्रविष्टि (सीएपीआरएआरआईआई) द्वारा कल्पना का विधानसभा प्रस्तुत करते हैं। मूल प्लाज्मिड वसूली पद्धति की कई शक्तियों से कैप्रेसी लाभ और डीएनए ligation प्रतिक्रियाओं (चीरा विधानसभा के लिए आवश्यक) को कम करने के लिए प्रतिबंध एंजाइम पाचन का परिचय। इस प्रोटोकॉल के लिए, उपयोगकर्ता एक ही प्लाज्मिड (पीयूसी 18 या पीयूसी 1 9) में जंगली जीन को क्लोन करते हैं। एमिनो एसिड अनुक्रम क्षेत्रों के सिलिको चयन के बाद जहां चीमेर्स को इकट्ठा किया जाना चाहिए, उपयोगकर्ता उन सभी समानार्थक डीएनए दृश्यों को प्राप्त करते हैं जो उन्हें एनकोड करते हैं। तदर्थ पर्ल स्क्रिप्ट उपयोगकर्ताओं को सभी समानार्थक डीएनए दृश्यों को निर्धारित करने में सक्षम बनाता है। इस चरण के बाद, एक अन्य पर्ल स्क्रिप्ट सभी प्रतिरूप डीएनए दृश्यों पर प्रतिबंधित एंजाइम साइटों की खोज करता है। यह सिलिको विश्लेषण में पीयूसी 18/1 9 प्लास्मिड पर मिली एम्पीसिलीन प्रतिरोध जीन ( एपीआर ) का उपयोग किया जाता है। पीसीआर द्वारा wildtype और amp आर जीन को बाधित करने के लिए समानार्थी क्षेत्रों के अंदर उपयोगकर्ता ओलिगोन्यूक्लियोटाइजेशन का डिज़ाइन करता है। प्राप्त करने के बादपूरक और डीएनए टुकड़े शुद्ध, प्रतिबंध एंजाइम पाचन पूरा किया है। कल्पना के पूरक पूरक डीएनए टुकड़े ligating द्वारा हासिल की है। पीयूसी 18/1 वैक्टर का चयन कैप्रेसी के लिए किया जाता है क्योंकि वे तकनीकी लाभ, जैसे छोटे आकार (2,686 आधार जोड़े), उच्च प्रति संख्या, लाभप्रद अनुक्रमण प्रतिक्रिया सुविधाओं, और वाणिज्यिक उपलब्धता की पेशकश करते हैं। चिमारा विधानसभा के लिए प्रतिबंध एंजाइमों का उपयोग, खुजली वाली उत्पादों से उत्पन्न डीएनए पोलीमरेज़ की आवश्यकता को समाप्त करता है। कैप्रृसी प्रोटीन-कोडन जीन को फ्यूज़ करने के लिए एक तेज़ और कम लागत वाला तरीका है

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

प्रोमेरोन फ़ंक्शन और / या बायोटेक्निकल प्रयोजनों के लिए चिमेरिक जीन असेंबली का व्यापक रूप से आणविक जीव विज्ञान में उपयोग किया गया है। फ्यूज़िंग जीन के लिए अलग-अलग तरीके मौजूद हैं, जैसे अतिव्यापी पीसीआर उत्पाद प्रवर्धन 1 , प्लाज्मिड रिकवरी 2 , मुताबिक़ पुनर्संयोजन 3 , सीआरआईएसपीआर-सीएस 9 सिस्टम 4 , साइट-निर्देशित पुनर्संयोजन 5 , और गिब्सन विधानसभा 6 । इनमें से प्रत्येक अलग-अलग तकनीकी लाभ प्रदान करता है; उदाहरण के लिए, अतिव्यापी पीसीआर डिजाइन की लचीलेपन, प्लास्मिड वसूली के दौरान निर्माण के विवो चयन में, या सीआरआईएसपीआर-सीएस 9 और गिब्सन सिस्टम की उच्च दक्षता। दूसरी ओर, इनमें से कुछ तरीकों का पालन करते समय कुछ कठिनाइयां पैदा हो सकती हैं; उदाहरण के लिए, पहले दो दृष्टिकोण कुंद-समाप्त डीएनए टुकड़ों पर भरोसा करते हैं, और इन प्रकार के उत्पादों की बाध्यता स्टिक की तुलना में तकनीकी रूप से चुनौतीपूर्ण हो सकती हैकेआई-एंड लैज। साइट-निर्देशित पुनर्संयोजन, मूल पर अतिरिक्त डीएनए दृश्यों (निशान) के निशान को छोड़ सकता है, जैसे कि क्रय-लॉक्स सिस्टम 5 । सीआरआईएसपीआर-सीएस 9 कभी-कभी लक्ष्य साइट 4 के अलावा अन्य जीनोम क्षेत्रों को भी संशोधित कर सकता है।

यहां, हम प्लाज्मिड रिकवरी और प्रतिबंध एंजाइम साइट सम्मिलन (सीएपीआरआरएसआई) द्वारा चीमे विधानसभा की शुरुआत करते हैं, प्रोटीन-कोडिंग जीन के लिए एक प्रोटोकॉल है जो प्लाज्मिड रिकवरी विधि (पीआरएम) को समानार्थक डीएनए अनुक्रमों पर प्रतिबंध एंजाइम साइटों के सम्मिलन के साथ जोड़ती है, जिससे लगी दक्षता बढ़ जाती है । अमीनो एसिड अनुक्रम अखंडता को सुनिश्चित करने के लिए, प्रतिबंध एंजाइम साइट समानार्थक डीएनए अनुक्रम फैला हुआ पर डाला जाता है। CAPPRESI के लाभों में यह है कि यह सामान्य प्रयोगशाला अभिकर्मकों / उपकरण ( जैसे , एंजाइम, सक्षम कोशिका, समाधान, और थर्मोसायक्लर) का उपयोग करके किया जा सकता है और यह त्वरित परिणाम दे सकता है (जब उचित एंजाइमों का उपयोग किया जाता है)। प्रतिबंध पर भरोसाएंजाइम साइटें, जो समानार्थक डीएनए अनुक्रमों से उभरती हैं, वह ब्याज की प्रोटीन के अंदर सटीक संलयन अंक के चयन को सीमित कर सकती हैं। ऐसे मामलों में, लक्षित जीन को ओलिगोन्यूक्लियोटाइड्स ओवरलैप करने के जरिए इस्तेमाल किया जाना चाहिए, और प्रतिबंध एंजाइम साइटें वेक्टर के प्रतिरोध जीन पर डाली जाएंगी।

CAPRRESI में सात सरल चरणों ( चित्रा 1 ) शामिल हैं: 1) क्लोनिंग वेक्टर, पीयूसी 18 या पीयूसी 1 9 6 का चयन ; 2) जंगली सूचियों के सिलिको विश्लेषण में फ्यूज किया जाना; 3) चिमारा विधानसभा और प्लाज्मिड विघटन के लिए क्षेत्रों को तोड़ने का चयन; 4) प्रतिबंध एंजाइम साइटों युक्त समानार्थक डीएनए दृश्यों के सिलिको पीढ़ी में; 5) चयनित प्लास्मिड में जंगली जीनों के स्वतंत्र क्लोनिंग; 6) पीसीआर द्वारा प्लास्मिड व्यवधान, प्रतिबंध एंजाइम पाचन के बाद; और 7) डीएनए बंधन और बैक्टीरियल परिवर्तन का उपयोग करके प्लाज्मिड वसूली। इस तकनीक द्वारा उत्पादित चिमेरिक जीन को सत्यापन किया जाना चाहिएIth अनुक्रमण

पीयूसी 18/1 वैक्टर क्लोनिंग और चिमरा विधानसभा के लिए तकनीकी लाभ प्रदान करते हैं, जैसे छोटे आकार ( यानी, 2,686 आधार जोड़े), उच्च प्रति संख्या, लाभप्रद अनुक्रमण प्रतिक्रिया सुविधाओं, और वाणिज्यिक उपलब्धता 7 । यहां, एस्चेरिशिया कोलाई मेजबान को चीमेरे को इकट्ठा करने और संभालना था क्योंकि बैक्टीरिया की संस्कृतिएं सस्ता हैं और तेजी से बढ़ती हैं यह देखते हुए, अंतिम लक्ष्य प्लास्मिड में संलयन टुकड़ों के बाद क्लोनिंग की आवश्यकता होगी ( उदाहरण के लिए, स्तनधारी कोशिकाओं में बैक्टीरिया या पीसीएमवी में पीआरके 415 के रूप में अभिव्यक्ति वैक्टर)।

दो प्राथमिक सिग्मा कारक जीनों को फ्यूज़ करने के लिए कैप्रृसी का परीक्षण किया गया था: ई। कोलिपरोडी और राइज़ोबियम एट्लिसिगा । प्राथमिक सिग्मा कारक हैं आरएनए पोलीमरेज़ उप-इकाई जो ट्रांसक्रिप्शन दीक्षा के लिए जिम्मेदार हैं, और वे चार डोमेन ( यानी , σ1, σ2, σ3, और σ4) 8 से मिलकर काम करते हैं। एमिनो एसिड अनुक्रम लंबीRpoD और siga द्वारा एनकोड प्रोटीन एच क्रमशः 613 और 685 हैं। आरपीओडी और सिगा शेयर 48% पहचान (98% कवरेज) इन प्राथमिक सिग्मा कारकों को σ2 और σ3 क्षेत्रों के बीच दो पूरक टुकड़ों में विभाजित किया गया था। इस डिजाइन के अनुसार दो चिरागिक जीन को इकट्ठा किया गया है: कल्पना 01 (आरपो डीसी 1-σ2 + सिगैर -3-σ4) और चीइमा 02 (सिगएसर 1-σ2 + आरपीओडी -3 3) डीएनए संलयन उत्पादों को क्रमशः द्वारा सत्यापित किया गया।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. कैप्रेश्री प्रोटोकॉल

नोट: चित्रा 1 समग्र कैप्रेएसआई प्रोटोकॉल का प्रतिनिधित्व करता है यह तकनीक एक सिलिको डिजाइन और वांछित चिमेरा के बाद के निर्माण पर आधारित है।

  1. क्लोनिंग प्लाज्मिड, पीयूसी 18 या पीयूसी 1 9 का चयन
    1. पीयूसी वेक्टर का चयन करें जो सबसे अच्छी तकनीकी मांगों को पूरा करता है
      नोट: एकाधिक क्लोनिंग साइट की ओरिएंटेशन को छोड़कर दोनों वैक्टर के समान अनुक्रम हैं। यह ओलिगोनक्लियोटाइड्स और पीसीआर प्लास्मिड व्यवधान के डिजाइन के लिए महत्वपूर्ण है।
  2. जंगली सूक्ष्म जीन और पीयूसी 18/1 श्रृंखला के सिलिको विश्लेषण में
    1. Wildtype जीन के डीएनए दृश्य प्राप्त करें और उन्हें फास्टा प्रारूप फ़ाइल में सहेजें ( जैसे, जीन। एफएएस)।
      नोट: पीयूसी 18/1 वैक्टर के अनुक्रम पीयूसी.फ़स फ़ाइल ( चित्रा 1 , चरण 1) में शामिल हैं।
    2. कौन सी प्रतिबंध enz निर्धारित करेंYmes wildsepe जीन और पीयूसी 18/1 अनुक्रमों को REsearch.pl स्क्रिप्ट चलाने के द्वारा कट नहीं करते हैं। वैकल्पिक रूप से, एक ऑनलाइन उपकरण ( चित्रा 1 , चरण 2) के साथ प्रतिबंध एंजाइम साइट खोज करें।
      1. टर्मिनल में निम्नलिखित टाइप करें:
        पर्ल रीसर्च.प्ल जीन। एफएएस
        पर्ल REsearch.pl pUC.fas
        नोट: ये कमांड निम्न आउटपुट फाइलें बनाएंगे: जीनस_लि.फ़ैस, जीन_एरेफ़स, पीयूसी_लिएफ़स, और पीयूसी_एरेफ़स।
      2. जीनस_रेफ़स और पीयूसी.फ़स फाइलों की तुलना करके चुने हुए पीयूसी 18/1 वेक्टर की कई क्लोनिंग साइट में जंगली जीन की क्लोनिंग के लिए उपयुक्त प्रतिबंध एंजाइम का चयन करें। पीयूसी 18/1 वेक्टर के एम्पीसिलीन प्रतिरोध जीन ( एपीपी ) के सापेक्ष सम्मिलन की ओरिएंटेशन चुनें।
    3. जंगली प्रकार के जीनों (बाहरी oligonucleotides) के कोडन क्षेत्र को बढ़ाने के लिए डिजाइन अग्रेषण और ओलिगोनक्लियोटाइड्स रिवर्स करें। प्रत्येक 5 'अंत में उचित प्रतिबंध एंजाइम साइट को शामिल करेंऑलिगोनक्लियोटाइड्स का; यह सम्मिलित अभिविन्यास को परिभाषित करेगा
      1. आगे ऑलिगोनक्लियोटाइड में एक कार्यात्मक रिबोसोम बाध्यकारी साइट को शामिल करें।
      2. वेक्टर के अंदर एक ही उन्मुखीकरण में दोनों जंगली प्रकार के जीनों को सम्मिलित करें।
  3. कल्पना विधानसभा और प्लाज्मिड व्यवधान के लिए तोड़ने वाले क्षेत्रों का चयन
    1. ट्रांसमिशन.प्ल स्क्रिप्ट ( चित्रा 1 , चरण 3) चलाकर जंगली प्रकार के एमिनो एसिड अनुक्रम और amp आर जीन प्राप्त करें।
      1. टर्मिनल में निम्नलिखित टाइप करें:
        Perl translate.pl जीन। एफएएस
        Perl translate.pl ampR.fas

        नोट: यह स्क्रिप्ट निम्न आउटपुट फ़ाइलों को बनाएगी: genes_aa.fas और ampR_aa.fas
    2. वैश्विक रूप से एक उपयुक्त सॉफ्टवेयर ( उदाहरण के लिए, मस्यल) 9 के साथ दो जंगली प्रकार एमिनो एसिड दृश्यों को संरेखित करें।
    3. कल्पना के लिए वांछित क्षेत्रों (3-6 अमीनो एसिड) का चयन करेंएमबीली अनुक्रम संरेखण के आधार पर। उन्हें FASTA प्रारूप में एक फ़ाइल में सहेजें ( जैसे , regions.fas)।
    4. डीएनए अनुक्रमों का पता लगाएँ कि चयनित अमीनो एसिड के कोड दोनों प्रकार की जंगली जीनों पर फैला है।
  4. प्रतिबन्ध एंजाइम साइट्स युक्त समानार्थक डीएनए अनुक्रमों के सिलिको पीढ़ी में
    1. सभी समानार्थक डीएनए अनुक्रम प्राप्त करें जो प्रत्येक अमीनो एसिड अनुक्रम खंड के लिए कोड को विभाजित क्षेत्रों ( चित्रा 1 , चरण 4) के रूप में चुना जाता है; इन दृश्यों को areas.fas फ़ाइल में संग्रहीत किया गया था।
      1. टर्मिनल में निम्नलिखित टाइप करें:
        पर्ल समानार्थी.प्ल। क्षेत्रों। एफएएस
        नोट: यह स्क्रिप्ट region_syn.fas आउटपुट फ़ाइल बनाएगा।
    2. प्रतिरूप डीएनए दृश्यों पर पाए गए प्रतिबंधित एंजाइम साइटों की खोज करें।
      1. टर्मिनल में निम्नलिखित टाइप करें: perl REsynonym.pl regions_syn.fas
        नोट: यह स्क्रिप्ट region_syn-re.fas आउटपुट फ़ाइल बनाएगा।
    3. एक प्रतिबंध एंजाइम चुनें जो कि दोनों प्रकार की जंगली जीनों के समानार्थक अनुक्रमों के बीच साझा किया गया है; इस साइट को प्रतिबंध एंजाइम पाचन के माध्यम से चिमेरा को इकट्ठा करने के लिए उपयोग किया जाएगा। सत्यापित करें कि चुने हुए प्रतिबंध एंजाइम में न तो जंगली सूक्ष्म जीन और न ही पीयूसी 18/1 9 वेक्टर श्रृंखलाएं कट गई हैं।
      1. प्रतिबंध एंजाइमों की तुलना जीन_आरएफ़स, पीयूसी_आरएफ़स, और क्षेत्रों_एसिएन-रीएफ़स फाइलों पर मिलें।
    4. सिलिको में मूल प्रकार डीएनए अनुक्रम दोनों के लिए इसी तरह की जंगली जीन पर मौजूद हैं। समानार्थक डीएनए दृश्यों को जंगली रूप अनुक्रम फ़ाइल (जीन। एफएएस) में जोड़ें।
    5. जीन पर निहित जीन के एमिनो एसिड अनुक्रम प्राप्त करें ( पीआरएल ट्रांसलेट.प्ल जीन्स.फस )।
    6. जंगली स्वर और समानार्थक डीएनए दृश्यों से अनुवादित अमीनो एसिड अनुक्रम संरेखित करें। सत्यापित करें कि दोनों दृश्य समान हैं
    7. इस अनुभाग के सभी चरणों को पीयू पर मौजूद ampR जीन के साथ दोहराएंसी 18/1 वेक्टर
      नोट: लक्ष्य दो पूरक भागों में ampr जीन (फ़ाइल ampR.fas) को बाधित करना है। एएमपीआर जीन को बाधित करने के लिए चयनित प्रतिबंध एंजाइम चीइम असेंबली के लिए इस्तेमाल होने वाले एक से अलग होना चाहिए।
  5. चयनित पीयूसी 18/1 वेक्टर (चित्रा 1, चरण 3) में दो जंगली जीनों का स्वतंत्र क्लोनिंग।
    1. एक प्लाज्मिड डीएनए शुद्धि किट का उपयोग करके चयनित पीयूसी 18/1 9 प्लाज्मिड डीएनए को शुद्ध करें।
      1. उदाहरण के लिए, पीयूसी 18 प्लाज्मिड के साथ ई। कोलाई डीएच 5 ए को बदलने और ठोस एलबी -35 मिलीग्राम / एमएल एम्पीसिलीन (एएमपी) पर 37 डिग्री सेल्सियस पर रात भर ट्रांसनाटेंट्स बढ़ाना। एक ट्रांसफॉर्मेंट कॉलोनी उठाओ, एक नया एलबी-0.3 एमजी / एमएल एमपी प्लेट टीका लगाना और 37 डिग्री सेल्सियस पर रात भर इसे बढ़ाना
      2. पिछली संस्कृति का हिस्सा लें और इसे तरल एलबी-0.3 मिलीग्राम / एमएल एमएपी में 6-8 घंटे के लिए 37 डिग्री सेल्सियस से बढ़ाएं। एक किट का उपयोग करके प्लाज्मिड डीएनए निकालें
    2. पीसीआर ने एपॉप का उपयोग करके कुल जीनोमिक डीएनए से जंगली जीन को बढ़ानाराइट बाहरी ओलिगोनक्लियोटाइड्स यदि संभव हो तो उच्च निष्ठा डीएनए पोलीमरेज़ का उपयोग करें डीएनए पोलीमरेज़ का चयन करें जिससे उपज अधिकतम हो। निर्माता के दिशानिर्देशों और ओलिगोनक्लियोटाइड के पिघलने के तापमान के अनुसार पीसीआर करें।
      1. डीएनए पोलीमरेज़, एम्प्लिकॉन आकार, टेम्पलेट और ओलिगोन्यूक्लियोटाइड्स के इस्तेमाल के आधार पर पीसीआर चक्र चलाएं। उदाहरण के लिए, आरओपीडी डीएनए को बढ़ाने के लिए, 50 μL प्रतिक्रिया तैयार करें: 5 μL 10x बफर, 2 μL 50 मिमी एमजीएसओ 4 , 1 μL 10 एमएम डीएनटीपी मिश्रण, प्रत्येक 10 माइक्रोन ऑलिगोन्यूक्लिओटाइड (2 टेबल) के 2 μL, 2 टेम्पलेट डीएनए ( ई कोलाई DH5α कुल डीएनए), 35.8 μL अति शुद्ध पानी, और 0.2 μL उच्च निष्ठा डीएनए पोलीमरेज़ के μL। निम्न पीसीआर चक्रों को चलाने: 1 मिनट में 94 डिग्री सेल्सियस प्रवर्धन के 30 चक्रों (30 डिग्री सेल्सियस 94 डिग्री सेल्सियस, 30 डिग्री सेल्सियस 60 डिग्री सेल्सियस के लिए ओलिगोनक्लियोटाइड्स, और 2 मिनट 68 डिग्री सेल्सियस विस्तार करना)।
      2. 1.2 ग्राम को भंग करेंमाइक्रोवेव में उन्हें गर्म करके 100 मिलीलीटर डबल डिस्टिल्ड पानी में एगारोस। एक जेल ट्रे और कंघी को इकट्ठा करें और उन्हें क्षैतिज जेल ढलाईकार में डाल दें। पिघला हुआ agarose समाधान के साथ जेल ट्रे भरें और इसे घनीभूत करें। कंघी को निकालें
      3. इलेक्ट्रोफोरेसिस चैम्बर में जेल रखें 1x ट्रिस-एसीटेट-ईडीटीए बफर के साथ चैम्बर भरें। जेल कुओं में 50 μL पीसीआर उत्पादों को लोड करें। नमूने इलेक्ट्रोफोरस ( जैसे , 1 घंटे के लिए 110 वी पर)।
      4. वैद्युतकणसंचलन के बाद, 100 मिलीलीटर की डबल डिस्टिल्ड वॉटर में 100 एमएल का 1 एमजी / एमएल एथिडियम ब्रोमाइड समाधान युक्त 10 मिनट के लिए धीमी गति से धक्का धीमी धक्के में एक और 10 मिनट के लिए डबल आसुत जल में जेल धो लें; एक क्षैतिज प्रकार के बरतन का उपयोग करें
        सावधानी: एथेडियम ब्रोमाइड एक जहरीले परिसर है; सुरक्षात्मक दस्ताने और कपास प्रयोगशाला कोट पहनें।
      5. एक किट का उपयोग करके जेल के संबंधित बैंड से जंगली जीन डीएनए को शुद्ध करना यूवी चेंबर में दाग वाले जेल को रखकर बैंड को कल्पना दें (अनुशंसित तरंगदैर्ध्य: 300 एनएम) जेल के जोखिम को कम से कम रखें एक डीएनए शुद्धि किट का प्रयोग करें और निर्माता के निर्देशों का पालन करें।
        सावधानी: यूवी विकिरण खतरनाक है; एक सुरक्षात्मक ढाल, चश्मा, और एक कपास प्रयोगशाला कोट पहनें।
    3. डाइजेस्ट की जंगली प्रकार के जीन और पीयूसी 18/1 9 प्लाज्मिड डीएनए निर्माता के निर्देशों के अनुसार प्रतिबंध एंजाइमों के साथ। जब संभव हो तो फास्ट पाचन एंजाइम का उपयोग करें उदाहरण के लिए, 10 μL ultrapure पानी, 2 μL 10x बफर, 1 μL केपीएन मैं प्रतिबंध एंजाइम में पीयूसी 18 डीएनए (300 एनजी / μL) के 6 μL, और एक्सबा मैं प्रतिबंध एंजाइम के 1 μL डाइजेस्ट करें । 30 मिनट के लिए 37 डिग्री सेल्सियस पर प्रतिक्रिया छोड़ दें
      1. निर्माता के दिशानिर्देशों के अनुसार प्रतिबंध एंजाइमों को निष्क्रिय करें उदाहरण के लिए, पांच मिनट के लिए 80 डिग्री सेल्सियस पर डबल-पाचन प्रतिक्रिया केपीएन I- Xba I को निष्क्रिय कर दें
    4. मिक्स डालें: एक बड़ा राटी पर वेक्टर डीएनए3: 1 का ओ एक बंधन प्रतिक्रिया के लिए निर्माता के निर्देशों का पालन करें। जब संभव हो तो तेजी से बंधन एंजाइम का उपयोग करें (10 मिनट के लिए 25 डिग्री सेल्सियस पर प्रतिक्रिया छोड़ दें)।
      नोट: आमतौर पर, किट का उपयोग शुद्धि के बाद डीएनए एकाग्रता पाचन और बंधन प्रतिक्रियाओं के लिए पर्याप्त है। उदाहरण के लिए, 6 μL आरपीओडी डीएनए ( केपीएन I- Xba I, 150 एनजी / μL), पीयूसी 18 डीएनए ( केपीएन I- XBA I, 150 एनजी / μL), 10 μL 2x बफर, 1 μL की अतिरंज्य पानी, और टी 4 डीएनए ligase के 1 μL। 10 मिनट के लिए 25 डिग्री सेल्सियस पर लगी प्रतिक्रिया छोड़ें
    5. पूरक सामग्री के रूप में वर्णित अनुसार, 2-4 μL लगी प्रतिक्रिया के साथ ई। कोलाई DH5α को रूपांतरित करें। प्लेट को बदलकर कोशिकाओं को ठोस एलबी / एएमपी / एक्स-गैल / आईपीटीजी प्लेट्स में रखें 37 डिग्री सेल्सियस पर रात भर प्लेटें छोड़ें
    6. सफेद रंग का प्रणोदक ई। कोलाई कॉलोनिज चुनें और उन्हें एक नया एलबी / एएमपी प्लेट पर लटका दें। 37 डिग्री सेल्सियस पर रात भर प्लेटें छोड़ें/ Li>
    7. अनुपूरक सामग्री में वर्णित अनुसार, प्रतिक्रिया को क्रमबद्ध करने के लिए उम्मीदवारों का चयन करने के लिए एक कॉलोनी पीसीआर करें। उम्मीदवारों से प्लाज्मिड डीएनए निकालें वैकल्पिक रूप से, डाइजेस्ट उम्मीदवार प्लाज्मिड डीएनए, उसी प्रतिबंध के एंजाइम्स के साथ आवेषण क्लोनिंग के लिए उपयोग किया जाता है।
    8. क्रमवारण प्रदाता 10 अनुक्रम सेवा प्रदाता के साथ निर्माण एक डीएनए एंगलर 11 ( चित्रा 1 , चरण 5) का उपयोग करके सिलिको में क्रम को इकट्ठा करें।
  6. PCR द्वारा प्लास्मिड व्यवधान के बाद प्रतिबंध एंजाइम पाचन।
    1. क्रमशः wildtype और amp आर जीन के लिए ब्रेक क्षेत्रों में सिलिको फॉरवर्ड और रिवर्स ओलिगोनक्लियोटाइड्स में डिजाइन । सिल्लो में इसके संबंधित समानार्थक डीएनए अनुक्रम के लिए wildtype fragment (चरण 1.4 में प्राप्त) में विकल्प।
      नोट: इस पर्याय डीएनए अनुक्रम में प्रतिबंध एंजाइम साइट है। अग्रेषित करें और ओलिगोनक्लियोटाइड्स रिवर्स टी पर ओवरलैप करेंवह प्रतिबंध एंजाइम साइट ऑलिगोनक्लियोटाइड्स 21-27 न्यूक्लियोटाइड से लेकर, साइटोसिन या गैनिन के साथ समाप्त होनी चाहिए, और इसमें प्रतिबंध एंजाइम साइट शामिल है। एक फ़ॉरवर्ड ओलिगोनक्लियोटाइड के टेम्पलेट डीएनए पर इसके लक्षित क्षेत्र के समान क्रम है। एक रिवर्स ओलिगोनक्लियोटाइड टेम्पलेट डीएनए पर लक्ष्य क्षेत्र का रिवर्स पूरक अनुक्रम है।
    2. पीसीआर प्रतिक्रियाओं के लिए डीएनए टेम्पलेट ( जैसे, पीयूसी 18 आरपीओडी और पीयूसी 18 सीआईजीए ) के रूप में दो जंगली रूप जीन निर्माणों का प्रयोग करें। प्रत्येक निर्माण के दो पूरक भागों प्राप्त करें (पीयूसी 18 आरओपीडी σ1 -σ2, पीयूसी 18 आरओपीडी σ3-σ4, पीयूसी 18 सीजीए σ1 -σ2, और पीयूसी 18 सीजीए σ3-σ4) ( चित्रा 1 , चरण 6)।
    3. डीएनए के नमूने को एक agarose जेल 1-1.2% [w / v] में लोड करें। इलेक्ट्रोफोरेसिस द्वारा डीएनए टेम्प्लेट से पीसीआर उत्पादों को अलग करें ( जैसे, 1 घंटे के लिए 110 वी)। वैकल्पिक रूप से, डीएनएन टेम्पलेट को तोड़ने के लिए डीपीएन I के साथ पीसीआर प्रतिक्रियाओं को पचाने के लिए।
      नोट: डीपीएनमैं एंजाइम केवल मैथिलेटेड डीएनए दृश्यों (5'-जीएटीसी -3) को पहचानता हूं।
      1. एक डीएनए शुद्धि किट का उपयोग कर नमूने शुद्ध। निर्माता के दिशानिर्देशों का पालन करें।
    4. निर्माता के निर्देशों के अनुसार उचित प्रतिबंध एंजाइमों के साथ सभी पूरक डीएनए टुकड़े को दोहराएं। जब संभव हो तो फास्ट-डायजेस्ट प्रतिबंध एंजाइम का उपयोग करें उदाहरण के लिए, एफ़एल II और स्पी I के साथ निर्माता के प्रोटोकॉल का उपयोग करके पीयूसी 18 आरपीडीसी 1-डीआरएस डीएनए टुकड़ा को दोहराइए। 15 मिनट के लिए 37 डिग्री सेल्सियस पर पाचन प्रतिक्रिया छोड़ दें
    5. निर्माता के दिशानिर्देशों के अनुसार प्रतिबंध एंजाइमों को निष्क्रिय करें उदाहरण के लिए, एफ़एल II- स्पी I को 20 मिनट के लिए 80 डिग्री सेल्सियस पर निष्क्रिय करें।
  7. डीएनए बंधन और बैक्टीरियल परिवर्तन का उपयोग करके प्लाज्मिड वसूली
    1. वांछित चिमरिक जीन को इकट्ठा करने के लिए एक बड़ा 1: 1 अनुपात में उचित डीएनए टुकड़े मिलाएं ( चित्रा1, चरण 7)।
      नोट: इस तरह, एम्पीआर जीन की अखंडता को बहाल किया जा रहा है, एक कार्यात्मक प्रोटीन पैदा कर रहा है।
      1. उदाहरण के लिए, पीयूसी 18 आरपीओडी σ1 -σ2 डीएनए ( एएफएल द्वितीय- स्पी I, 150 एनजी / μ एल के साथ पच चुका) के 4 μL को मिलाएं, पीयूसी 18 सीआईजीए σ3-σ4 डीएनए (एफ़एल II- स्पी आई, 150 एनजी / μ एल) के 4 μL, 10 μL के 2x बफर, 2 μL अतिपरवलर पानी, और 1 μL टी 4 डीएनए ligase; किट शुद्धि के बाद डीएनए एकाग्रता पाचन और बाद के बंधन के लिए काफी अच्छा है। 10 मिनट के लिए 25 डिग्री सेल्सियस पर लेंगे प्रतिक्रिया छोड़ दें
    2. 3 डी 5 एल्यूमीनियम के साथ काइला डीओएचएनएई कोइमेंटल लिगिंग रिएक्शन (अनुपूरक सामग्री) को बदलना। एलएबी / एएमपी / एक्स-गैल / आईपीटीजी प्लेट्स में 37 डिग्री सेल्सियस रातोंरात रात भर में ट्रांसन्टैंट कोशिकाओं को बढ़ाएं।
    3. सफेद रंग का प्रणोदक ई। कोलाई कॉलोनिज चुनें और उन्हें एक नया एलबी / एएमपी प्लेट पर लटका दें। 37 पर रात भर प्लेटें छोड़ेंसी।
    4. अनुपूरक सामग्रियों में वर्णित अनुसार अनुक्रमण की प्रतिक्रिया के लिए उम्मीदवारों का चयन करने के लिए एक कॉलोनी पीसीआर करें। 1-1.2% (w / v) agarose जेल में वैद्युतकणसंचलन प्रदर्शन (बैंड 2.3.2.1 में वर्णित) में बैंड को विज़ुअलाइज़ करें।
    5. सकारात्मक उम्मीदवारों से संस्कृतियां बढ़ाएं प्लाज्मिड डीएनए शुद्धि किट का उपयोग करके उनमें से प्लाज्मिड डीएनए निकालें।

2. अनुक्रम उम्मीदवार चिमरिक कंस्ट्रक्शन

  1. अनुक्रम सेवा प्रदाता से दिशानिर्देशों का पालन करके सुनिश्चित करें कि प्लाज्मिड डीएनए की गुणवत्ता अनुक्रमण के लिए पर्याप्त है। शुद्धिकरण किटों का उपयोग करके डीएनए निकालें उदाहरण के लिए, अनुक्रम सेवा प्रदाता के इंटरनेट पेज पर, नमूने के लिए अनुशंसित डीएनए एकाग्रता पर विशेष ध्यान दें। एक डीएनए मात्रा का ठहराव साधन का उपयोग कर नमूने की एकाग्रता प्राप्त करें।
  2. अनुक्रमण अनुक्रमिक सेवा प्रदाता 10 के साथ अनुक्रमिक चिमड़ी निर्माण
  3. इकट्ठा से क्विनिंगिंग एक सिल्लिक डीएनए एंगलर 11 में पढ़ता है
  4. अनुक्रम संरेखण उपकरण 9 , 12 का उपयोग करते हुए सिलिको- डिज़ाइन किए गए चिमरिक अनुक्रमों में बनाम संरेखित करें। यह सत्यापित करें कि चिरागिक जीन को सफलतापूर्वक जोड़ा गया था।

3. तैयारी करना

नोट: जीवित कोशिकाओं से जुड़े सभी कदमों को बन्सन बर्नर के साथ एक स्वच्छ लामिना का प्रवाह हुड पर किया जाना चाहिए।

  1. ई। कोलाई DH5α- सक्षम कोशिकाओं का निर्माण।
    1. ई। कोलाई- सक्षम कोशिकाओं का निर्माण करने के लिए, प्रकाशित प्रोटोकॉल 13 का पालन करें या पूरक सामग्री देखें । वैकल्पिक रूप से, व्यावसायिक रूप से उपलब्ध सक्षम कक्षों का उपयोग करें
  2. ई। कोलाई DH5α- सक्षम कोशिकाओं को ट्रांसफ़ॉर्मिंग
    1. ई। कोलाई संस्कृतियों के रासायनिक परिवर्तन के लिए, प्रकाशित प्रोटोकॉल का पालन करेंClass = "xref"> 13 या अनुपूरक सामग्री देखें वैकल्पिक रूप से, जीवाणु परिवर्तन के लिए इलेक्ट्रोप्लोरेशन का उपयोग करें। यदि व्यावसायिक रूप से उपलब्ध सक्षम सेल का उपयोग किया जाता है, तो निर्माता के दिशानिर्देशों का पालन करें
  3. ई। कोलाई DH5α से जीनोमिक और प्लाज्मिड डीएनए शुद्ध करना।
    1. व्यावसायिक रूप से उपलब्ध किटों या निम्नलिखित प्रकाशित प्रोटोकॉल 13 का उपयोग करते हुए पूरक सामग्री में वर्णित अनुसार न्यूक्लिक एसिड निष्कर्षण करना।
  4. कॉलोनी पीसीआर प्रदर्शन
    1. बाद के क्रमिक प्रतिक्रिया के लिए उम्मीदवार के ट्रांसफार्मन कालोनियों की पहचान करने के लिए इस तकनीक का उपयोग करें।
      नोट: यह विधि अनुक्रमों की अखंडता के अंतिम सत्यापन का प्रतिनिधित्व नहीं करती है। इस तकनीक का एक विस्तृत विवरण पूरक सामग्री में उपलब्ध है
  5. समाधान तैयार करना
    1. देख
  6. CAPRRESI प्रोटोकॉल के लिए आवश्यक स्क्रिप्ट और अनुक्रम फ़ाइलें डाउनलोड करें
    1. जीन बैंक फाइलें डाउनलोड करें, जिनमें वांछित प्रजातियों के संपूर्ण जीनोम अनुक्रम हैं, जीनोम ब्राउज़र का उपयोग करके जीन के डीएनए अनुक्रम को निकालने और इसे फाटा फ़ाइल प्रारूप में सहेजते हैं। CAPRRESI प्रोटोकॉल के लिए आवश्यक पर्ल स्क्रिप्ट डाउनलोड करें। एक ही निर्देशिका में स्क्रिप्ट और अनुक्रम फ़ाइलें संग्रहीत करें

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

चित्रा 1 चित्रा 1 CAPRRESI दर्शाया गया है। इस पद्धति का उपयोग करते हुए, दो चिरात्मक जीन को दो जीवाणु प्राथमिक सिग्मा कारकों ( यानी, कोलाई आरपीओडी और आर एटली सिगा) के डोमेन का आदान-प्रदान करके इकट्ठा किया गया था। आरपीओडी और सीआईजीए जीनों के डीएनए दृश्यों को क्रमशः जेनबैंक जीनोम फाइल NC_000913 और NC_007761 से आर्टेमिस जीनोम ब्राउज़र 14 का उपयोग करके प्राप्त किया गया था। पीयूसी 18 वेक्टर के डीएनए अनुक्रम एनसीबीआई सर्वर के न्यूक्लियोटाइड डाटाबेस से प्राप्त किया गया था। प्रतिबंध एंजाइम साइटों के सिलिको विश्लेषण में डीएनए अनुक्रमों पर REsearch.pl पर्ल स्क्रिप्ट चलाकर किया गया था (चरण 1.2.2 देखें)। ये परिणाम ऑलिगोन्यूक्लियोटाइड डिजाइन (चरण 1.2.3) के लिए उपयोग किए गए थे। बाहरी ओलिगोनक्लियोटाइड्स में पीआईसी 18 मल्टीपल क्लोनिंग साइट में बेसिक टाइप जीन्स को क्लोन करने के लिए एक्सबा आई और केपीएन I प्रतिबंध एंजाइम के लिए पहचान की साइटें शामिल हैं। आगे ऑलिगोनक्लियोटाइड में एक रबी भी शामिल थाकुछ बाध्यकारी साइट ( तालिका 2 ) जीनोमिक डीएनए को ई। कोलाई से निकाला गया था, जिसे एलबी / नल ब्रोथ (37 डिग्री सेल्सियस, 220-250 आरपीएम) और आर एटिली सीएफएन 42 कोशिकाओं में पीवाई / नल / कैल्क 2 ब्रोथ (30 डिग्री सेल्सियस, 220-250 आरपीएम )। ये नमूने wildtype जीन प्रवर्धन (चरण 1.5.2) के लिए डीएनए टेम्प्लेट के रूप में उपयोग किए गए थे।

वाल्टरटेप जीन एक टेक उच्च-निष्ठा डीएनए पोलीमरेज़ का इस्तेमाल करते हुए विस्तारित किया गया था, जो एग्रोस जेल (डीएनए शुद्धि किट) से शुद्ध था, केपीएन I- Xba I प्रतिबंध एंजाइम के साथ दोहराया गया था, और पीयूसी 18 वेक्टर में क्लोन किया गया था। रासायनिक रूप से सक्षम ई। कोलाई DH5α कोशिकाओं को जंगली स्वरुप पीयूसी 18 आरपीओडी और पीयूसी 18 सीआईजीए (चरण 1.5.5) के अनुरूप 5 μL की बाघ प्रतिक्रिया के साथ बदल दिया गया। 37 डिग्री सेल्सियस पर विकसित ठोस एलबी / एएमपी / एक्स-गैल / आईपीटीजी प्लेटों पर ट्रांसफ़ॉर्मेंट सेल का चयन किया गया था Wildtype निर्माण Sanger sequenc द्वारा सत्यापित किया गयाआईएनजी 10 Sanger अनुक्रम पढ़ता सिरीओ में थे एमआईआरए 11 (कदम 1.5.8) का उपयोग कर।

Wildtype जीनों से एमिनो एसिड अनुक्रम translate.pl स्क्रिप्ट (1.3.1 कदम) चलकर प्राप्त किया गया। क्लस्टल 12 के साथ जंगली प्रकार के जीन को संरेखित करने के बाद, एमिनो एसिड क्षेत्रों टीएलवी और एनएलआर को क्रमशः एम्पीसिलीन प्रतिरोध जीन ( एपीआर ) और जंगलीप्रथम प्राथमिक सिग्मा कारकों पर चुना गया (चरण 1.3.3)। इन एमिनो एसिड क्षेत्रों का उपयोग सभी संभव डीएनए पर्याय नामों की गणना करने के लिए किया गया था, जो समानार्थी.प्ल स्क्रिप्ट (चरण 1.4.1) चलाकर उन्हें सांकेतिक शब्दों में बदलते हैं। REsynonym.pl स्क्रिप्ट ने पूर्वनिर्धारित डीएनए अनुक्रमों (चरण 1.4.2) पर पाया प्रतिबंध एंजाइम साइटों की खोज की। वे पर्यायी क्षेत्रों, जो कि जंगली दृश्यों की तुलना में कम से कम परिवर्तन की शुरुआत करते थे, का चयन किया गया था। प्राथमिक सिग्मा कारक जीन के लिए, आरपी के जंगली स्वरूपएए सीटीटीएजी जी के लिए ओडी (एएसीटीटीएसीजीटी) और सिगा (एएसीसीटीटीसीजीसी) का आदान-प्रदान किया गया। बाद में एएफएल II साइट (बोल्ड) शामिल थी। एम्प्रर जीन के लिए, जंगली स्वरूप अनुक्रम एसीजीसीटीजीजीटीजी को इसके समानाथ , एसी एक्टैग्ट जी के लिए एक्सचेंज किया गया था। एंप्रैर जीन में सम्मिलित समानार्थक डीएनए अनुक्रम में स्पी I साइट (बोल्ड) शामिल थी। अनुक्रम अखंडता और ओलिगोन्यूक्लियोटाइड डिजाइन (चरण 1.2-1.4) को सत्यापित करने के लिए इसी प्रकार के अनुक्रम दृश्यों के लिए wildtype के सिलिको प्रतिस्थापन में किया गया था।

डीएनए टेम्पलेट्स (चरण 1.5.2) के रूप में उपयुक्त oligonucleotides ( तालिका 2 ) और wildtype निर्माण का उपयोग करके समानार्थक अनुक्रम परिवर्तन पीसीआर द्वारा पेश किए गए थे। प्रवर्धन प्रतिक्रियाओं ने चार पूरक भागों का उत्पादन किया: पीयूसी 18 आरपीओडी σ1 -σ2, पीयूसी 18 आरपीओडी σ3-σ4, पीयूसी 18 सीजीए σ1 -σ2, और पीयूसी 18 सीआईजीए σ3-σ4। पूरक भागों डिस्कन केवल सिग्मा कारक रुपए, बल्कि एम्प्रैर जीन भी। एक डीएनए शुद्धि किट (चरण 1.6.3) का उपयोग कर पूरक भागों शुद्ध थे।

ये पूरक डीएनए टुकड़े एफ़एल II और स्पी I प्रतिबंध एंजाइम (चरण 1.6.4) के साथ डबल से पचाए गए थे। कैप्रृसी डिजाइन के अनुसार, डीएनए के टुकड़े पीयूसी 18 आरपीओडी σ1-σ2 को पीआईसी 18 सीआईजीए σ3-σ4 के साथ कल्पना के लिए प्राप्त किया गया था, और पीयूसी 18 सीआईजीए σ1-σ2 पीआईसी 18 आरपीओडी σ3-σ4 के साथ लिपटे गया था जो चिरेरा 02 (चरण 1.7.1-1.7 .3)। रासायनिक रूप से सक्षम ई। कोलाई DH5α कोशिकाओं को पीयूसी 18 चीम 101 और पीयूसी 18 चीम 02 (चरण 1.7.4) की बाध्य प्रतिक्रिया के 5 μL के साथ बदल दिया गया था। 37 डिग्री सेल्सियस (चरण 1.7.5) में विकसित ठोस एलबी / एएमपी / एक्स-गैल / आईपीटीजी प्लेटों पर ट्रांसफ़ॉर्मेंट सेल का चयन किया गया था। चिमारिक निर्माण Sanger अनुक्रमण 10 (चरण 2) द्वारा सत्यापित किया गया था। सेंगर अनुक्रम आरईआड्स को एमआईआरए 11 का इस्तेमाल करके इकट्ठा किया गया था, और इसकी परिणामी फाइलें तालिका 3 में सूचीबद्ध हैं चित्रा 2 विभाजित क्षेत्रों में जंगली प्रकार और चिरात्मक जीनों के इकट्ठे अनुक्रमों के 9 संरेखण (MUSCLE का उपयोग करके दिखाया गया) दिखाता है।

आकृति 1
चित्रा 1: सीपीआरईआरआई ओवरव्यू। प्रतिनिधित्व: जीन (मोटी तीर), कार्यात्मक प्लास्मिड (बंद सर्कल), और ऑलिगोन्यूक्लियोटाइड्स (पतले, काले रंग वाला तीरों)। ओलिगोनक्लियोटाइड्स में सम्मिलित प्रतिबंध एंजाइम साइटें रंगों में दिखाई देती हैं। संकेताक्षर: वाल्ट ( वन्य प्रकार ), एफडब्लूडी ( आगे ऑलिगोन्यूक्लियोटाइड ), आरईवी (रिवर्स ऑलिगोन्यूक्लियोटाइड ), एपीआर (एम्पीसिलीन प्रतिरोधक जीन), आरईएस (प्रतिबंध एंजाइम साइट), आरई (प्रतिबंध एंजाइम)। कृपया एक बड़ा वाणी देखने के लिए यहां क्लिक करेंइस आंकड़े पर

चित्र 2
चित्रा 2: इकट्ठे जंगली और चिमरिक जीन अनुक्रमों के संरेखण। इकट्ठे डीएनए दृश्यों को मस्केले 9 का उपयोग करके गठबंधन किया गया था अनुक्रम मीरा 11 के साथ इकट्ठे हुए थे समानार्थी दृश्य काले रंग में दिखाई देते हैं एफ़एल II मान्यता साइट रेखांकित रेखांकित करता है। आईयूपीएसी न्यूक्लियोटाइड कोड: आर (ए या जी) और के (जी या टी)। निर्माण: आरपीओडी (लाल), सीआईजीए (नीला), कल्पना 1 अनुक्रम ( आरपीओडी σ1-σ2-siga σ3-σ4), और कल्पना 2 अनुक्रम ( एसआईजीए σ1-σ2-rpoD σ3-σ4)। इस आंकड़े के एक बड़े संस्करण को देखने के लिए कृपया यहां क्लिक करें

उपाय अवयव अनुदेश
मात्रा यौगिक
लुरी-बर्टानी (एलबी) शोरबा 5 ग्राम खमीर निकालने पानी में सभी घटकों को भंग। आटोक्लेव। उपयोग होने तक कमरे के तापमान पर स्टोर करें। ठोस एलबी शोरबा के लिए, व्यंजन के 15 जी जीवाणुओं के लिए जोड़ें।
10 ग्राम कैसिइन पेप्टाइन
10 ग्राम सोडियम क्लोराइड
1 एल तक डबल डिस्टिल्ड वॉटर
एलबी / एएमपी / एक्स-गैल / आईपीटीजी प्लेट्स 100 एमएल पिघल ठोस एलबी शोरबा एलबी ब्रोथ को समशीतोष्ण करने के लिए सभी घटकों को जोड़ें। पेट्री डिश भरें और जब तक वे जमना न करें। बन्सन बर्नर पर साफ लामिना का प्रवाह हुड में कदम उठाएं।
100 μL एम्पीसिलीन (एएमपी) [100 मिलीग्राम / एमएल]
100 μL एक्स-गैल [20 मिलीग्राम / एमएल]
50 μL 1 एम आईपीटीजी समाधान
पेप्टाइन खमीर (पीवाई) शोरबा 3 जी खमीर निकालने पानी में सभी घटकों को भंग। आटोक्लेव। उपयोग होने तक कमरे के तापमान पर स्टोर करें। ठोस पीवाई शोरबा के लिए, रेचक के लिए जीवाणु संबंधी 15 ग्राम जोड़ें। आर एटली संस्कृति के लिए उपयोग करने से पहले 700 एमएल 1 एम CaCl 2 समाधान जोड़ें।
5 ग्राम कैसिइन पेप्टाइन
1 एल तक डबल डिस्टिल्ड वॉटर
PY / CaCl 2 / नल प्लेटें 100 एमएल पिघल ठोस पीवाई शोरबा शीतल पीई शोरबा के लिए सभी घटकों को जोड़ें। पेट्री डिश भरें और तब तक इंतजार करें जब तक वे मजबूत न हों। बन्सन बर्नर पर साफ लामिना का प्रवाह हुड में कदम उठाएं।
700 μL 1 एम CaCl 2 समाधान
100 μL नालिडेक्सिक एसिड (नल) [20 मिलीग्राम / एमएल]
1 एम कैल्शियम क्लोराइड (CaCl 2 ) समाधान 11.1 ग्राम CaCl 2 पानी में CaCl 2 भंग। आटोक्लेव। कमरे के तापमान पर रखो।
100 एमएल तक डबल डिस्टिल्ड वॉटर
ट्राइस-ईडीटीए (ते) 10: 1 पीएच 8.0 1 एमएल 1 एम ट्रिस समाधान सभी घटकों को मिलाएं आटोक्लेव। कमरे के तापमान पर रखो।
400 μL 0.25 एम EDTA समाधान
100 एमएल तक डबल डिस्टिल्ड वॉटर
ते 50:20 पीएच 8.0 5 एमएल 1 एम ट्रिस समाधान सभी घटकों को मिलाएं आटोक्लेव। कमरे के तापमान पर स्टोर करें/ Td>
8 एमएल 0.25 एम EDTA समाधान
100 एमएल तक डबल डिस्टिल्ड वॉटर
ते 10: 1 10 मिमी NaCl समाधान 58.4 मिलीग्राम सोडियम क्लोराइड TE 10: 1 में NaCl भंग करें आटोक्लेव। कमरे के तापमान पर रखो।
100 एमएल तक ते 10: 1 पीएच 8.0 समाधान
विश्लेषण समाधान मैं 80 मिलीग्राम लाइसोजाइम पानी में सभी घटकों को भंग कर मिलाएं। फ़िल्टर 0.22 माइक्रोन फिल्टर का उपयोग कर बाँझ। कमरे के तापमान पर रखो।
2 एमएल 0.5 एम ग्लूकोज समाधान
400 μL 0.5 एम EDTA समाधान
500 μL 1 एम ट्रिस समाधान
20 एमएल तक निष्फल डबल डिस्टिल्ड वॉटर
विश्लेषण समाधान II 1.2 एमएल 5 एम सोडियम हाइड्रोक्साइड (NaOH) समाधान पानी में सभी घटकों को भंग। फ़िल्टर 0.22 माइक्रोन फिल्टर का उपयोग कर बाँझ। कमरे के तापमान पर रखो।
3 एमएल 10% सोडियम डाइडेस्किल सल्फेट (एसडीएस) समाधान
30 एमएल तक निष्फल डबल डिस्टिल्ड वॉटर
विश्लेषण समाधान III 29.4 ग्राम पोटेशियम एसीटेट (सीए 3 सीओके) पानी में सभी घटकों को भंग कर मिलाएं। फ़िल्टर 0.22 माइक्रोन फिल्टर का उपयोग कर बाँझ। कमरे के तापमान पर रखो।
11.5 एमएल पूर्ण एसिटिक एसिड (सीएच 3 सीओओओएच)
100 एमएल तक निष्फल डबल डिस्टिल्ड वॉटर
1 एम मैग्नीशियम क्लोराइड (एमजीसीएल 2 ) समाधान 9.5 ग्राम एमजीसीएल 2 डब्ल्यू एमजीसीएल 2 में डोलोअटर। आटोक्लेव। कमरे के तापमान पर रखो।
100 एमएल तक डबल डिस्टिल्ड वॉटर
3 एम सोडियम एसीटेट (सीए 3 COONA) समाधान 24.6 ग्राम सीए 3 सीओओ पानी में सीए 3 COONa भंग। आटोक्लेव। कमरे के तापमान पर रखो
100 एमएल तक डबल डिस्टिल्ड वॉटर
10% एसडीएस समाधान 10 ग्राम एसडीएस कम वेग पर एक चुंबकीय सरगर्मी पट्टी के साथ पानी में एसडीएस भंग। आटोक्लेव। कमरे के तापमान पर रखो।
100 एमएल तक डबल डिस्टिल्ड वॉटर
3 एम सी 3 सीओके समाधान 29.4 ग्राम सीएच 3 कुक पानी में सीए 3 कुक भंग। फ़िल्टर 0.22 माइक्रोन फिल्टर का उपयोग कर बाँझ। कमरे के तापमान पर रखो। 100 एमएल तक निष्फल डबल डिस्टिल्ड वॉटर
प्रोटीनेस के समाधान 5 मिलीग्राम प्रोटीनेस के TE 50:20 समाधान में प्रोटीनेस के कश्मीर भंग करें। 1 घंटे के लिए 37 डिग्री सेल्सियस पर गर्मी -20 डिग्री सेल्सियस पर स्टोर करें
1 एमएल तक ते 50:20 पीएच 8.0 समाधान
RNase समाधान 10 मिलीग्राम RNase पानी में आरएनस भंग। 10 मिनट के लिए 95 डिग्री सेल्सियस पर गर्मी -20 डिग्री सेल्सियस पर स्टोर करें
1 एमएल तक निष्फल अत्याधुनिक पानी
1 एम isopropyl-β-D-thiogalactoside (आईपीटीजी) समाधान 238.3 मिलीग्राम IPTG पानी में आईपीटीजी भंग। फ़िल्टर 0.22 माइक्रोन फिल्टर का उपयोग कर बाँझ। -20 डिग्री सेल्सियस पर स्टोर करें
1 एमएल तक निष्फल अत्याधुनिक पानी
20 मिलीग्राम एक्स-गल पानी में एक्स-गैल भंग। फ़िल्टर 0.22 माइक्रोन फिल्टर का उपयोग कर बाँझ। -20 डिग्री सेल्सियस पर स्टोर करें
1 एमएल तक निष्फल अत्याधुनिक पानी
फिनोल: क्लोरोफॉर्म: आइसोमिल शराब 24: 24: 1 समाधान 24 एमएल फिनोल सभी घटकों को मिलाएं एक एम्बर में बोतल 4 डिग्री सेल्सियस पर स्टोर करें सावधान! खतरनाक पदार्थ। सुरक्षात्मक चश्मा, दस्ताने और कपास प्रयोगशाला गाउन पहनें। एक निष्कर्षण हुड का उपयोग करें संभालने के दौरान बन्सन बर्नर या आग के किसी अन्य स्रोत को चालू न करें। वैकल्पिक: वाणिज्यिक फिनोल का उपयोग करें: क्लोरोफॉर्म: आइसोमिल शराब 25: 24: 1 समाधान
24 एमएल क्लोरोफार्म
1 एमएल आइसोमिल अल्कोहल
0.5 एम ग्लूकोज समाधान 9 ग्राम जीlucose पानी में ग्लूकोज भंग करना फ़िल्टर 0.22 माइक्रोन फिल्टर का उपयोग कर बाँझ। कमरे के तापमान पर रखो।
100 एमएल तक निष्फल अत्याधुनिक पानी
0.5 एम एथिलेनेमियानेटेटेट्रैसिटिक एसिड (EDTA) पीएच 8.0 समाधान 14.6 जी EDTA पानी में EDTA भंग। 5 एम NaOH समाधान के साथ पीएच समायोजित करें आटोक्लेव। कमरे के तापमान पर रखो।
100 एमएल तक डबल डिस्टिल्ड वॉटर
0.25 एम EDTA पीएच 8.0 समाधान 7.3 जी EDTA पानी में EDTA भंग। 5 एम NaOH समाधान के साथ पीएच समायोजित करें आटोक्लेव। कमरे के तापमान पर रखो।
100 एमएल तक डबल डिस्टिल्ड वॉटर
1 एम ट्रिस पीएच 8.0 समाधान 12.1 ग्राम Tris पानी में Tris भंग। साथ पीएच समायोजित करेंपूर्ण हाइड्रोक्लोरिक एसिड (एचसीएल) आटोक्लेव। कमरे के तापमान पर रखो।
100 एमएल तक डबल डिस्टिल्ड वॉटर
5 एम सोडियम हाइड्रोक्साइड (NaOH) समाधान 19.9 ग्राम NaOH पानी में NaOH भंग। कमरे के तापमान पर रखो। सावधान! कास्टिक परिसर
100 एमएल तक निष्फल डबल डिस्टिल्ड वॉटर
0.1 एम नोओएच समाधान 39 9 मिलीग्राम NaOH पानी में NaOH भंग। कमरे के तापमान पर रखो।
100 एमएल तक निष्फल डबल डिस्टिल्ड वॉटर
नालिडेक्सिक एसिड (नाल) स्टॉक समाधान 60 मिलीग्राम नालिडेक्सिक एसिड पानी में नल भंग। फ़िल्टर 0.22 माइक्रोन फिल्टर का उपयोग कर बाँझ। 4 डिग्री सेल्सियस पर स्टोर करें
3 एमएल तक 0.1 एमएनएओएच समाधान
एम्पीसिलीन (एएमपी) शेयर समाधान 300 मिलीग्राम एम्पीसिलीन पानी में एम्पी भंग। फ़िल्टर 0.22 माइक्रोन फिल्टर का उपयोग कर बाँझ। 4 डिग्री सेल्सियस पर स्टोर करें
3 एमएल तक निष्फल डबल डिस्टिल्ड वॉटर
10x ट्रिस-एसीटेट-ईडीटीए बफर 48.4 ग्राम Tris पानी में सभी घटकों को भंग। आटोक्लेव। कमरे के तापमान पर रखो।
20 मिलीलीटर 0.5 एम EDTA समाधान
11.44 मिलीलीटर ग्लासिएल एसिटिक एसिड
1 एल तक डबल डिस्टिल्ड वॉटर

तालिका 1: समाधान तैयारी समाधान की तैयारी के लिए निर्देश

नहीं। कोड अनुक्रम लंबाई (एनटी) विशेषताएं
1 RpoD-FWD जीसी टीसीटागा जीए आगागा टाटैटाटगगैगकाएएसीसीसीसीजीसीएजीटीएए 43 एक्सबाआई साइट; जंगली प्रकार की जीन प्रवर्धन और वेक्टर क्लोनिंग
2 छड़ के REV जीजीटीएसीसी टीटीएटीसीजीटीसीएजीएजीएसीसीएसीजी 29 केपीएनआई साइट; जंगली प्रकार की जीन प्रवर्धन और वेक्टर क्लोनिंग
3 Siga-FWD जीसी टीसीटागा जीए आगागा टाटैटाटग जीकाएएएजीजीटीएएएजीएजी 43 एक्सबाआई साइट; जंगली प्रकार की जीन प्रवर्धन और वेक्टर क्लोनिंग
4 Siga-REV जीजीटीएसीसी TTAGCTGTCCAGAAAGCTTCT </ Td> 29 केपीएनआई साइट; जंगली प्रकार की जीन प्रवर्धन और वेक्टर क्लोनिंग
3 AmpR-FWD एसी एक्टैगेट ग्यागताएगाट 21 स्पीआई साइट डाली, प्रतिरूप उत्परिवर्तन Ampr जीन का विघटन
4 AmpR-REV टीसी एक्टैग GTTTCTGGGTGAG 21 स्पीआई साइट डाली, प्रतिरूप उत्परिवर्तन Ampr जीन का विघटन
5 σ2RpoD-FWD ए.ए. सीटीएटीएजी जीसीटीजीजीटीटीटीटीटीटीटीसीजीसीटी 27 AflII साइट को सम्मिलित किया गया, प्रतिरूप उत्परिवर्तन। Chim01-02 का निर्माण
6 σ2RpoD-REV जीसी सीटीएटीएजी टीटीसी जीसीटीटीसीएएसीसीटीएटीटीटी 27 AflII साइट को सम्मिलित किया गया, प्रतिरूप उत्परिवर्तन। Chim01-02 का निर्माण
7 σ2SigA-FWD ए.ए. CTTAAG जीसीटीसीजीटीसीटीटीटीसीएएटीसीजीसीसी 27 AflII साइट को सम्मिलित किया गया, प्रतिरूप उत्परिवर्तन। Chim01-02 का निर्माण
8 σ2SigA-REV जीसी सीटीएटीएजी टीटीसीजीटीटीसीजीएसीसीटीटीटीसीटीटी 27 AflII साइट को सम्मिलित किया गया, प्रतिरूप उत्परिवर्तन। Chim01-02 का निर्माण

तालिका 2: ओलिगोन्यूक्लियोटाइड अनुक्रम प्रतिबंध एंजाइम साइटें रेखांकित होती हैं रिबोसम बाध्यकारी साइट: बोल्ड

निर्माण अनुक्रम फ़ाइल गुणवत्ता फ़ाइल
chimera01 chim01_out.unpadded.fasta chim01_out.unpadded.fasta.qual
chim01_A3 / बी 3 / E2 / एफ 2 / G2 /H2.pdf
chimera02 chim02_out.unpadded.fasta chim02_out.unpadded.fasta.qual
chim02_C3 / डी 3 / ई 3 / F3 / G3 / H3.pdf
rpoD rpod_out.unpadded.fasta rpod_out.unpadded.fasta.qual
SIGA siga_out.unpadded.fasta siga_out.unpadded.fasta.qual

तालिका 3: एमआईआरए कोडांतरक और डीएनए सीक्वेंसर से प्राप्त अनुक्रम फाइलें मैरिंग 11 सॉफ़्टवेयर के साथ मैमेरिंग ऑप्शन का इस्तेमाल करते हुए चिमारिक और वन्य प्रकार के निर्माण से जुड़ी सेंगर सिकेंजिंग को इकट्ठा किया गया था। चिमरा अनुक्रमण के क्रोमैटोग्राम को पीडीएफ फाइलों के रूप में दिखाई देता है

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

सीएपीआरआरएसआई को पीआरएम 2 के विकल्प के रूप में डिजाइन किया गया था। मूल पीआरएम एक शक्तिशाली तकनीक है; यह चयनित जीन के किसी भी हिस्से के साथ डीएनए दृश्यों के संलयन के लिए अनुमति देता है। पीआरएम के लिए, वैनिटीइप जीन को समान प्लाज्मिड में क्लोन किया जाना चाहिए। उसके बाद, ऑलिगोनक्लियोटाइड्स प्लिमिड पर पाए जाने वाले जंगली प्रकार और एंटीबायोटिक दवाओं के प्रतिरोध के भीतर डिज़ाइन की जाती हैं। कुंठित, उच्च निष्ठा डीएनए पोलीमरेज़ और पहले डिज़ाइन किए गए ओलिगोनक्लियोटाइड्स का उपयोग करके पीसीआर द्वारा प्लास्मिड व्यवधान प्राप्त किया जाता है। पूरक पीसीआर उत्पादों की लगीकरण चिरागिक जीन को इकट्ठा करती है और एंटीबायोटिक्स प्रतिरोध कैसेट को पुनर्स्थापित करती है, जिससे कार्यात्मक प्लाज्मिड वसूली होती है। पीआरएम एक ही प्लाज्मिड पृष्ठभूमि पर चिराजी जीन पुस्तकालयों के निर्माण को सक्षम बनाता है। दुर्भाग्य से, कुंद-समाप्त डीएनए अनुक्रमों का बंधन तकनीकी रूप से कठिन हो सकता है। पीसीआर टुकड़े ओवरलैपिंग द्वारा कल्पना विधानसभा 1 को भी यह आवश्यक है कि डीएनए पोलीमरेज़ मुंहतोड़ उत्पादों का उत्पादन करते हैं औरप्रत्येक प्रतिक्रिया के लिए डीएनए शुद्धि इस तकनीक द्वारा एकत्रित चिरागिक जीन रैखिक डीएनए उत्पादों हैं। लक्ष्य वेक्टर में प्रत्येक निर्माण का क्लोनिंग आगे के विश्लेषण में देरी कर सकता है।

पीआरएम की कई शक्तियों से कैप्रेसी लाभ और समानार्थक डीएनए अनुक्रम क्षेत्रों पर प्रतिबंध एंजाइम साइटों का उपयोग करके पूरक डीएनए टुकड़े के बंधन को सरल करता है। इन कारणों के लिए, सीएपीआरआरआई को कुंद-समाप्त डीएनए पोलीमरेज़ की आवश्यकता नहीं है। समानार्थक डीएनए अनुक्रमों का इस्तेमाल चिमरा विधानसभा के लिए संलयन स्थलों को रोकता है, लेकिन बाघ दक्षता को बढ़ाता है। सीएपीआरआरएसआई में शुरू की गई एक और महत्वपूर्ण संशोधन यह है कि चिमरास पीयूसी 18/1 9 वैक्टर में इकट्ठे और संभाला जाता है। इन वैक्टर के पास कई लाभप्रद विशेषताएं हैं, जैसा कि पहले बताया गया था। ई। कोलाई मेजबानों में निर्माण वेक्टर का प्रचार करके चिमेर डीएनए प्राप्त किया जा सकता है। अंतिम प्लाज्मिड ( उदाहरण के लिए , एक अभिव्यक्ति वेक्टर) में चिरात्मक जीन के बाद क्लोनिंग कभी-कभीकी आवश्यकता है।

कैप्रृसी डीएनए और एमिनो एसिड अनुक्रमों के सिलिको से निपटने में भी निर्भर है। एड हॉक पर्ल स्क्रिप्ट जंगली स्वरूप जीनों को क्लोन करने के लिए उचित प्रतिबंध एंजाइम के चयन को सक्षम करता है, ब्रेक क्षेत्र (चीमां विधानसभा के लिए) के समस्त सभी समानार्थक डीएनए अनुक्रमों की गणना और प्लाज्मिड वसूली को सरल बनाने के लिए प्रतिबंध एंजाइमों की पहचान। इन स्थितियों को देखते हुए, सीएपीआरआरएसआई प्रोटीन-कोडिंग जीन को फ्यूज़ करने के लिए एक विकल्प है। CAPRRESI प्रोटोकॉल के महत्वपूर्ण कदम हैं: 1) तोड़ने वाले क्षेत्रों का चयन और 2) पीसीआर उत्पादों की शुद्धि। ब्रेकिंग क्षेत्र फैले हुए हैं जहां समानार्थक अनुक्रम की गणना की जाती है, प्रतिबंध एंजाइम साइटें, जो जंगली सूक्ष्म दृश्यों पर नहीं देखी जाती हैं चिमड़ा विधानसभा के प्रतिबंध एंजाइम साइटों का उपयोग डीएनए पोलीमरेज़ की आवश्यकता को समाप्त करता है, जो मुंहतोड़ उत्पादों को मुहैया कराता है और ligation प्रतिक्रिया को आसान बनाता है। सभी क्षेत्रों में प्रतिबंध योग्य एंजाइम साइट नहीं होंगे; के लिएइस कारण से, एक बार में एक एमिनो एसिड द्वारा ब्रेकिंग क्षेत्रों को स्थानांतरित करने की सिफारिश की जाती है जब तक कि सबसे अच्छा अनुक्रम खिंचाव नहीं मिल जाता है। यदि सिल्लिक डिजाइन में ब्रेकिंग क्षेत्रों की गति के लिए अनुमति नहीं दी जाती है या अनुक्रम उपयुक्त प्रतिबंध एंजाइम साइटों के साथ समानार्थक डीएनए अनुक्रम की कमी करता है, तो ओलिगोन्यूक्लियोटाइड ओवरलैपिंग का उपयोग करते हुए लक्ष्य जीन को फ्यूज करने और ampicillin प्रतिरोध जीन में समानार्थक डीएनए अनुक्रमों को पेश करने की सिफारिश की जाती है। (वेक्टर पर पाया) केवल इस तरह, जीनों को किसी भी हिस्से में जोड़ा जा सकता है और प्लास्मिड वसूली एक अद्वितीय साइट (केवल एक प्रतिबंध एंजाइम के साथ पचा) की बाध्यता पर निर्भर करता है। CAPPRESI की लचीलापन इसके लिए अन्य तकनीकों के साथ संयोजन में प्रदर्शन की अनुमति देता है

पूरक डीएनए टुकड़े के बंधन के बाद माता पिता के प्लाज्मिड संदूषण की संभावना कम करने के लिए, पीसीआर उत्पादों के शुद्धि को टेम्पलेट डीएनए को खत्म करने के लिए किया जाता है। इन दो महत्वपूर्ण चरणों को पूरा करना बीएसी को बढ़ाती हैटेरियल रूपांतरण दक्षता (सही तरीके से इकट्ठे निर्माण की संख्या), जिससे कैपरेसी को या तो रासायनिक सक्षम (CaCl 2 ) या इलेक्ट्रोकोपाइंट ई। कोलाई कोशिकाओं के साथ पेश किया जा सकता है। सबसे पहले प्रकार की सक्षम कोशिकाओं ई। कोलाई संस्कृतियों के सबसे सस्ता स्रोत का प्रतिनिधित्व करती हैं, जो अधिकांश प्रयोगशालाओं में बैक्टीरियल परिवर्तन के लिए नियोजित होती हैं। पहले दिखाए गए सभी सुविधाओं के कारण, सीएपीआरईआरईईईईएमआरएस को इकट्ठा करने के लिए एक उपयोगी विकल्प का प्रतिनिधित्व करता है।

इसके अलावा, कैपरीसी पीसीआर के टुकड़े या प्लाज्मिड वसूली तकनीकों के साथ संयोजन में काम कर सकता है। उदाहरण के लिए, पूरक डीएनए भाग प्रति दो समानार्थक अनुक्रमों को सम्मिलित करने के बजाय, वांछित इलाके (लक्षित जंगली प्रकार के जीनों पर) हस्तक्षेप करने वाले ओलिगोन्यूक्लियोटाइड्स का उपयोग मध्यवर्ती दृश्यों को फ्यूज़ कर सकता है। समानार्थक अनुक्रमों की शुरूआत पीयूसी 18/1 9 वैक्टर की एम्प्रर जीन तक सीमित हो सकती है, जिससे प्लास्मी को बहाल करने के लिए केवल एक प्रतिबंध एंजाइम का इस्तेमाल होता हैघ अखंडता ये भविष्य के अनुप्रयोग किसी भी प्रकार के डीएनए दृश्यों ( यानी, प्रोटीन-कोडिंग जीन न केवल), लिजी दक्षता से समझौता किए बिना, संलयन के लिए सीएपीआरआरएसई को मजबूत कर सकते हैं।

सीएपीआरआरएसएआई की जांच के लिए, दो चिमनी सिग्मा कारकों को दो जंगली प्राथमिक सिग्मा कारक जीनों के क्षेत्रों का आदान-प्रदान करके इकट्ठा किया गया: आरपीओडी ( ई। कोलाई ) और सिगा ( आर एटली ) सभी ज्ञात प्राथमिक सिग्मा कारकों में चार डोमेन होते हैं, σ1 से σ4 8 कल्पना 01 में आरपोडीस 1-σ2 और SigAσ3-σ4 के होते हैं, जबकि चिरेरा 02 में सीगएसर 1-σ2 और RpoDσ3-σ4 है। चिमार निर्माण की अखंडता को सेंगर अनुक्रमण 10 ( चित्रा 2 ) द्वारा सत्यापित किया गया था।

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखकों ने घोषणा की है कि उनके पास कोई प्रतिस्पर्धी वित्तीय हित नहीं है

Acknowledgments

यह काम कांज़ोजो नेसिओनल डी सेनेसीया वाई टेकनोलॉजिआ, कोंकायटी, मैक्सिको (अनुदान संख्या 154833) और यूनिवर्सिडैड नेसिअनल ऑटोनोमा डी मेक्सिको द्वारा समर्थित था लेखक अपने प्रशासनिक और तकनीकी सलाह के लिए विक्टर गोंजालेज़, रोजा आई। संतैमारिया, पेट्रीसिया बस्टोस और सोलएडड जुआरेज़ को धन्यवाद देना चाहते हैं।

Materials

Name Company Catalog Number Comments
Platinum Taq DNA polymerase High Fidelity Thermo Fisher 11304011 Produces a mix of blunt/3’-A overhang ended PCR products
High pure plasmid isolation kit Roche 11754785001 Used for all plasmid purification reactions
High pure PCR product purification kit Roche 11732676001 Used for all PCR purification reactions from agarose gels
AflII restriction enzyme New England Biolabs R0520L Recognizes sequence 5’-CTTAAG-3’ and cuts at 37 °C
KpnI-HF restriction enzyme New England Biolabs R3142L Recognizes sequence 5’-GGTACC-3’ and cuts at 37 °C
SpeI-HF restriction enzyme New England Biolabs R3133L Recognizes sequence 5’-ACTAGT-3’ and cuts at 37 °C
XbaI restriction enzyme New England Biolabs R0145L Recognizes sequence 5’-TCTAGA-3’ and cuts at 37 °C
Ampicillin sodium salt Sigma Aldrich A0166-5G Antibiotics
Nalidixic acid Sigma Aldrich N8878-5G Antibiotics
Yeast Extract Sigma Aldrich Y1625-1KG Bacterial cell culture
Casein peptone Sigma Aldrich 70171-500G Bacterial cell culture
NaCl Sigma Aldrich S9888-1KG Sodium chloride
Agar Sigma Aldrich 05040-1KG Bacterial cell culture
XbaI restriction enzyme Thermo Fisher FD0684 Fast digest XbaI enzyme
KpnI restriction enzyme Thermo Fisher FD0524 Fast digest KpnI enzyme
Quick Ligation Kit New England Biolabs M2200S Fast DNA ligation kit
AflII restriction enzyme Thermo Fisher FD0834 Fast digest AflII enzyme
SpeI restriction enzyme Thermo Fisher FD1253 Fast digest SpeI enzyme

DOWNLOAD MATERIALS LIST

References

  1. Horton, R. M., Hunt, H. D., Ho, S. N., Pullen, J. K., Pease, L. R. Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene. 77, (1), 61-68 (1989).
  2. Vos, M. J., Kampinga, H. H. A PCR amplification strategy for unrestricted generation of chimeric genes. Anal. Biochem. 380, (2), 338-340 (2008).
  3. Hawkins, N. C., Garriga, G., Beh, C. T. Creating Precise GFP Fusions in Plasmids Using Yeast Homologous Recombination. Biotechniques. 34, (1), 1-5 (2003).
  4. Sander, J. D., Joung, J. K. CRISPR-Cas systems for editing, regulating and targeting genomes. Nat Biotechnol. 32, (4), 347-355 (2014).
  5. Nagy, A. Cre recombinase: The universal reagent for genome tailoring. Genesis. 26, (2), 99-109 (2000).
  6. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods. 6, (5), 343-345 (2009).
  7. Norrander, J., Kempe, T., Messing, J. Construction of improved M13 vectors using oligodeoxynucleotide-directed mutagenesis. Gene. 26, (1), 101-106 (1983).
  8. Gruber, T. M., Gross, C. A. Multiple sigma subunits and the partitioning of bacterial transcription space. Annu Rev Microbiol. 57, 441-466 (2003).
  9. Edgar, R. C. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 32, (5), 1792-1797 (2004).
  10. Macrogen Inc. Seoul, Rep. Of Korea. Available from: http://dna.macrogen.com/eng/index.jsp (2016).
  11. Chevreux, B. MIRA: an automated genome and EST assembler. Available from: http://www.chevreux.org/thesis/index.html 1-161 (2005).
  12. Thompson, J. D., Gibson, T. J., Higgins, D. G. Multiple sequence alignment using ClustalW and ClustalX. Curr Protoc Bioinformatics. Chapter 2 (Unit 2.3) 1-22 (2002).
  13. Sambrook, J., Russell, D. W. Molecular Cloning: A laboratory manual. CSHLP. (2001).
  14. Rutherford, K., et al. Artemis: sequence visualization and annotation. Bioinformatics. 16, (10), 944-945 (2000).
कैप्रेशेसी: प्लिमिड रिकवरी एंड प्रतिबंध एन्जाइम साइट इनर्सरेशन द्वारा कल्पना विधानसभा
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Santillán, O., Ramírez-Romero, M. A., Dávila, G. CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion. J. Vis. Exp. (124), e55526, doi:10.3791/55526 (2017).More

Santillán, O., Ramírez-Romero, M. A., Dávila, G. CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion. J. Vis. Exp. (124), e55526, doi:10.3791/55526 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter