Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

CAPRRESI: Chimera Assembly genom Plasmid Recovery och Restriction Enzym Site Insertion

doi: 10.3791/55526 Published: June 25, 2017

Summary

Här presenterar vi chimärmontering genom plasmidåtervinning och restriktionsenzymställeinsättning (CAPRRESI), ett protokoll baserat på införandet av restriktionsenzymställen i synonym-DNA-sekvenser och funktionell plasmidåtervinning. Detta protokoll är en snabb och billig metod för att fusera proteinkodande gener.

Abstract

Här presenterar vi chimera-montering genom plasmidåtervinning och restriktionsenzymställeinsättning (CAPRRESI). CAPRRESI drar fördel av många styrkor i den ursprungliga plasmidåtervinningsförfarandet och introducerar restriktionsenzym digerering för att underlätta DNA-ligeringsreaktioner (krävs för chimärmontering). För detta protokoll klonar användarna vildtypgener i samma plasmid (pUC18 eller pUC19). Efter det i silikoselektionen av aminosyrasekvensområden där chimärer ska monteras, erhåller användarna alla de synonym-DNA-sekvenser som kodar för dem. Ad hoc Perl-skript ger användarna möjlighet att bestämma alla synonym-DNA-sekvenser. Efter detta steg söker ett annat Perl-skript för restriktionsenzymställen på alla synonym-DNA-sekvenser. Detta i silicoanalys utförs också med användning av ampicillinresistensgenen ( ampR ) som finns på pUC18 / 19-plasmider. Användare designar oligonukleotider inom synonymområdena för att störa vildtyp och ampR- gener genom PCR. Efter obtSammansmältning och rening av komplementära DNA-fragment, uppnås restriktionsenzym digestion. Kimamasammansättningen uppnås genom att ligera lämpliga komplementära DNA-fragment. PUC18 / 19 vektorer väljs för CAPRRESI eftersom de erbjuder tekniska fördelar, såsom liten storlek (2 686 baspar), högkopieringsnummer, fördelaktiga sekvenseringsreaktionsegenskaper och kommersiell tillgänglighet. Användningen av restriktionsenzymer för chimergaggregation eliminerar behovet av DNA-polymeraser, vilket ger upphov till trubbiga produkter. CAPRRESI är en snabb och billig metod för att fusera proteinkodande gener.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Chimärgenenheten har använts i stor utsträckning i molekylärbiologi för att belysa proteinfunktionen och / eller för biotekniska ändamål. Olika metoder finns för fusionsgener, såsom överlappande PCR-produktförstärkning 1 , plasmidåtervinning 2 , homolog rekombination 3 , CRISPR-Cas9-system 4 , platsreglerad rekombination 5 och Gibson-sammansättning 6 . Var och en av dessa erbjuder olika tekniska fördelar; Till exempel flexibiliteten hos överlappande PCR-konstruktion, valet av in vivo konstruktioner under plasmidåtervinning eller hög effektivitet av CRISPR-Cas9 och Gibson-system. Å andra sidan kan vissa svårigheter uppstå vid utförande av några av dessa metoder. Till exempel är de två första tillvägagångssätten beroende av trubbiga DNA-fragment, och ligering av dessa typer av produkter kan vara tekniskt utmanande jämfört med sticktKy-ändig ligering. Site-directed rekombination kan lämna spår av extra DNA-sekvenser (ärr) på originalet, som i CrexxP-systemet 5 . CRISPR-Cas9 kan ibland modifiera andra genomregioner utöver målplatsen 4 .

Här introducerar vi chimärmontering genom plasmidåtervinning och restriktionsenzymställeinsättning (CAPRRESI), ett protokoll för fusion av proteinkodande gener som kombinerar plasmidåtervinningsmetoden (PRM) med införandet av restriktionsenzymställen på synonym-DNA-sekvenser, förbättrande ligeringseffektivitet . För att säkerställa aminosyrasekvensintegritet insättas restriktionsenzymställen på synonyms DNA-sekvenssträckor. Bland fördelarna med CAPPRESI är att det kan utföras med vanliga laboratoriereagenser / verktyg ( t.ex. enzymer, kompetenta celler, lösningar och termocykler) och att det kan ge snabba resultat (när lämpliga enzymer används). Lita på begränsningEnzymställen som kommer från synonym-DNA-sekvenser kan begränsa urvalet av exakta fusionspunkter inom proteinerna av intresse. I sådana fall bör målgener fusioneras med användning av överlappande oligonukleotider, och restriktionsenzymställen bör införas på vektorens resistensgen.

CAPRRESI består av sju enkla steg ( Figur 1 ): 1) Val av kloningsvektor, pUC18 eller pUC196; 2) i silikoanalys av vildtypsekvenserna som skall fusioneras; 3) selektion av brytregioner för chimärmontering och plasmidavbrott; 4) i silico- generering av synonym-DNA-sekvenser innehållande restriktionsenzymställen; 5) oberoende kloning av vildtypgenerna i den valda plasmiden; 6) plasmidstörning genom PCR, följt av restriktionsenzym-digestion; Och 7) plasmidåtervinning med användning av DNA-ligering och bakteriell transformation. Chimära gener som framställs genom denna teknik bör verifieras wI följd.

PUC18 / 19-vektorerna erbjuder tekniska fördelar för kloning och chimärmontering, såsom liten storlek ( dvs. 2 686 baspar), högkopiantal, fördelaktiga sekvenseringsreaktionsegenskaper och kommersiell tillgänglighet 7 . Här användes en Escherichia coli värd för att montera och hantera chimärerna eftersom bakteriekulturer är billiga och växer snabbt. Med tanke på detta kommer efterföljande kloning av fusionsfragmenten i de slutliga målplasmiderna att behövas (t ex expressionsvektorer som pRK415 i bakterier eller pCMV i däggdjursceller).

CAPRRESI testades för att fusera två primära sigmafaktorgener: E. colirpoD och Rhizobium etlisigA . Primär-sigmafaktorer är RNA-polymeras-subenheter som är ansvariga för transkriptionsinitiering, och de består av fyra domäner ( dvs σ1, σ2, σ3 och σ4) 8 . Aminosyrasekvensen längsH av proteiner kodade av rpoD och sigA är 613 respektive 685. RpoD och SigA delar 48% identitet (98% täckning). Dessa primära sigmafaktorer delades upp i två komplementära fragment mellan regionerna σ2 och σ3. Två chimära gener sammanställdes enligt denna design: chimera 01 (RpoDσ1-σ2 + SigAσ3-σ4) och chimär 02 (SigAσ1-σ2 + RpoDσ3-σ4). DNA-fusionsprodukter verifierades genom sekvensering.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. CAPRRESI-protokollet

OBS! Figur 1 representerar det övergripande CAPRRESI-protokollet. Denna teknik är baserad på en silikondesign och den efterföljande konstruktionen av de önskade chimärerna.

  1. Urval av kloningsplasmiden, pUC18 eller pUC19.
    1. Välj pUC-vektorn som bäst passar tekniska krav.
      OBS! Båda vektorerna har samma sekvens, förutom orienteringen av multipelkloningsstället. Detta är viktigt för utformningen av oligonukleotider och PCR-plasmidavbrottet.
  2. Vid silikoanalys av vildtypgenerna och pUC18 / 19-sekvenserna.
    1. Hämta DNA-sekvenserna av vildtypgenerna och spara dem i en FASTA-formatfil ( t.ex. genes.fas).
      OBS: Sekvenserna av pUC18 / 19 vektorer finns i pUC.fas-filen ( Figur 1 , steg 1).
    2. Bestäm vilken begränsning osvYmes skar inte vildtypgenerna och pUC18 / 19-sekvenserna genom att köra REsearch.pl-skriptet. Alternativt, utföra en sökning med restriktionsenzymsökning med ett onlineverktyg ( Figur 1 , steg 2).
      1. Skriv följande i en terminal:
        Perl REsearch.pl genes.fas
        Perl REsearch.pl pUC.fas
        OBS! Dessa kommandon skapar följande utdatafiler: genes_lin.fas, genes_re.fas, pUC_lin.fas och pUC_re.fas.
      2. Välj lämpliga restriktionsenzymer för kloning av vildtypgenerna i multipelkloningsstället för den valda pUC18 / 19-vektorn genom att jämföra genes_re.fas- och pUC.fas-filerna. Välj inläggets orientering i förhållande till ampicillinresistensgenen ( ampR ) hos pUC18 / 19-vektorn.
    3. Designa framåt och bakåt-oligonukleotider för att amplifiera den kodande regionen hos vildtypgenerna (externa oligonukleotider). Inkludera rätt restriktionsenzym-plats vid varje 5'-ändeAv oligonukleotiderna; Detta kommer att definiera inläggsorienteringen.
      1. Inkludera en funktionell ribosombindningsplats i de framåtriktade oligonukleotiderna.
      2. Sätt in båda vildtypgenerna i samma orientering inuti vektorn.
  3. Urval av brytregionerna för chimärmontering och plasmidstörning.
    1. Hämta aminosyrasekvensen för vildtypen och ampR- generna genom att köra translate.pl-skriptet ( Figur 1 , steg 3).
      1. Skriv följande i en terminal:
        Perl translate.pl genes.fas
        Perl translate.pl ampR.fas

        OBS! Detta skript skapar följande utdatafiler: genes_aa.fas och ampR_aa.fas.
    2. Anpassa globalt de två wildtyp aminosyrasekvenserna med en lämplig programvara ( t.ex. MUSCLE) 9 .
    3. Välj önskade brytregioner (3-6 aminosyror) för chimera asseMbly baserat på sekvensinriktningen. Spara dem i en fil i FASTA-format ( t.ex. , regions.fas).
    4. Lokalisera DNA-sekvenserna som kodar för den valda aminosyran sträcker sig på båda vildtypgenerna.
  4. Vid silikoproduktion av synonym-DNA-sekvenser innehållande restriktionsenzymställen.
    1. Hämta alla synonym-DNA-sekvenser som kodar för varje aminosyrasekvens sträcker utvalda som brytregioner ( Figur 1 , Steg 4); Dessa sekvenser lagrades i regions.fas-filen.
      1. Skriv följande i en terminal:
        Perl synonym.pl regions.fas
        OBS! Det här skriptet kommer att skapa exportfilen regions_syn.fas.
    2. Sök efter restriktionsenzymställen som finns på synonym DNA-sekvenser.
      1. Skriv följande i en terminal: perl REsynonym.pl regions_syn.fas
        OBS! Det här skriptet kommer att skapa exportfilen regions_syn-re.fas.
    3. Välj ett restriktionsenzym som delas mellan synonym sekvenser av båda vildtypgener; Denna sida kommer att användas för att montera chimärer via restriktionsenzym digestion. Verifiera att det valda restriktionsenzymet inte skar varken vildtypgenerna eller pUC18 / 19 vektorsekvenserna.
      1. Jämför de restriktionsenzymer som finns på generna_re.fas, pUC_re.fas och regions_syn-re.fas-filer.
    4. I silico ersätter originalerna för deras synonym DNA på motsvarande ort på båda vildtypgenerna. Lägg till synonym DNA-sekvenser i vildtypsekvensfilen (genes.fas).
    5. Få aminosyrasekvensen av gener som finns i genes.fas-filen ( perl translate.pl genes.fas ).
    6. Justera aminosyrasekvenserna översatta från vildtyp och synonym DNA-sekvenser. Verifiera att båda sekvenserna är desamma.
    7. Upprepa alla steg i detta avsnitt med ampR- genen som finns på pUC18 / 19 vektor.
      OBS ! Målet är att störa ampR-genet (fil ampR.fas) i två komplementära delar. Restriktionsenzymet som valts för att störa ampR- genen bör vara annorlunda än den som användes för chimärmontering.
  5. Oberoende kloning av de två vildtypgenerna i den valda pUC18 / 19-vektorn (Figur 1, Steg 3).
    1. Rening av det valda pUC18 / 19 plasmid-DNA med användning av ett plasmid-DNA-reningskit.
      1. Exempelvis transformerar E. coli DH5a med pUC18-plasmiden och odlar transformanterna över natten vid 37 ° C på fast LB-0,3 mg / ml ampicillin (Amp). Välj en transformantkoloni, inokulera en ny LB-0.3 mg / ml Amp-platta och odla den över natten vid 37 ° C.
      2. Ta del av den föregående kulturen och odla den i flytande LB-0,3 mg / ml Amp i 6-8 h vid 37 ° C. Extrahera plasmid-DNA med användning av ett kit.
    2. PCR amplifierar vildtypgener från det totala genomiska DNA med användning av appropenYttre oligonukleotider. Använd ett högfidelitets DNA-polymeras om möjligt. Välj DNA-polymeras som maximerar utbytet. Utför PCR enligt tillverkarens riktlinjer och smältpunkten för oligonukleotiderna.
      1. Kör PCR-cykler, beroende på DNA-polymeras, amplikonstorlek, mall och oligonukleotider som användes. Till exempel, för att amplifiera rpoD- DNA, bereda en 50 | il reaktion: 5 | il 10x buffert, 2 | il 50 mM MgSO4, 1 | il 10 mM dNTP-blandning, 2 | il av varje 10 im oligonukleotid (Tabell 2), 2 Μl mall-DNA (totalt E. coli DH5a-DNA), 35,8 jil ultrahalt vatten och 0,2 jil högfidelitets-DNA-polymeras. Kör följande PCR-cykler: 1 min vid 94 ° C för den ursprungliga denatureringen följt av 30 cykler av amplifiering (30 s vid 94 ° C till denaturering, 30 s vid 60 ° C för att annea oligonukleotiderna och 2 min vid 68 ° C att förlänga).
      2. Lös upp 1,2 g avAgaros i 100 ml dubbeldestillerat vatten genom att värma dem i mikrovågsugnen. Montera en gelskiva och kamma och sätt dem i den horisontella gelskivan. Fyll gelfacket med den smälta agaroslösningen och låt den stelna. Ta bort kammen.
      3. Placera gelén i elektrofores kammaren. Fyll kammare med 1x Tris-acetat-EDTA-buffert. Ladda 50 μl PCR-produkter i gelbrunnarna. Elektroforera proverna ( t.ex. vid 110 V i 1 h).
      4. Efter elektrofores, fläck gelén i 100 ml dubbeldestillerat vatten innehållande 100 | il 1 mg / ml etidiumbromidlösning under 10 min med långsam skakning. Tvätta gelén i dubbeldestillerat vatten i ytterligare 10 minuter i långsam skakning. Använd en horisontell shaker.
        Varning: Etidiumbromid är en giftig förening; Använd skyddshandskar och en bomullslaboratoriehölje.
      5. Rening av vildtyp-gen-DNA från motsvarande band av gelén med användning av ett kit. Visualisera banden genom att placera den färgade gelén i en UV-kammare (Rekommenderad våglängd: 300 nm). Håll exponeringen av gelén till ett minimum. Använd ett DNA-reningskit och följ tillverkarens instruktioner.
        Varning: UV-strålning är farlig; Bära skyddskåpa, glasögon och bomullslaboratorium.
    3. Digestera renade vildtypgener och pUC18 / 19 plasmid-DNA med restriktionsenzymerna enligt tillverkarens instruktioner. Använd snabbt matsmältningsenzymer när det är möjligt. Exempelvis digererar 6 μL pUC18-DNA (300 ng / μl) i 10 | il av ultrapure vatten, 2 | il 10X buffert, 1 | il Kpn I-restriktionsenzym och 1 | il av Xbal- restriktionsenzym. Låt reaktionen stå vid 37 ° C under 30 minuter.
      1. Inaktivera restriktionsenzymerna enligt tillverkarens riktlinjer. Exempelvis inaktiverar dubbeldestionsreaktionen Kpn I- Xba I vid 80 ° C i 5 min.
    4. Blanda insats: vektor-DNA vid en volymetrisk ratiO av 3: 1. Följ tillverkarens instruktioner för en ligeringsreaktion. Använd snabb ligeringsenzymer när det är möjligt (lämna reaktionen vid 25 ° C under 10 minuter).
      OBS: Typiskt är DNA-koncentrationen efter rening med användning av satserna tillräckligt bra för digestions- och ligeringsreaktioner. Lägg till till exempel 6 μL rpoD- DNA ( Kpn I- Xba I, 150 ng / μl), 3 pi pUC18-DNA ( Kpn I- Xba I, 150 ng / pi), 10 pi 2x buffert, 1 pi ultraljud Vatten och 1 | il T4-DNA-ligas. Lämna ligeringsreaktion vid 25 ° C under 10 minuter.
    5. Transformera E. coli DH5a med 2-4 μl av ligeringsreaktionen, som beskrivs i kompletterande material. Platta de transformerade cellerna i fasta LB / Amp / X-gal / IPTG-plattor. Låt plattorna över natten ligga vid 37 ° C.
    6. Välj vitfärgade E. coli- kolonier av transformant och stryk dem på en ny LB / Amp-platta. Låt plattorna över natten ligga vid 37 ° C. </ Li>
    7. Utför en koloni-PCR för att välja kandidater för sekvensering av reaktionen, såsom beskrivs i kompletterande material. Extrakt plasmid DNA från kandidater. Alternativt digererar du kandidatplasmid-DNA med samma restriktionsenzymer som används för kloning av insatserna.
    8. Sekvenskandidatkonstruktioner med en sekventeringsleverantör 10 . Montera sekvensen i silico med hjälp av en DNA-monterare 11 ( Figur 1 , steg 5).
  6. Plasmidstörning genom PCR följt av restriktionsenzym digerering.
    1. Design i silico framåt och bakåt-oligonukleotider vid brytregioner för respektive vildtyp och ampR- gener. Substitut i silico vildtypfragmentet för dess motsvarande synonym-DNA-sekvens (erhållen i steg 1.4).
      OBS: Denna synonym DNA-sekvens innehåller ett restriktionsenzymställe. Framåt och omvänd oligonukleotider överlappar vid tHan restriktionsenzymställe. Oligonukleotider bör sträcka sig från 21-27 nukleotider, sluta med en cytosin eller guanin och innehålla ett restriktionsenzymställe. En framåtriktad oligonukleotid har samma sekvens som dess målregion på mall-DNA. En omvänd oligonukleotid är den omvända komplementära sekvensen av målområdet på mall-DNA.
    2. Använd de två vildtypgenkonstruktionerna som DNA-mall för PCR-reaktioner (t ex pUC18 rpoD och pUC18 sigA ). Hämta två komplementära delar av varje konstruktion (pUC18 rpoD σ1-σ2, pUC18 rpoD σ3-σ4, pUC18 sigA σ1-σ2 och pUC18 sigA σ3-σ4) ( Figur 1 , steg 6).
    3. Ladda DNA-prover i en agarosgel 1-1-2% [vikt / volym]. Separera PCR-produkterna från DNA-mallen genom elektrofores ( t.ex. 110 V i 1 h). Alternativt kan du smälta PCR-reaktionerna med Dpn I för att bryta DNA-mallen.
      OBS: DpnJag enzym känner igen endast metylerade DNA-sekvenser (5'-GATC-3 ').
      1. Rening av proven med ett DNA-reningskit. Följ tillverkarens riktlinjer.
    4. Dubbel digerera alla komplementära DNA-fragment med lämpliga restriktionsenzymer enligt tillverkarens anvisningar. Använd snabbspjälkande restriktionsenzymer när det är möjligt. Dubbel digerera pUC18rpoDσ1-σ2 DNA-fragmentet med Afl II och Spe I med tillverkarens protokoll. Låt digestionsreaktionen vid 37 ° C under 15 minuter.
    5. Inaktivera restriktionsenzymerna enligt tillverkarens riktlinjer. Inaktivera till exempel Afl II- Spe I vid 80 ° C under 20 minuter.
  7. Plasmidåtervinning med användning av DNA-ligering och bakteriell transformation.
    1. Blanda de korrekta DNA-fragmenten i ett volumetriskt 1: 1 förhållande för att montera den önskade chimära genen ( Figur1, steg 7).
      ANMÄRKNING: På detta sätt återställs integriteten hos ampR- genen, vilket ger ett funktionellt protein.
      1. Blanda till exempel 4 μL pUC18 rpoD σ1-σ2 DNA (digererat med Afl II- Spe I, 150 ng / μl), 4 pl av pUC18 sigA σ3-σ4 DNA ( Afl II- Spe I, 150 ng / μl), 10 | il av 2x buffert, 2 | j, l ultrapure vatten och 1 | il T4 DNA ligas; DNA-koncentrationen efter kitrening är tillräckligt bra för digestion och efterföljande ligering. Låt ligeringsreaktionen vid 25 ° C under 10 min.
    2. Transformera E. coli DH5a med 3-5 pi av chimera-enhetens ligeringsreaktion (kompletterande material). Väx transformantcellerna i LB / Amp / X-gal / IPTG-plattor över natten vid 37 ° C över natten.
    3. Välj vitfärgade E. coli- kolonier av transformant och stryk dem på en ny LB / Amp-platta. Lämna plattorna över natten vid 37° C.
    4. Utför en koloni-PCR för att välja kandidater för en sekvenseringsreaktion, såsom beskrivs i kompletterande material. Visualisera band i en 1-1,2% (vikt / volym) agarosgel genom att utföra elektrofores (beskrivet i steg 2.3.2.1).
    5. Växa kulturer från positiva kandidater. Extrakt plasmid-DNA från dem med användning av ett plasmid-DNA-reningskit.

2. Sequence Kandidat Chimeric Constructions

  1. Se till att kvaliteten på plasmid-DNA är tillräckligt bra för sekvenseringsreaktionen genom att följa riktlinjer från sekvensleverantören. Extrahera DNA med hjälp av reningskit. Till exempel, på webbsidan för sekvensleverantören, var särskilt uppmärksam på den rekommenderade DNA-koncentrationen för proven. Hämta koncentrationen av prover med hjälp av ett DNA-kvantifieringsinstrument.
  2. Sekvenskandidat-chimära konstruktioner med en sekventeringsleverantör 10 .
  3. Montera se Quencing läser med en i silico DNA assembler 11 .
  4. Rikta inhopad kontra i silikondesignade chimära sekvenser med hjälp av sekvensjusteringsverktyg 9 , 12 . Verifiera att den chimära genen smältes framgångsrikt.

3. Förberedelser

OBS: Alla steg som involverar levande celler ska utföras i en ren laminärflödeskåp med Bunsen-brännaren på.

  1. Producerande E. coli DH5a-kompetenta celler.
    1. För att producera E. coli- kompetenta celler, följ publicerade protokoll 13 eller se kompletterande material . Använd alternativt kommersiellt tillgängliga kompetenta celler.
  2. Transformering av E. coli DH5a-kompetenta celler.
    1. För kemisk transformation av E. coli- kulturer, följ publicerade protokollClass = "xref"> 13 eller se kompletterande material . Alternativt använd elektroporation för bakteriell transformation. Om kommersiellt tillgängliga kompetenta celler används, följ tillverkarens riktlinjer.
  3. Rening av genomiskt och plasmid-DNA från E. coli DH5a.
    1. Utför nukleinsyraxtraktion, som anges i kompletterande material , med användning av kommersiellt tillgängliga kit eller följande publicerade protokoll 13 .
  4. Utför koloni-PCR.
    1. Använd denna teknik för att identifiera kandidat-transformantkolonier för efterföljande sekvenseringsreaktion.
      OBS: Denna metod representerar inte en slutgiltig verifikation av sekvensernas integritet. En detaljerad beskrivning av denna teknik finns tillgänglig i kompletterande material .
  5. Förbereda lösningarna.
    1. Se
  6. Ladda ner skript och sekvensfiler som krävs för CAPRRESI-protokollet.
    1. Hämta genbankfiler som innehåller hela genomsekvensen av den önskade arten, extrahera DNA-sekvensen för den valda genen med hjälp av en genombläddrare och spara den i fasta filformat. Ladda ner de Perl-skript som krävs för CAPRRESI-protokollet. Spara skript och sekvensfiler i samma katalog.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Figur 1 visar CAPRRESI. Med användning av denna metod samlades två chimära gener genom att utbyta domänerna av två bakteriella primära sigmafaktorer ( dvs E. coli RpoD och R. etli SigA). DNA-sekvenserna hos rpoD- och sigA- generna erhölls med användning av Artemis Genome Browser 14 från GenBank genomfilerna NC_000913 respektive NC_007761. DNA-sekvensen av pUC18-vektorn erhölls från nukleotiddatabasen hos NCBI-servern. I silico analyser av restriktionsenzymställen gjordes på DNA-sekvenser genom att köra Perl-scriptet REsearch.pl (se steg 1.2.2). Dessa resultat användes för oligonukleotiddesign (steg 1.2.3). Externa oligonukleotider innefattade igenkänningsställen för XbaI- och KpnI- restriktionsenzymer för att klona vildtypgener i den pUC18 multipla kloningsstället. Den framåtriktade oligonukleotiden innefattade också en riboNågon bindningsplats ( tabell 2 ). Genomiskt DNA extraherades från E. coli DH5a-celler odlade i LB / Nal-buljong (37 ° C, 220-250 rpm) och R. etli CFN42-celler odlade i PY / Nal / CaCl2-buljong (30 ° C, 220-250 rpm ). Dessa prover användes som DNA-mallar för vildtypsgenamplifiering (steg 1.5.2).

Wildtypgener amplifierades med användning av ett Taq -högfidelitets-DNA-polymeras, som renades från agarosgeler (DNA-reningskit), dubbelt digererades med KpnI- Xba I-restriktionsenzymer och klonades in i pUC18-vektorn. Kemiskt kompetenta E. coli DH5a-celler transformerades med 5 | il av ligeringsreaktionen motsvarande vildtypskonstruktioner pUC18 rpoD och pUC18 sigA (steg 1.5.5). Transformanta celler valdes på fasta LB / Amp / X-gal / IPTG-plattor odlade vid 37 ° C. Wildtypskonstruktioner verifierades av Sanger-sekvensenIng 10 . Sanger-sekvensläsning var i silikon sammansatt med användning av MIRA 11 (steg 1.5.8).

Aminosyrasekvenser från vildtypgener erhölls genom att köra translate.pl-skriptet (steg 1.3.1). Efter anpassning av vildtypgener med Clustal 12 valdes aminosyraregionerna TLV och NLR på ampicillinresistensgenen ( ampR ) respektive vildtyps primära sigmafaktorer (steg 1.3.3). Dessa aminosyraområden användes för att beräkna alla möjliga DNA-synonym-sekvenser som kodar dem genom att köra synonym.pl-skriptet (steg 1.4.1). Resynonym.pl-skriptet sökte efter restriktionsenzymställen som hittades på de tidigare genererade synonym-DNA-sekvenserna (steg 1.4.2). De synonymområden som införde det lägsta antalet förändringar jämfört med vildtypsekvenserna valdes. För de primära sigmafaktorgenerna, vildtypsekvenser av RpOD (AACTTACGT) och SigA (AACCTTCGC) utbytes för AA CTTAAG G. Den senare innefattade en Afl II-plats (fet). För ampR- genen utväxlades vildtypsekvensen ACGCTGGTG för sin synonym, AC ACTAGT G. Den synonym-DNA-sekvens som infördes i ampR- genen innehöll en SpeI- plats (fet). Den i silikosubstitutionen av vildtypen för motsvarande synonymsekvenser gjordes för att verifiera sekvensintegriteten och oligonukleotiddesignen (steg 1.2-1.4).

Synonymsekvensförändringar infördes genom PCR med användning av lämpliga oligonukleotider ( tabell 2 ) och vildtypskonstruktioner som DNA-mallar (steg 1.5.2). Amplifieringsreaktioner producerade fyra komplementära delar: pUC18 rpoD σ1-σ2, pUC18 rpoD σ3-σ4, pUC18 sigA σ1-σ2 och pUC18 sigA σ3-σ4. Komplementära delar disBröt inte bara sigmafaktorer, men också ampR- generna. Kompletterande delar renades med användning av ett DNA-reningskit (steg 1.6.3).

Dessa komplementära DNA-fragment dubbelt digererades med Afl II- och Spel- restriktionsenzymer (steg 1.6.4). Enligt CAPRRESI-design ligerades DNA-fragment pUC18 rpoD σ1-σ2 med pUC18 sigA σ3-σ4 för att erhålla chimär 01 och pUC18 sigA σ1-σ2 ligerades med pUC18 rpoD σ3-σ4 för att montera chimär 02 (steg 1.7.1-1.7 0,3). Kemiskt kompetenta E. coli DH5a-celler transformerades med 5 | il av ligeringsreaktionen av pUC18 chim01 och pUC18 chim02 (steg 1.7.4). Transformanta celler valdes på fasta LB / Amp / X-gal / IPTG-plattor odlade vid 37 ° C (steg 1.7.5). Chimära konstruktioner verifierades genom Sanger-sekvensering 10 (steg 2). Sångersekvens rEads monterades med MIRA 11 , och dess resulterande filer listas i tabell 3 . Figur 2 visar inriktningarna (utförda med användning av MUSCLE) 9 av sammansatta sekvenser av vildtyp och chimära gener vid brottområden.

Figur 1
Figur 1: CAPRRESI översikt. Representationer: gener (tjocka pilar), funktionella plasmider (slutna cirklar) och oligonukleotider (tunna, svartpipade pilar). Restriktionsenzymställen införda i oligonukleotider förekommer i färger. Förkortningar: Wt (vildtyp), FWD (framåtriktad oligonukleotid), REV (omvänd oligonukleotid), ampR (ampicillinresistensgen), RES (restriktionsenzymplats), RE (restriktionsenzym). Vänligen klicka här för att se en större versiPå denna figur.

Figur 2
Figur 2: Justering av sammansatta vildtyp och kimära gensekvenser. Sammansatta DNA-sekvenser inriktades med användning av MUSCLE 9 . Sekvenser monterades med MIRA 11 . Synonymsekvenser visas i svart. Afl II-igenkänningssidan visas understruken. IUPAC-nukleotidkod: R (A eller G) och K (G eller T). Konstruktioner: rpoD (röd), sigA (blå), chimera 01-sekvens ( rpoD σ1-σ2- sigA σ3-σ4) och chimera 02-sekvensen ( sigA σ1-σ2- rpoD σ3-σ4). Vänligen klicka här för att se en större version av denna figur.

Lösning Komponenter Instruktioner
Kvantitet Förening
Luria-Bertani (LB) buljong 5 g jästextrakt Lös alla komponenter i vatten. Autoklav. Förvara vid rumstemperatur tills användning. För fast LB-buljong, tillsätt 15 g bakteriologisk agar till receptet.
10 g Kaseinpepton
10 g NaCl
Upp till 1 liter Dubbel destillerat vatten
LB / Amp / X-gal / IPTG-plattor 100 ml Smält fast LB-buljong Lägg till alla komponenter till tempererad LB buljong. Fyll petriskålar och vänta tills de stelnar. Utför steg i en ren laminärflödeskåp med Bunsen-brännaren på.
100 | il Ampicillin (Amp) [100 mg / ml]
100 | il X-gal [20 mg / ml]
50 pl 1 M IPTG-lösning
Peptonjäst (PY) buljong 3 g jästextrakt Lös alla komponenter i vatten. Autoklav. Förvara vid rumstemperatur tills användning. För fast PY-buljong, tillsätt 15 g bakteriologisk agar till receptet. För R. etli-odling tillsätt 700 μL 1 M CaCl2-lösning före användning.
5 g Kaseinpepton
Upp till 1 liter Dubbel destillerat vatten
PY / CaCl2 / Nal-plattor 100 ml Smält fast PY buljong Lägg till alla komponenter till tempererad PY buljong. Fyll petriskålarna och vänta tills de stelnar. Utför steg i en ren laminärflödeskåp med Bunsen-brännaren på.
700 pl 1 M CaCl2-lösning
100 | il Nalidixinsyra (Nal) [20 mg / ml]
1 M kalciumklorid (CaCl2) lösning 11,1 g CaCl2 Lös CaCl2 i vatten. Autoklav. Förvara vid rumstemperatur.
Upp till 100 ml Dubbel destillerat vatten
Tris-EDTA (TE) 10: 1 pH 8,0 1 ml 1 M Tris-lösning Blanda alla komponenter. Autoklav. Förvara vid rumstemperatur.
400 | il 0,25 M EDTA-lösning
Upp till 100 ml Dubbel destillerat vatten
TE 50:20 pH 8,0 5 ml 1 M Tris-lösning Blanda alla komponenter. Autoklav. Förvara vid rumstemperatur. </ Td>
8 ml 0,25 M EDTA-lösning
Upp till 100 ml Dubbel destillerat vatten
TE 10: 1 10 mM NaCl-lösning 58,4 mg NaCl Lös upp NaCl i TE 10: 1. Autoklav. Förvara vid rumstemperatur.
Upp till 100 ml TE 10: 1 pH 8,0-lösning
Lysislösning I 80 mg lysozym Lös upp och bland alla komponenter i vatten. Filtrera sterilisera med ett 0,22 μm filter. Förvara vid rumstemperatur.
2 ml 0,5 M glukoslösning
400 | il 0,5 M EDTA-lösning
500 pl 1 M Tris-lösning
Upp till 20 ml Steriliserat dubbel destillerat vatten
Lysislösning II 1,2 ml 5 M natriumhydroxid (NaOH) -lösning Lös alla komponenter i vatten. Filtrera sterilisera med ett 0,22 μm filter. Förvara vid rumstemperatur.
3 ml 10% natriumdodecylsulfatlösning (SDS)
Upp till 30 ml Steriliserat dubbel destillerat vatten
Lysislösning III 29,4 g Kaliumacetat (CH3 COOK) Lös upp och bland alla komponenter i vatten. Filtrera sterilisera med ett 0,22 μm filter. Förvara vid rumstemperatur.
11,5 ml Absolut ättiksyra (CH3COOH)
Upp till 100 ml Steriliserat dubbel destillerat vatten
1 M magnesiumklorid (MgCl2) -lösning 9,5 g MgCl2 Lös upp MgCl2 i water. Autoklav. Förvara vid rumstemperatur.
Upp till 100 ml Dubbel destillerat vatten
3 M natriumacetat (CH3COONa) -lösning 24,6 g CH3 COONa Lös CH3 COONa i vatten. Autoklav. Förvara vid rumstemperatur
Upp till 100 ml Dubbel destillerat vatten
10% SDS-lösning 10 g SDS Lös SDS i vatten med en magnetisk omrörningsstav vid låg hastighet. Autoklav. Förvara vid rumstemperatur.
Upp till 100 ml Dubbel destillerat vatten
3 M CH3 COOK-lösning 29,4 g CH3 COOK Lös CH3 COOK i vatten. Filtrera sterilisera med ett 0,22 μm filter. Förvara vid rumstemperatur. Upp till 100 ml Steriliserat dubbel destillerat vatten
Proteinas K-lösning 5 mg Proteinas K Lös upp proteinas K i TE 50:20 lösning. Värm vid 37 ºC i 1 h. Förvaras vid -20 ºC.
Upp till 1 ml TE 50:20 pH 8,0-lösning
RNas-lösning 10 mg RNas Lös upp RNas i vatten. Värm vid 95 ºC i 10 min. Förvaras vid -20 ºC.
Upp till 1 ml Steriliserat ultralätt vatten
1 M isopropyl-p-D-tiogalaktosidlösning (IPTG) 238,3 mg IPTG Lös IPTG i vatten. Filtrera sterilisera med ett 0,22 μm filter. Förvaras vid -20 ºC.
Upp till 1 ml Steriliserat ultralätt vatten
20 mg X-gal Lös upp X-gal i vatten. Filtrera sterilisera med ett 0,22 μm filter. Förvaras vid -20 ºC.
Upp till 1 ml Steriliserat ultralätt vatten
Fenol: kloroform: isoamylalkohol 24: 24: 1 lösning 24 ml fenol Blanda alla komponenter. Förvara i en gult kapslad flaska vid 4 ºC. VARNING! Farligt material. Använd skyddshandskar, handskar och bomullslaboratorium. Använd en extraktionshuv. Slå inte på Bunsen-brännaren eller någon annan eldkälla vid hantering. Alternativ: använd kommersiell fenol: kloroform: isoamylalkohol 25: 24: 1 lösning
24 ml kloroform
1 ml Isoamylalkohol
0,5 M glukoslösning 9 g glucose Lös upp glukos i vatten. Filtrera sterilisera med ett 0,22 μm filter. Förvara vid rumstemperatur.
Upp till 100 ml Steriliserat ultralätt vatten
0,5 M etylendiamintetraättiksyra (EDTA) pH 8,0-lösning 14,6 g EDTA Lös upp EDTA i vatten. Justera pH med 5 M NaOH lösning. Autoklav. Förvara vid rumstemperatur.
Upp till 100 ml Dubbel destillerat vatten
0,25 M EDTA pH 8,0-lösning 7,3 g EDTA Lös upp EDTA i vatten. Justera pH med 5 M NaOH lösning. Autoklav. Förvara vid rumstemperatur.
Upp till 100 ml Dubbel destillerat vatten
1 M Tris pH 8,0-lösning 12,1 g tris Lös upp Tris i vatten. Justera pH medAbsolut saltsyra (HCl). Autoklav. Förvara vid rumstemperatur.
Upp till 100 ml Dubbel destillerat vatten
5 M natriumhydroxid (NaOH) -lösning 19,9 g NaOH Lös upp NaOH i vatten. Förvara vid rumstemperatur. VARNING! Caustisk förening.
Upp till 100 ml Steriliserat dubbel destillerat vatten
0,1 M NaOH-lösning 399 mg NaOH Lös upp NaOH i vatten. Förvara vid rumstemperatur.
Upp till 100 ml Steriliserat dubbel destillerat vatten
Nalidixsyra (Nal) stamlösning 60 mg Nalidixinsyra Lös upp Nal i vatten. Filtrera sterilisera med ett 0,22 μm filter. Förvara vid 4 ºC.
Upp till 3 ml 0,1 MNAOH-lösning
Ampicillin (Amp) stamlösning 300 mg ampicillin Lös upp amp i vatten. Filtrera sterilisera med ett 0,22 μm filter. Förvara vid 4 ºC.
Upp till 3 ml Steriliserat dubbel destillerat vatten
10x tris-acetat-EDTA-buffert 48,4 g tris Lös alla komponenter i vatten. Autoklav. Förvara vid rumstemperatur.
20 ml 0,5 M EDTA-lösning
11,44 ml isättika
Upp till 1 liter Dubbel destillerat vatten

Tabell 1: Lösningsberedning. Instruktioner för lösningstillverkning.

Nej. Koda Sekvens Längd (nt) Funktioner
1 RpoD-FWD GC TCTAGA GA AGAGA TATCATATGGAGCAAAACCCGCAGTCA 43 Xbal-ställe ; Vildtypsgenamplifiering och vektorkloning
2 ROD-REV GG GGTACC TTAATCGTCCAGGAAGCTACG 29 Kpnl-ställe ; Vildtypsgenamplifiering och vektorkloning
3 SIgA-FWD GC TCTAGA GA AGAGA TATCATATGGCAACCAAGGTCAAAGAG 43 Xbal-ställe ; Vildtypsgenamplifiering och vektorkloning
4 SIgA-REV GG GGTACC TTAGCTGTCCAGAAAGCTTCT </ Td> 29 Kpnl-ställe ; Vildtypsgenamplifiering och vektorkloning
3 AmpR-FWD AC ACTAGT GAAAGTAAAAGAT 21 SpeI- plats infogad, synonym mutation. Störning av ampR- gen
4 AmpR-REV TC ACTAGT GTTTCTGGGTGAG 21 SpeI- plats infogad, synonym mutation. Störning av ampR- gen
5 σ2RpoD-FWD AA CTTAAG GCTGGTTATTTCTATCGCT 27 AflII- plats insatt, synonym mutation. Konstruktion av chim01-02
6 σ2RpoD-REV GC CTTAAG TTCGCTTCAACCATCTCTT 27 AflII- plats insatt, synonym mutation. Konstruktion av chim01-02
7 σ2SigA-FWD AA CTTAAG GCTCGTCATTTCAATCGCC 27 AflII- plats insatt, synonym mutation. Konstruktion av chim01-02
8 σ2SigA-REV GC CTTAAG TTCGCTTCGACCATTTCCT 27 AflII- plats insatt, synonym mutation. Konstruktion av chim01-02

Tabell 2: Oligonukleotidsekvenser. Restriktionsenzymplatser framträder understrukna. Ribosombindningsplats: fet.

Konstruktion Sekvensfil Kvalitetsfil
chimera01 chim01_out.unpadded.fasta chim01_out.unpadded.fasta.qual
chim01_A3 / B3 / E2 / F2 / G2 /H2.pdf
chimera02 chim02_out.unpadded.fasta chim02_out.unpadded.fasta.qual
chim02_C3 / D3 / E3 / F3 / G3 / H3.pdf
rpoD rpod_out.unpadded.fasta rpod_out.unpadded.fasta.qual
sIgA siga_out.unpadded.fasta siga_out.unpadded.fasta.qual

Tabell 3: Sekvensfiler som erhållits med MIRA assembler och DNA sequencer. Sanger-sekvensering läser från chimära och vildtypskonstruktioner monterades med MIRA 11- programvara med hjälp av mappningsalternativet. Kromatogram av chimärsekvensering visas som PDF-filer.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

CAPRRESI designades som ett alternativ till PRM 2 . Den ursprungliga PRM är en kraftfull teknik; Det möjliggör fusion av DNA-sekvenser längs någon del av de valda generna. För PRM bör vildtypgener klonas i samma plasmid. Därefter konstrueras oligonukleotider inuti vildtyp och antibiotikaresistensgener som finns på plasmiden. Plasmidförstöring uppnås genom PCR med användning av trubbiga, högfideliga DNA-polymeraser och tidigare utformade oligonukleotider. Ligeringen av komplementära PCR-produkter samlar chimära gener och återställer antibiotikaresistenskassetten, vilket resulterar i funktionell plasmidåtervinning. PRM möjliggör konstruktionen av kimära genbibliotek på samma plasmidbakgrund. Tyvärr kan ligeringen av trubbiga DNA-sekvenser vara tekniskt svår. Chimärsammansättning genom överlappande PCR-fragment 1 kräver också att DNA-polymeraser ger stumparade produkter ochDNA-rening för varje reaktion. De chimära generna som sammansätts av denna teknik är linjära DNA-produkter. Kloning av varje konstruktion i målvektorn kan fördröja ytterligare analys.

CAPRRESI drar nytta av många av styrkan i PRM och förenklar också ligeringen av komplementära DNA-fragment genom att använda restriktionsenzymställen på synonym-DNA-sekvensområden. Av dessa skäl kräver CAPRRESI inte stumma DNA-polymeraser. Användningen av synonym-DNA-sekvenser begränsar fusionsställen för chimäraggregat men ökar ligeringseffektiviteten. En annan viktig modifiering infördes i CAPRRESI är att kimärer samlas och hanteras i pUC18 / 19 vektorer. Dessa vektorer har flera fördelaktiga egenskaper, som tidigare angivits. Chimeriskt DNA kunde erhållas genom propagering av konstruktionsvektorn i E. coli värdar. Efterföljande kloning av chimära gener i den slutliga plasmiden ( t.ex. en expressionsvektor) är iblandnödvändig.

CAPRRESI är också beroende av silikahantering av DNA- och aminosyrasekvenser. Ad hoc Perl-skript möjliggör valet av lämpliga restriktionsenzymer för att klona vildtypgener, beräkningen av alla synonym-DNA-sekvenser som motsvarar brytregioner (för chimärmontering) och identifiering av restriktionsenzymer för att förenkla plasmidåtervinning. Med dessa förhållanden är CAPRRESI ett alternativ för att fusera proteinkodande gener. Kritiska steg i CAPRRESI-protokollet är: 1) valet av brytningsområden och 2) reningen av PCR-produkter. Brytningsregioner är sträckningar där synonymsekvenser beräknas, producerande restriktionsenzymställen som inte finns på vildtypsekvenser. Användningen av restriktionsenzymställen för chimärsammansättning eliminerar behovet av DNA-polymeraser som ger upphov till trubbiga produkter och underlättar ligeringsreaktionen. Inte alla regioner kommer att ha användbara gränser för restriktionsenzym; foDet är därför som rekommenderas att flytta brottsregioner med en aminosyra åt gången tills den bästa sekvenssträckan finns. Om silikonstrukturen inte tillåter rörelse av brytningsområdena eller sekvenssträckorna saknar synonym-DNA-sekvenser med lämpliga restriktionsenzymställen, rekommenderas det att smälta målgener med användning av överlappande oligonukleotider och att introducera synonym-DNA-sekvenser i ampicillinresistensgenen (Endast på vektorn). På detta sätt kan generna smälta vid vilken som helst del och plasmidåtervinningen är beroende av ligering av en unik plats (digererad med endast ett restriktionsenzym). Flexibiliteten hos CAPPRESI gör att den kan utföras i kombination med andra tekniker.

Rening av PCR-produkter utförs för att eliminera mall-DNA, vilket minskar risken för föräldraplasmidförorening efter ligering av komplementära DNA-fragment. Att uppfylla dessa två kritiska steg ökar bacTerial transformationseffektivitet (antalet korrekt monterade konstruktioner), vilket möjliggör att CAPRRESI utförs med antingen kemiskt kompetenta (CaCl2) eller elektrokompetenta E. coli- celler. Den första typen av kompetenta celler representerar den billigaste källan till E. coli- kulturer, som används för bakteriell transformation i de flesta laboratorier. På grund av alla funktioner som tidigare visats är CAPRRESI ett användbart alternativ för montering av chimärer.

Dessutom kan CAPRRESI fungera i kombination med överlappande PCR-fragment eller plasmidåtervinningstekniker. I stället för att införa två synonym-sekvenser per komplementär DNA-del kan till exempel den önskade brytregionen (på målvildtypgenerna) använda överlappande oligonukleotider för att smälta mellanliggande sekvenser. Införandet av synonymsekvenser kan begränsas till ampR- genen av pUC18 / 19-vektorer, vilket leder till användningen av endast ett restriktionsenzym för att återställa plasmiD integritet. Dessa framtida tillämpningar kan stärka CAPRRESI genom att möjliggöra fusion av vilken typ av DNA-sekvenser som helst (inte bara proteinkodande gener) utan att kompromissa med ligeringseffektivitet.

För att testa CAPRRESI monterades två chimära sigmafaktorer genom att utbyta regioner av två primära sigmafaktorgener av vildtyp : rpoD ( E. coli ) och sigA ( R. etli ). Alla kända primära sigmafaktorer har fyra domäner, σ1 till σ4 8 . Chimera 01 består av RpoDσ1-σ2 och SigAσ3-σ4, medan chimär 02 har SigAσ1-σ2 och RpoDσ3-σ4. Integriteten hos de chimära konstruktionerna verifierades genom Sanger-sekvensering 10 ( Figur 2 ).

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna förklarar att de inte har några konkurrerande ekonomiska intressen.

Acknowledgments

Detta arbete stöddes av Consejo Nacional de Ciencia och Tecnología, CONACYT, México (bidrag nr 154833) och Universidad Nacional Autónoma de México. Författarna vill tacka Víctor González, Rosa I. Santamaría, Patricia Bustos och Soledad Juárez för deras administrativa och tekniska råd.

Materials

Name Company Catalog Number Comments
Platinum Taq DNA polymerase High Fidelity Thermo Fisher 11304011 Produces a mix of blunt/3’-A overhang ended PCR products
High pure plasmid isolation kit Roche 11754785001 Used for all plasmid purification reactions
High pure PCR product purification kit Roche 11732676001 Used for all PCR purification reactions from agarose gels
AflII restriction enzyme New England Biolabs R0520L Recognizes sequence 5’-CTTAAG-3’ and cuts at 37 °C
KpnI-HF restriction enzyme New England Biolabs R3142L Recognizes sequence 5’-GGTACC-3’ and cuts at 37 °C
SpeI-HF restriction enzyme New England Biolabs R3133L Recognizes sequence 5’-ACTAGT-3’ and cuts at 37 °C
XbaI restriction enzyme New England Biolabs R0145L Recognizes sequence 5’-TCTAGA-3’ and cuts at 37 °C
Ampicillin sodium salt Sigma Aldrich A0166-5G Antibiotics
Nalidixic acid Sigma Aldrich N8878-5G Antibiotics
Yeast Extract Sigma Aldrich Y1625-1KG Bacterial cell culture
Casein peptone Sigma Aldrich 70171-500G Bacterial cell culture
NaCl Sigma Aldrich S9888-1KG Sodium chloride
Agar Sigma Aldrich 05040-1KG Bacterial cell culture
XbaI restriction enzyme Thermo Fisher FD0684 Fast digest XbaI enzyme
KpnI restriction enzyme Thermo Fisher FD0524 Fast digest KpnI enzyme
Quick Ligation Kit New England Biolabs M2200S Fast DNA ligation kit
AflII restriction enzyme Thermo Fisher FD0834 Fast digest AflII enzyme
SpeI restriction enzyme Thermo Fisher FD1253 Fast digest SpeI enzyme

DOWNLOAD MATERIALS LIST

References

  1. Horton, R. M., Hunt, H. D., Ho, S. N., Pullen, J. K., Pease, L. R. Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene. 77, (1), 61-68 (1989).
  2. Vos, M. J., Kampinga, H. H. A PCR amplification strategy for unrestricted generation of chimeric genes. Anal. Biochem. 380, (2), 338-340 (2008).
  3. Hawkins, N. C., Garriga, G., Beh, C. T. Creating Precise GFP Fusions in Plasmids Using Yeast Homologous Recombination. Biotechniques. 34, (1), 1-5 (2003).
  4. Sander, J. D., Joung, J. K. CRISPR-Cas systems for editing, regulating and targeting genomes. Nat Biotechnol. 32, (4), 347-355 (2014).
  5. Nagy, A. Cre recombinase: The universal reagent for genome tailoring. Genesis. 26, (2), 99-109 (2000).
  6. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods. 6, (5), 343-345 (2009).
  7. Norrander, J., Kempe, T., Messing, J. Construction of improved M13 vectors using oligodeoxynucleotide-directed mutagenesis. Gene. 26, (1), 101-106 (1983).
  8. Gruber, T. M., Gross, C. A. Multiple sigma subunits and the partitioning of bacterial transcription space. Annu Rev Microbiol. 57, 441-466 (2003).
  9. Edgar, R. C. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 32, (5), 1792-1797 (2004).
  10. Macrogen Inc. Seoul, Rep. Of Korea. Available from: http://dna.macrogen.com/eng/index.jsp (2016).
  11. Chevreux, B. MIRA: an automated genome and EST assembler. Available from: http://www.chevreux.org/thesis/index.html 1-161 (2005).
  12. Thompson, J. D., Gibson, T. J., Higgins, D. G. Multiple sequence alignment using ClustalW and ClustalX. Curr Protoc Bioinformatics. Chapter 2 (Unit 2.3) 1-22 (2002).
  13. Sambrook, J., Russell, D. W. Molecular Cloning: A laboratory manual. CSHLP. (2001).
  14. Rutherford, K., et al. Artemis: sequence visualization and annotation. Bioinformatics. 16, (10), 944-945 (2000).
CAPRRESI: Chimera Assembly genom Plasmid Recovery och Restriction Enzym Site Insertion
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Santillán, O., Ramírez-Romero, M. A., Dávila, G. CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion. J. Vis. Exp. (124), e55526, doi:10.3791/55526 (2017).More

Santillán, O., Ramírez-Romero, M. A., Dávila, G. CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion. J. Vis. Exp. (124), e55526, doi:10.3791/55526 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter