Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biochemistry

Rekombinant Protein Ekspression, Krystallisering og Biofysiske Studier af a doi: 10.3791/55576 Published: May 16, 2017

Summary

Bacillus anthracis er det obligatoriske patogen af ​​dødelig inhalationsbrandbrand, så undersøgelser af dets gener og proteiner er strengt regulerede. En alternativ tilgang er at studere orthologe gener. Vi beskriver biofysikologiske undersøgelser af en B. anthracis ortholog i B. cereus , bc1531, der kræver minimal eksperimentelt udstyr og mangler alvorlige sikkerhedshensyn.

Abstract

For at overvinde sikkerhedsrestriktioner og forskrifter når man studerer gener og proteiner fra ægte patogener, kan deres homologer undersøges. Bacillus anthracis er et obligatorisk patogen, som forårsager dødelig inhalationsbrandbrand. Bacillus cereus betragtes som en nyttig model til at studere B. antracis på grund af dens nære evolutionære forhold. Genklyngen ba1554 - ba1558 af B. anthracis er stærkt bevaret med bc1531 - bc1535- klyngen i B. cereus , såvel som med bt1364-bt1368- klyngen i Bacillus thuringiensis, der angiver den kritiske rolle af de associerede gener i Bacillus- slægten. Dette manuskript beskriver metoder til fremstilling og karakterisering af et proteinprodukt fra det første gen ( ba1554 ) fra genklyngen i B. anthracis ved anvendelse af et rekombinant protein af dets ortholog i B. cereus , bc1531.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Rekombinant proteinekspression anvendes i vid udstrækning til at overvinde problemer forbundet med naturlige proteinkilder, såsom begrænsede proteinmængder og skadelig forurening. Desuden kan i en undersøgelse af patogene gener og proteiner anvendes en alternativ laboratoriestamme, der ikke kræver yderligere sikkerhedsforanstaltninger. For eksempel er Bacillus cereus en nyttig model til at studere Bacillus anthracis på grund af deres nære evolutionære forhold 1 .

B. anthracis er et obligatorisk patogen, der forårsager dødelig inhalationsantrax hos mennesker og husdyr og kan potentielt anvendes som bioweapon 2 . Således er laboratorieundersøgelser af B. anthracis strengt reguleret af de amerikanske centre for sygdomsbekæmpelse, der kræver biosikkerhedsniveau 3 (BSL-3) praksis, som pålægger laboratorieområdet at blive adskilt med negativt rumtryk. I modsætning til B. anthracis B. cereus er kategoriseret som et BSL-1-middel og har således mindste sikkerhedsproblemer. B. cereus er et opportunistisk patogen, der ved infektion forårsager fødeforgiftning, der kan behandles uden medicinsk hjælp. Men fordi B. cereus deler mange kritiske gener med B. antracis , kan funktionerne af B. anthracis proteiner studeres under anvendelse af de tilsvarende homologer af B. cereus 1 .

Ba1554 - ba1558 genklyngen af B. anthracis er stærkt bevaret med bc1531 - bc1535 klyngen Af B. cereus , såvel som med bt1364-bt1368- klyngen af Bacillus thuringiensis , hvad angår genorganisation og sekvens. Desuden er de første gener ( ba1554 , bc1531 og bt1364 ) af de respektive klynger absolut bevaret ( dvs. 100% nukleotidsekvensidentitet), implicitNg en kritisk rolle for genproduktet i Bacillus- arten. På grund af sin placering i disse genklynger var ba1554 fejlagtigt som en formodet transkriptionsregulator 3 . Imidlertid viser aminosyresekvensanalyse af ba1554- produktet, at det tilhører MazG-familien, som har nukleotidpyrophosphohydrolaseaktivitet og ikke er forbundet med transkriptionsfaktoraktivitet 4 , 5 . Selv om proteiner tilhørende MazG-familien er forskellige med hensyn til den samlede sekvens og længde, deler de et fælles MazG-domæne med 100 rester, der er kendetegnet ved et EXXE 12-28 EXXD-motiv ("X" står for en hvilken som helst aminosyrerest, og tallet Angiver antallet af X rester).

MazG-domænet er ikke altid direkte ansvarlig for en bestemt katalytisk aktivitet. Et MazG-medlem fra Escherichia coli (EcMazG) besidder to MazG-domæner, men påDet C-terminale MazG-domæne er enzymatisk aktivt 6 . Desuden varierer substratspecificiteten af ​​MazG-enzymer fra ikke-specifikke nucleosidtrifosfater (til EcMazG) til specifik dCTP / dATP (for integrin-associeret MazG) og dUTP (til dUTPaser) 6 , 7 , 8 , 9 . Derfor er biofysisk-kemiske analyser af BA1554-proteinet nødvendige for at bekræfte dets NTPase-aktivitet og at dechiffrere dets substratspecificitet.

Her tilvejebringer vi en trin-for-trin protokol, som de fleste laboratorier uden et BSL-3-anlæg kan følge for at karakterisere proteinproduktet fra B. cereus bc1531 genet, som er en ortholog af B. anthracis ba1554 , på molekylær niveau. Kort fortalt blev rekombinant BC1531 (rBC1531) udtrykt i E. coli og oprenset ved anvendelse af en affinitetsmærke. Til røntgenkrystalliske eksperimenter, krystalliseresZationbetingelser for rBC1531-proteinet blev screenet og optimeret. For at vurdere den enzymatiske aktivitet af rBC1531 blev NTPase-aktivitet overvåget kolorimetrisk for at undgå radioaktivt mærket nukleotider, der er blevet anvendt konventionelt. Endelig gjorde analyser af de opnåede biofysikologiske data os i stand til at bestemme oligomeriseringstilstanden og katalytiske parametre for rBC1531 såvel som at opnå røntgendiffraktionsdata fra rBC1531-krystallen.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Rekombinant proteinproduktion og oprensning af rBC1531

  1. Fremstilling af et rekombinant BC1531 protein (rBC1531) ekspressionsplasmid
    1. Klargør genomisk DNA fra B. cereus 10 .
    2. Amplify bc1531 genet fra en template af B. cereus genomisk DNA ved polymerasekædereaktion (PCR) ved anvendelse af fremadrettede og reverse primere (se Materialelisten) for at oprette Bam HI og Sal I restriktionsenzymsteder, henholdsvis 10 .
    3. Fordøj PCR-produktet og en modificeret pET49b-vektor (pET49bm) ved anvendelse af BamHI og SalI som beskrevet 11 .
    4. Bland det fordøjede PCR-produkt og vektoren (3: 1 forhold) fra trin 1.1.3 ved anvendelse af T4 DNA ligase i en 10 μl reaktion som beskrevet 11 . Inkubér ved 18 ° C i 30 minutter.
    5. Pipetter 3 μl af ligeringsreaktionen i 50 μl kemicaLly kompetente E. coli DH5a celler i et rør. Bland forsigtigt ved pipettering op og ned og læg på is i 30 minutter. Varmestød i 45 s ved 42 ° C. Tilsæt 1 ml Luria-Bertani (LB) medium og dyrk cellerne under kraftig omrystning (250 rpm, 37 ° C, 45 min).
    6. Tag 100 μL af de transformerede celler fra trin 1.1.6 og spred dem på LB-agarpladerne med 100 μg / ml kanamycin (Kan). Inkubér i ~ 18 timer ved 37 ° C.
    7. Vælg kolonier ved hjælp af en steril tip og dyrk cellerne i 3 ml LB medium med 100 μg / mL Kan; Ryst kraftigt (250 rpm, 37 ° C, 18 timer).
    8. Fremstil plasmid DNA ved anvendelse af en alkalisk SDS lysis metode som beskrevet 10 .
    9. Bekræft nukleotidsekvensen af ​​rBC1531-ekspressionskonstruktionen under anvendelse af DNA-sekventering 12 .
  2. Overekspression af rBC1531 proteinet
    1. Omforme E. coli BL21 (DE3) stammen med rBC1531-expOmsætningsplasmid, som beskrevet i trin 1.1.5-1.1.6, til overekspression.
    2. Vælg en koloni og dyrk den i 10 ml LB-medium indeholdende 50 μg / ml Kan (LB + Kan); Omrystes kraftigt i 18 timer ved 37 ° C.
    3. Inokulere 10 ml overnight-kultur i 1 L LB + Kan-medium og vokse ved 37 ° C indtil OD 600 (optisk densitet ved 600 nm) når ~ 0,7.
    4. Dyk kulturen i iskoldt vand i ~ 15 minutter for at afkøle temperaturen til 18 ° C, og tilsæt isopropyl β-D-1-thiogalactopyranosid (IPTG) til kulturen ved en slutkoncentration på 1 mM til rekombinant proteinekspression. Vok kulturen ved 18 ° C i yderligere ~ 16-18 timer.
  3. Oprensning af rBC1531
    1. Høst cellerne ved centrifugering (5.000 xg, 4 ° C, 30 min). Kassér supernatanten omhyggeligt for ikke at forstyrre cellerne. Suspender cellerne igen i 50 ml phosphatbufferet saltopløsning (PBS) opløsning indeholdende 10 mM imidazol.
    2. Lyse cellerne to gange ved sonication på is for at forhindre overopvarmning af cellelysaterne (tid: 2 min 30 s, cyklus på: 5 s, cyklus fra: 10 s; amplitude: 38%).
    3. Ryd cellelysatet ved centrifugering (~ 25.000 xg, 4 ° C, 30 min).
    4. Bland 3 ml nikkelperler og 60 ml PBS indeholdende 10 mM imidazol og tyngdekraftstrømmen den ekstra puffer til at bestemme de ækvilibrerede nikkelperler i en 2,5 x 10 cm glaskromatografikolonne.
    5. Pipette til overførsel af supernatanten fra trin 1.3.3 til søjlen med præ-ækvilibrerede nikkelperler og inkubering ved 4 ° C i 2 timer på et spindelhjul med lav hastighed (~ 20 omdr./min.).
    6. Lad supernatanten dræne ved tyngdekraften og vask nikkelperlerne i søjlen tre gange med 100 ml PBS indeholdende 10 mM imidazol.
    7. Elute rBC1531 protein ved at påføre 4 x 5 ml PBS indeholdende 250 mM imidazol.
    8. Tag 15 μl af elueringen fra trin 1.3.7 og kør den på 15% SDS-PAGE. Visualiser proteinbåndene påGelen ved anvendelse af Coomassie blå farvning 10 .
  4. Fjernelse af affinitetsmærkerne af rBC1531-proteinet ved thrombinproteolyse
    1. Pipetter fraktionerne ind i dialyserøret (molekylvægt afskåret: 3 kDa) og anbring røret i et bæger indeholdende 4 liter trombinklyvningskompatibel buffer (20 mM HEPES, pH 7,4, 150 mM NaCl og 1,5 mM β-mercaptoethanol) Ved 4 ° C natten over.
    2. Pipetter fraktionerne og overfør dem til et konisk rør.
    3. Mål absorbansen ved 280 nm og estimér rBC1531 proteinkoncentrationen som beskrevet 13 .
    4. Tag 50 μg rBC1531 i et 0,5 ml rør og tilsæt forskellige mængder thrombin ( dvs. 2, 1, 0,6 og 0,3 enheder). Inkuber rBC1531- og thrombinreaktionerne ved 20 ° C i ~ 3 timer for at bestemme den mindste mængde trombin, der kræves for at spalte den N-terminale affinitetsmærke.
    5. Kør rBC1531 og trombinreaktionerne på en 15%SDS-PAGE og bestemme den laveste mængde thrombin ( fx 0,3 enheder thrombin pr. 50 μg rBC1531), der fuldstændigt fordøjer den N-terminale affinitetsmærke og producerer et tagfrit rBC1531.
    6. Tilsæt 10 mg rBC1531 protein og 60 enheder thrombin til et 15 ml rør og inkuber ved 20 ° C i ~ 3 timer til thrombin-proteolysereaktionen.
    7. Påfør gelfiltreringsstandarder til en størrelseseksklusionskromatografi (SEC) kolonne for at fremstille en standardkurve med molekylvægte og elueringsvolumener som beskrevet 13 .
    8. Placer det trombinfordøjede rBC1531-protein fra trin 1.4.6 i et centrifugalfilterrør (molekylvægt afskåret: 3 kDa) og centrifuge ved 3.000 g ved 4 ° C for at reducere til et volumen på mindre end 5 ml.
    9. Påfør det koncentrerede rBC1531-protein til SEC-søjlen og opsaml 60 eluerede fraktioner i 0,5 ml pr. Rør 13 .
    10. Tag 15 μl af hver fraktion, kør dem på en 15% SDS-PAGE og staiN gelen ved anvendelse af Coomassie-farvningsløsning (0,15% (vægt / volumen) Coomassie brilliant blue, 40% (volumen / volumen) methanol og 10% (volumen / volumen) iseddikesyre) som beskrevet 10 .
    11. Pipetter de fraktioner, der indeholder rBC1531, og saml dem i ét rør.

2. Krystallisering Screening og optimering af rBC1531

  1. Screeningsbetingelser for rBC1531-proteinkrystallisation
    1. Koncentrer rBC1531 fra trin 1.4.11 op til ~ 18,5 mg / ml ved anvendelse af et centrifugalfilterrør som beskrevet i trin 1.4.8.
    2. Tilsæt 50 μl af hver krystalliseringsscreeningsopløsning (se afsnit 2.2) 14 til brøndene i 96-brønds siddedråberkrystallisationsplader. Placer 0,5 μL af 18,5 mg / mL rBC1531 proteinopløsningen på en siddeplads. Bland proteinopløsningen med 0,5 μl af brøndopløsningen og gentag processen for hele pladen.
    3. Dæk pladen med klar klæbende film.Placer 96-brøndspladerne ved 18 ° C og tillade dampdiffusion.
    4. Scan dråberne ved 20-40X forstørrelse ved hjælp af et lysmikroskop for at overvåge krystaldannelsen dagligt i 2-3 uger.
    5. Indsamle røntgendiffraktionsdata 12 under anvendelse af de opnåede rBC1531 proteinkrystaller.
  2. Optimering af rBC1531 krystallisationsbetingelser
    1. Forbered 500 μL af den valgte indledende krystallisationsbetingelsesopløsning ( fx 0,1 M natriumcacodylat, pH 6,5 og 1,0 M natriumcitrat) og fyld en 24-brønds krystallisationsplade til siddedråbet.
    2. Tilsæt 0,5 μL af 18,5 mg / ml rBC1531 proteinopløsningen til en siddeseng, bland med 0,5 μL brøndopløsningen og dækk pladen med klar klæbende film. Placer pladen ved 18 ° C.
    3. Overhold krystalvæksten under et lysmikroskop i en uge.
    4. Optimer forskellige krystalliseringsbetingelser ved at variere pH ( dvs.PH 5,5-6,8) af 0,1 M cacodylat og ved at ændre saltkoncentrationen ( dvs. 0,9-1,2 M) natriumcitrat for at opnå enkelkrystaller. Overvåg krystalvæksten i ~ 1 uge og indsaml røntgendiffraktionsdata 12 .

3. Karakterisering af nukleosidtrifosfatase (NTPase) aktivitet af rBC1531

  1. Validering af det uorganiske fosfatafhængige kolorimetriske undersøgelse
    1. Forbered en bestanddel af pyrophosphat (100 mM) og fortynd det til endelige koncentrationer på 0,1, 0,25, 0,5, 1,0, 5,0, 10, 50, 100 og 250 μM i 200 μl reaktionsbuffer (20 mM HEPES, pH 7,4; 150 MM NaCl og 2 mM MgCl2) i dubletter med 96 brønde. Brug den første plade som kontrol (dette indeholder ikke pyrophosphatase). Sørg for, at den anden plade indeholder pyrophosphatase som arbejdsplade som angivet i trin 3.1.2.
    2. Tilsæt 0,01 enhed Saccharomyces cerevisiae uorganisk pYrofosfatase (1 μl) til brøndene på arbejdspladen og inkuber ved 20 ° C i 30-60 minutter.
    3. Forbered molybdatsyreopløsning ved at blande ammoniummolybdat (0,86% vol / vol) og ascorbinsyre (14% v / v) opløsninger i et 7: 3-forhold. Tilsæt 16 μL molybdatsyreopløsning til både arbejds- og kontrolbrøndene og vent i 15 minutter.
    4. Læs den optiske tæthed ved 690 nm (OD 690nm ).
  2. Colorimetrisk NTPase-analyse
    1. Forbered en stamme af 100 mM nukleosidtrifosfat (NTP) substrat og fortynd til den ønskede koncentration ( fx 0, 0.2, 4.4, 11, 22, 44, 88 eller 132 μM) i 180 μl assaybuffer (20 mM HEPES, PH 7,4, 150 mM NaCl og 2 mM MgCl2).
    2. Tilsæt 20 μg rBC1531 (1,5 mM) og NTP-substraterne fra trin 3.2.1 op til 200 μl pr. Reaktion i en 96-brønds plade og pipetter op og ned for at blande godt. Dæk pladen med låg og læg den i en 37 ° C inkubator i 30 minutterAt udføre substrathydrolysereaktionen.
    3. Overfør pladen til et 70 ° C vandbad og lad det stå i 15 minutter for at stoppe rBC1531-medierede katalytiske reaktioner.
    4. Tilsæt 0,01 enhed S. cerevisiae uorganisk pyrophosphatase (1 μl) til hver brønd i reaktionspladen (fra trin 3.2.3) og inkuber ved 20 ° C i 30 minutter. Tilsæt 16 μL molybdatsyreopløsning til reaktionspladen for at udvikle farven (~ 15 min). Læs ved OD 690nm .
    5. Analysér ved brug af Michaelis-Menten ligningen, som beskrevet 12 .

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Karakterisering af proteinet af interesse i dette studie begyndte ved at fremstille en tilstrækkelig mængde rekombinant B. cereus bc1531 (rBC1531) protein, fortrinsvis mere end flere milligram. DNA-fragmentet, som koder for BC1531-proteinet, blev fremstillet ved PCR under anvendelse af det genomiske DNA fra B. cereus som en skabelon, da den indeholder orthologiske gener identiske med ba1554 . RBC1531 blev overudtrykt som et opløseligt protein i E. coli- celler. RBC1531-proteinet blev udtrykt med et 6x-histidinmærke og et thrombin-spaltningssted ved dets N-terminale 12 . Som et første oprensningstrin blev rBC1531 oprenset ved nikkelaffinitetskromatografi ( figur 1A ). Dernæst blev der udført et thrombinfordøjelsesforsøg for at bestemme den laveste mængde trombin, der kræves til fuldstændig fordøjelse af affinitetsmærket fra rBC1531 ( figur 1A ). I vores hænder var 0,3 enheder thrombin sufTilstrækkeligt til fuldstændigt at fjerne affinitetsmærket fra rBC1531. Ved skalering blev 10 mg rBC1531 således behandlet med 60 enheder thrombin til tag-fjernelse. Efter thrombinfordøjelse blev den tag-fri rBC1531 påført på en SEC-søjle for at fjerne eventuelle opløselige aggregater og forureninger med højere eller lavere molekylvægt. RBC1531-fraktionerne blev analyseret ved SDS-PAGE, hvis resultater viste, at rBC1531 var ~ 99% rent ( figur 1A ). Samlet set gav 1 liter kultur ~ 8 mg rBC1531 protein.

For at estimere den oligomeriske status af rBC1531 blev SEC udført. En standard lineær kurve, der korrelerer logværdien af ​​molekylvægten af ​​prøverne med deres tilsvarende elueringsvolumener, blev plottet under anvendelse af toppe af proteinstandarderne ( figur 1B ). RBC1531 blev elueret ved et elueringsvolumen på ~ 84 ml, og dets tilsyneladende molekylvægt blev estimeret som ~ 55 kDa. I betragtning af at den beregnede molekylære viOtte af rBC1531-monomeren er ~ 13 kDa, viser disse resultater, at rBC1531 samles som en tetramer.

Renset rBC1531 blev screenet for krystallisation ved anvendelse af ~ 400 betingelser i en siddende dråbevis diffusionsmetode. RBC1531 krystallerne optrådte i ~ 2 dage ved to betingelser: tilstand-A, 0,1 M natriumcitrat (pH 5,5) og 20% ​​PEG 3000 ( figur 2A ) og betingelse-B, 0,1 M natriumcacodylat (pH 6,5) og 1,0 M natrium Citrat ( figur 2B ). Krystallisationsbetingelserne blev optimeret ved at variere pH-værdien (0,1 M natriumcitrat, pH 5,0-6,0) og koncentrationen af ​​PEG 3000 (18-21% PEG 3000) fra betingelse A og ved modifikation af pH (0,1 M natriumcacodylat, pH 5,5-6,8) og saltkoncentration (0,9-1,2 M natriumcitrat) fra betingelse-B. Diffraktions-egnede krystaller blev opnået kun for betingelse B, hvorimod krystallerne fra tilstand A var tilbøjelige til at være inter-vokset i stedet for singulære. Betingelser-B krystallerDiffrakterede røntgenstråler til en opløsning på 2,74 Å ( figur 2C ) og blev anvendt til rBC1531 strukturbestemmelse.

Observationen af ​​et konserveret MazG-domæne i BA1554-proteinsekvensen antydede tilstedeværelsen af ​​NTPase-aktivitet, der er i stand til at hydrolyse NTP'er. NTP hydrolyse giver generelt nucleosid diphosphat (NDP) og uorganisk phosphat (Pi) eller nukleosidmonophosphat (NMP) og pyrophosphat (PPi). PPi kræver yderligere pyrophosphataseaktivitet for at give Pi. Niveauer af Pi kan måles direkte ved anvendelse af molybdat, der danner et blåfarvet kompleks med Pi (molybdat-Pi), der kan overvåges under anvendelse af den optiske densitet ved en bølgelængde på 690 nm (OD 690 nm) ( Figur 3A ). I vores undersøgelse, efter NTP hydrolyse ved rBC1531, blev der ikke produceret nogen synlig blå farve efter tilsætning af molybdat ( Figur 3B ). Men da pyrophosphatase blev tilsat til rBC1531-medieret NTP-hydrolyse rEaction, farven ændret til dybblå ( figur 3B ), hvilket indikerer, at rBC1531 har NTP pyrophosphohydrolase aktivitet. Et plot af OD 690nm- og NTP-koncentrationen blev analyseret under anvendelse af en ikke-lineær regressionsmetode til bestemmelse af kinetiske parametre ( Vmax på 0,75 og Km på 10 μM) for rBC1531-enzymet ( Figur 3C ).

figur 1
Figur 1: SDS-PAGE og størrelseseksklusionskromatografi (SEC) analyse. ( A ) SDS-PAGE analyse af rBC1531. (Venstre) rBC1531-elueringsspidserne fra nikkelaffinitetskromatografi (bane 2, Ni) og SEC (bane 3) blev analyseret sammen med proteinstandarder (bane 1, mærket i kDa). (Højre) Analyse af trombinfordøjelsen af ​​rBC1531 til fjernelse af affinitetsmærket. Mængderne af thrombin tilsat til 50 μg rBC1531 i forskellige reaktioner er indIceret i enheder over gelen. ( B ) Size-exclusion chromatography (SEC) analyse af rBC1531 og proteinstandarderne. (Venstre) Elueringsprofiler af rBC1531 (blå) og standarder (rød). Molekylvægten af ​​standardproteinerne er vist over hver top i kDa. De vertikale (y) og vandrette (x) akser viser henholdsvis milliabsorptionsenhederne (mAU ved 280 nm) og retentionsvolumener (mL). (Højre) Den tilsyneladende molekylære størrelse af rBC1531 blev estimeret under anvendelse af et lineært plot for molekylvægten, i logskala og elueringsvolumener af proteinstandarder (R2 = 0,9934). Klik her for at se en større version af denne figur.

Figur 2
Figur 2: Krystallisering og røntgendiffraktion. ( A ) rBC1531 krystaller i konditi0,1 M natriumcitrat (pH 5,5) og 20% ​​PEG 3000. ( B ) rBC1531 krystaller i tilstand B, 0,1 M natriumcacodylat (pH 6,5) og 1,0 M natriumcitrat. Indledende (venstre) og optimerede (midter og højre) krystaller vises. Den optimerede rBC1531 krystal (højre, ~ 0,35 mm x ~ 0,35 mm x ~ 0,20 mm) blev anvendt til røntgendiffraktion. Skalestænger = 100 μm. ( C ) røntgendiffraktionsbillede af rBC1531 krystal opnået ved PAL strålen BL-7A 12 . Pilen angiver et sted med høj opløsning. Klik her for at se en større version af denne figur.

Figur 3
Figur 3: NTPase aktivitet. ( A ) Dannelsen af ​​molybdæn-Pi-komplekset er afhængig af Pi-koncentration. Optisk densitet ved 690 nm er diRetligt forbundet med stigning i Pi niveauer. Y-aksen og X-aksen repræsenterer henholdsvis OD 690nm og koncentrationen (μM) af Pi. ( B ) Farve ændres ved tilsætning af pyrophosphatase. I den første række af brønde blev pyrophosphatase ikke tilsat og dannede ikke det blåfarvede Pi-kompleks. Den anden række består imidlertid af brønde, hvor rBC1531-NTP-reaktionerne blev behandlet med pyrophosphatase og udviklet en blå farve. OD 690nm værdierne steg med stigning i NTP koncentrationer. ( C ) Michaelis-Menten-plot af rBC1531-NTP-reaktionerne. Y-aksen og X-aksen repræsenterer OD 690nm og koncentrationen (0-120 μM) henholdsvis NTP-substrater. Fejlstængerne repræsenterer standardafvigelsen for tre separate eksperimenter. Klik her for at se en større version af denne figur.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har intet at afsløre.

Acknowledgments

Røntgendiffraktionsdatasætene blev opsamlet ved beamline 7A i Pohang Accelerator Laboratory (Korea). Denne undersøgelse blev støttet af Basic Science Research Programmet administreret gennem Koreas National Research Foundation (NRF), finansieret af Ministeriet for Videnskab, IKT og fremtidig planlægning (2015R1A1A01057574 til MH).

Materials

Name Company Catalog Number Comments
Bacillus cereus ATCC14579 Korean Collection for Tissue Culture 3624
Genomic DNA prep kit GeneAll 106-101 Genomic DNA preparation
Forward primer Macrogen GAAGGATCCGGAAGCAAAAA
CGATGAAAGATATGCA
BamHI site is underlined
Reverse primer Macrogen CTTGTCGACTTATTCTTTCTCT
CCCTCATCAATACGTG
SalI site is underlined
nPfu-Forte Enzynomics P410 PCR polymerase
BamHI Enzynomics R003S
SalI Enzynomics R009S
pET49b expression vector Novagen 71463 Expression vector was modified to add affinity tags and BamHI/SalI sites10
T4 DNA ligase Enzynomics M001S
Dialysis memebrane Thermofisher 18265017
Dry block heater JSR JSBL-02T
LB broth (Luria-Bertani) LPS solution LB-05
LB Agar, Miller (Luria-Bertani) Becton, Dickinson and Company
Kanamycin LPS solution KAN025
Mini-prep kit Favorgen FAPDE300 Plasmid DNA preparation
BL21(DE3) Competent cell Novagen 69450-3CN
Isopropyl β-D-1-thiogalactopyranoside (IPTG) Fisher BioReagents 50-213-378
Sodium chloride Daejung 7548-4100 PBS material
Potassium chloride Daejung 6566-4405 PBS material
Potassium phosphate Bio Basic Inc PB0445 PBS material
Sodium phosphate Bio Basic Inc S0404 PBS material
Imidazole Bio Basic Inc IB0277
Sonicator Sonics VCX 130
Ni-NTA agaros Qiagen 30210 Nickel bead
Rotator Finepcr AG
Precision Plus Protein Dual Color Standards Bio-rad 1610374 SDS-PAGE protein standard
Coonmassie Brilliant Blue R-250 Fisher BioReagents BP101-25 Coomassie staining solution
Methyl alcohol Samchun chemical M0585 Coomassie staining solution
Acetic acid Daejung 1002-4105 Coomassie staining solution
Dialysis memebrane Thermofisher 68035
2-Mercaptoethanol Sigma-aldrich M6250
Thrombin Merckmillipore 605157-1KUCN Prepare aliquots of 20 μL (1 Unit per μL) and store at 70 °C and thaw before use
Superdex 200 16/600 General Electric 28989335 Size exclusion chromatography
Gel filtration standard Bio-rad 151-1901
Centrifugal filter Amicon UFC800396
Crystralization plates Hampton research HR3-083 96-well sitting drop plate
The JCSG core suite I-IV Qiagen 130924-130927 Crystallization secreening solution
Microscope Nikon SMZ745T
Cryschem plates Hampton research HR3-158 24-well sitting drop plate
Inorganic pyrophosphatase Sigma 10108987001
Ammonium molybdate solution Sigma 13106-76-8
L-ascorbic acid Sigma 50-81-7
NTP substrate Startagene 200415-51
Spectrophotometer Biotek SynergyH1 microplate reader
GraphPad Prism 5 GraphPad Prism 5 for Window

DOWNLOAD MATERIALS LIST

References

  1. Ivanova, N., et al. Genome sequence of Bacillus cereus and comparative analysis with Bacillus anthracis. Nature. 423, 87-91 (2003).
  2. Spencer, R. C. Bacillus anthracis. J Clin Pathol. 56, 182-187 (2003).
  3. Deli, A., et al. LmbE proteins from Bacillus cereus are de-N-acetylases with broad substrate specificity and are highly similar to proteins in Bacillus anthracis. FEBS J. 277, 2740-2753 (2010).
  4. Gross, M., Marianovsky, I., Glaser, G. MazG -- a regulator of programmed cell death in Escherichia coli. Mol Microbiol. 59, 590-601 (2006).
  5. Galperin, M. Y., Moroz, O. V., Wilson, K. S., Murzin, A. G. House cleaning, a part of good housekeeping. Mol Microbiol. 59, 5-19 (2006).
  6. Lee, S., et al. Crystal structure of Escherichia coli MazG, the regulator of nutritional stress response. J Biol Chem. 283, 15232-15240 (2008).
  7. Moroz, O. V., et al. Dimeric dUTPases, HisE, and MazG belong to a new superfamily of all-alpha NTP pyrophosphohydrolases with potential "house-cleaning" functions. J Mol Biol. 347, 243-255 (2005).
  8. Robinson, A., et al. A putative house-cleaning enzyme encoded within an integron array: 1.8 A crystal structure defines a new MazG subtype. Mol Microbiol. 66, 610-621 (2007).
  9. Moroz, O. V., et al. The crystal structure of a complex of Campylobacter jejuni dUTPase with substrate analogue sheds light on the mechanism and suggests the "basic module" for dimeric d(C/U)TPases. J Mol Biol. 342, 1583-1597 (2004).
  10. Green, M., Sambrook, J. Molecular cloning: A laboratory Manual. 1, John Inglis. (2012).
  11. Brown, T. A. Gene cloning an introduction. Chapman & Hall. (1986).
  12. Kim, M. I., Hong, M. Crystal structure of the Bacillus-conserved MazG protein, a nucleotide pyrophosphohydrolase. Biochem Biophys Res Commun. 472, 237-242 (2016).
  13. Sheehan, D. Physical biochemistry: Principles and applications. A John Wiley & Sons. (2009).
  14. Lesley, S. A., Wilson, I. A. Protein production and crystallization at the joint center for structural genomics. J Struct Funct Genomics. 6, 71-79 (2005).
  15. Jeon, Y. J., et al. Structural and biochemical characterization of bacterial YpgQ protein reveals a metal-dependent nucleotide pyrophosphohydrolase. J Struct Biol. 195, 113-122 (2016).
Rekombinant Protein Ekspression, Krystallisering og Biofysiske Studier af a<em&gt; Bacillus</em&gt; -konserveret nucleotidpyrophosphorylase, BcMazG
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Kim, M. I., Lee, C., Hong, M. Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG. J. Vis. Exp. (123), e55576, doi:10.3791/55576 (2017).More

Kim, M. I., Lee, C., Hong, M. Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG. J. Vis. Exp. (123), e55576, doi:10.3791/55576 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter