Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biochemistry

Rekombinant Proteinuttrykk, Krystallisering og Biofysiske Studier av a doi: 10.3791/55576 Published: May 16, 2017

Summary

Bacillus anthracis er det obligatoriske patogenet for dødelig inhalasjonsantrax, så studier av dets gener og proteiner er strengt regulert. En alternativ tilnærming er å studere ortopologiske gener. Vi beskriver biofysikk-kjemiske studier av en B. antracis ortholog i B. cereus , bc1531, som krever minimal eksperimentelt utstyr og mangler alvorlige sikkerhetsproblemer.

Abstract

For å overvinne sikkerhetsrestriksjoner og forskrifter når man studerer gener og proteiner fra ekte patogener, kan deres homologer bli studert. Bacillus anthracis er et obligatorisk patogen som forårsaker dødelig inhalasjons miltbrand. Bacillus cereus anses som en nyttig modell for å studere B. antracis på grunn av dens nære evolusjonære forhold. Genklyngen ba1554 - ba1558 av B. antracis er sterkt konservert med bc1531 - bc1535 klyngen i B. cereus , samt med bt1364-bt1368 klyngen i Bacillus thuringiensis, som indikerer den kritiske rollen til de tilknyttede gener i Bacillus slekten. Dette manuskriptet beskriver metoder for å forberede og karakterisere et proteinprodukt av det første genet ( ba1554 ) fra genklyngen i B. antracis ved bruk av et rekombinant protein av dets ortholog i B. cereus , bc1531.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Rekombinant proteinuttrykk er mye brukt til å overvinne problemer forbundet med naturlige proteinkilder, for eksempel begrensede proteinmengder og skadelig forurensning. Videre kan i en studie av patogene gener og proteiner benyttes en alternativ laboratoriestamme som ikke krever ytterligere sikkerhetsforanstaltninger. For eksempel er Bacillus cereus en nyttig modell for å studere Bacillus anthracis på grunn av deres nære evolusjonære forhold 1 .

B. antracis er et obligatorisk patogen som forårsaker dødelig inhalasjons miltbrand i mennesker og husdyr og kan potensielt brukes som bioweapon 2 . Dermed er laboratorieundersøkelser på B. antracis strengt regulert av US Centers for Disease Control, som krever biosikkerhetsnivå 3 (BSL-3) praksis, som mandatiserer laboratorieområdet segregert med negativt romtrykk. I motsetning til B. antracis B. cereus er kategorisert som et BSL-1-agent og har dermed minimal sikkerhetsproblemer. B. cereus er et opportunistisk patogen som ved infeksjon forårsaker matforgiftning som kan behandles uten medisinsk hjelp. Men fordi B. cereus deler mange kritiske gener med B. antracis , kan funksjonene til B. antracis proteiner studeres ved hjelp av tilsvarende homologer av B. cereus 1 .

Ba1554 - ba1558 genklyngen av B. antracis er sterkt konservert med bc1531 - bc1535 klyngen Av B. cereus , så vel som med bt1364-bt1368 klyngen av Bacillus thuringiensis , når det gjelder genorganisasjon og sekvens. Videre er de første gener ( ba1554 , bc1531 og bt1364 ) av de respektive klynger helt konservert ( dvs. 100% nukleotidsekvensidentitet), implisittNg en kritisk rolle for genproduktet i Bacillus- arten. På grunn av sin plassering i disse genklyngene var ba1554 feilidentifisert som en antatt transkripsjonsregulator 3 . Imidlertid indikerer aminosyresekvensanalyse av ba1554- produktet at det tilhører MazG-familien, som har nukleotidpyrofoshydrolaseaktivitet og ikke er assosiert med transkripsjonsfaktoraktivitet 4 , 5 . Selv om proteiner tilhørende MazG-familien er forskjellige med hensyn til generell sekvens og lengde, deler de et felles MazG-domene med 100 rester, karakterisert ved et EXXE 12-28 EXXD-motiv ("X" står for en hvilken som helst aminosyrerest, og tallet Angir antall X rester).

MazG-domenet tar ikke alltid ansvar for en bestemt katalytisk aktivitet. Et MazG-medlem fra Escherichia coli (EcMazG) har to MazG-domener, men påDet C-terminale MazG-domenet er enzymatisk aktivt 6 . Videre varierer substratspecifikiteten av MazG-enzymer fra ikke-spesifikke nukleosidtrifosfater (for EcMazG) til spesifikk dCTP / dATP (for integrin-assosiert MazG) og dUTP (for dUTPaser) 6 , 7 , 8 , 9 . Derfor er biofysisk-kjemiske analyser av BA1554-proteinet nødvendige for å bekrefte NTPase-aktiviteten og for å dekode dens substratspecifikitet.

Her gir vi en trinnvis protokoll som de fleste laboratorier uten et BSL-3-anlegg kan følge for å karakterisere proteinproduktet fra B. cereus bc1531- genet, som er en ortholog av B. antracis ba1554 , på molekylivå. Kort fortalt ble rekombinant BC1531 (rBC1531) uttrykt i E. coli og renset ved anvendelse av en affinitetsmerking. For røntgenkrystallografiske eksperimenter, krystallisererZationbetingelsene for rBC1531-proteinet ble screenet og optimalisert. For å vurdere den enzymatiske aktiviteten til rBC1531 ble NTPaseaktiviteten overvåket kolorimetrisk for å unngå radioaktivt merkede nukleotider som er blitt anvendt konvensjonelt. Til slutt muliggjorde analyser av de oppnådde biofysisk-kjemiske data oss å bestemme oligomeriseringstilstanden og katalytiske parametrene til rBC1531, samt å oppnå røntgendiffraksjonsdata fra rBC1531-krystallet.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Rekombinant proteinproduksjon og rensing av rBC1531

  1. Fremstilling av et rekombinant BC1531 protein (rBC1531) ekspresjon plasmid
    1. Fremstille genomisk DNA av B. cereus 10 .
    2. Forsterk bc1531- genet fra en mal av B. cereus genomisk DNA ved polymerasekjedereaksjon (PCR) ved bruk av fremover- og revers-primere (se Materialelisten) for å opprette Bam HI- og Sal I-restriktionsenzymsteder, henholdsvis 10 .
    3. Fordel PCR-produktet og en modifisert pET49b-vektor (pET49bm) ved hjelp av Bam HI og Sal I, som beskrevet 11 .
    4. Bland det fordøyede PCR-produktet og vektoren (3: 1-forhold) fra trinn 1.1.3 ved å bruke T4 DNA-ligase i en 10 μl reaksjon, som beskrevet 11 . Inkuber ved 18 ° C i 30 minutter.
    5. Pipetter 3 μl av ligeringsreaksjonen i 50 μl kjemikalieLly kompetente E. coli DH5a celler i et rør. Bland forsiktig ved pipettering opp og ned og legg på is i 30 minutter. Varm sjokk i 45 s ved 42 ° C. Tilsett 1 ml Luria-Bertani (LB) medium og dyrk cellene mens du ryster kraftig (250 rpm, 37 ° C, 45 min).
    6. Ta 100 μl av de transformerte cellene fra trinn 1.1.6 og spred dem på LB-agarplatene med 100 μg / ml kanamycin (Kan). Inkuber i ~ 18 timer ved 37 ° C.
    7. Velg kolonier ved hjelp av en steril tips og dyrk cellene i 3 ml LB medium med 100 μg / mL Kan; Rist kraftig (250 rpm, 37 ° C, 18 timer).
    8. Forbered plasmid-DNA ved bruk av en alkalisk-SDS lysismetode, som beskrevet 10 .
    9. Bekreft nukleotidsekvensen av rBC1531-ekspresjonskonstruksjonen ved bruk av DNA-sekvensering 12 .
  2. Overekspresjon av rBC1531 proteinet
    1. Omforme E. coli BL21 (DE3) stammen med rBC1531-expRunds plasmid, som beskrevet i trinn 1.1.5-1.1.6, for overekspresjon.
    2. Velg en koloni og vokse den i 10 ml LB medium som inneholder 50 μg / mL Kan (LB + Kan); Rist kraftig i 18 timer ved 37 ° C.
    3. Inokuler 10 ml nattkultur i 1 liter LB + Kan-medium og vokse ved 37 ° C til OD 600 (optisk tetthet ved 600 nm) når ~ 0,7.
    4. Dyk kulturen i iskaldt vann i ~ 15 minutter for å avkjøle temperaturen til 18 ° C og tilsette isopropyl-β-D-1-tiogalaktopyranosid (IPTG) til kulturen ved en endelig konsentrasjon på 1 mM for rekombinant proteinekspresjon. Dyrk kulturen ved 18 ° C i ytterligere ~ 16-18 timer.
  3. Rensing av rBC1531
    1. Høst cellene ved sentrifugering (5000 xg, 4 ° C, 30 min). Kast supernatanten forsiktig slik at de ikke forstyrrer cellene. Suspensere cellene i 50 ml fosfatbuffert saltoppløsning (PBS) som inneholder 10 mM imidazol.
    2. Lyse cellene to ganger ved sonikering på is for å forhindre overoppvarming av cellelysatene (tid: 2 min 30 s; syklus på: 5 s; syklus av: 10 s; amplitude: 38%).
    3. Tøm cellelysatet ved sentrifugering (~ 25.000 xg, 4 ° C, 30 min).
    4. Bland 3 ml nikkelperler og 60 ml PBS inneholdende 10 mM imidazol og tyngdekraftstrømmen den ekstra bufferen for å sedimenterte de ekvilibrerte nikkelperlene i en 2,5 x 10 cm glaskromatografikolonne.
    5. Pipett for å overføre supernatanten fra trinn 1.3.3 til kolonnen med forekvivalente nikkelperler og inkubere ved 4 ° C i 2 timer på et spinnhjul med lav hastighet (~ 20 omdr./min.).
    6. La supernatanten drenere av tyngdekraften og vask nikkelperlene i kolonnen tre ganger med 100 ml PBS inneholdende 10 mM imidazol.
    7. Eluer rBC1531 protein ved å påføre 4 x 5 ml PBS inneholdende 250 mM imidazol.
    8. Ta 15 μl av elueringen fra trinn 1.3.7 og kjør den på 15% SDS-PAGE. Visualiser proteinbåndene påGelen ved bruk av Coomassie blå farging 10 .
  4. Fjerning av affinitetsmerkene til rBC1531-proteinet ved trombinproteolyse
    1. Pipetter fraksjonene til dialyserør (molekylvekt kuttet av: 3 kDa) og plasser røret i et beger som inneholder 4 L trombinklyvningskompatibel buffer (20 mM HEPES, pH 7,4, 150 mM NaCl og 1,5 mM p-merkaptoetanol) Ved 4 ° C over natten.
    2. Pipett fraksjonene og overfør dem til et konisk rør.
    3. Mål absorbansen ved 280 nm og estimer rBC1531 proteinkonsentrasjonen, som beskrevet 13 .
    4. Ta 50 μg rBC1531 i et 0,5 ml rør og tilsett ulike mengder trombin ( dvs. 2, 1, 0,6 og 0,3 enheter). Inkuber rBC1531- og trombinreaksjonene ved 20 ° C i ~ 3 timer for å bestemme minste mengde trombin som kreves for å spalte den N-terminale affinitetstegnet.
    5. Kjør rBC1531 og trombinreaksjonene på en 15%SDS-PAGE og bestemme den laveste mengden trombin ( f.eks. 0,3 enheter trombin per 50 μg rBC1531) som fullstendig fordøyer den N-terminale affinitetsmerket og produserer en taggfri rBC1531.
    6. Tilsett 10 mg rBC1531 protein og 60 enheter trombin til et 15 ml rør og inkuber ved 20 ° C i ~ 3 timer for trombin-proteolysereaksjonen.
    7. Påfør gelfiltreringsstandarder til en SEKS-kolonne med størrelsesekskluderingskromatografi for å lage en standardkurve med molekylvekter og elueringsvolumer, som beskrevet 13 .
    8. Plasser det trombinfordelte rBC1531-proteinet fra trinn 1.4.6 i et sentrifugalfilterrør (molekylvekt kuttet av: 3 kDa) og sentrifuge ved 3000 g ved 4 ° C for å redusere til et volum på mindre enn 5 ml.
    9. Påfør det konsentrerte rBC1531-proteinet til SEC-kolonnen og oppsaml 60 eluerte fraksjoner i 0,5 ml per rør 13 .
    10. Ta 15 μl av hver fraksjon, kjør dem på en 15% SDS-PAGE, og staiN gelen ved hjelp av Coomassie-fargeløsning (0,15% (vekt / volum) Coomassie briljantblått, 40% (volum / volum) metanol og 10% (volum / volum) iseddik) som beskrevet 10 .
    11. Pipett fraksjonene som inneholder rBC1531 og samle dem i ett rør.

2. Krystallisering Screening og optimalisering av rBC1531

  1. Screeningsbetingelser for rBC1531 proteinkrystallisering
    1. Konsentrér rBC1531 fra trinn 1.4.11 opp til ~ 18,5 mg / ml ved bruk av et sentrifugalfilterrør, som beskrevet i trinn 1.4.8.
    2. Tilsett 50 μl av hver krystalliserings-screeningsløsning (se avsnitt 2.2) 14 til brønnene i 96-brønne sitte-dråpekrystallisasjonsplater. Plasser 0,5 μl av 18,5 mg / ml rBC1531 proteinoppløsningen på en sittende seng. Bland proteinoppløsningen med 0,5 μl av brønnoppløsningen, gjenta prosessen for hele platen.
    3. Dekk platen med klar limfilm.Plasser 96-brønnplatene ved 18 ° C og la det være dampdiffusjon.
    4. Skann dråpene ved 20-40X forstørrelse ved hjelp av et lysmikroskop for å overvåke krystalldannelsen daglig i 2-3 uker.
    5. Samle røntgendiffraksjonsdata 12 ved å bruke de oppnådde rBC1531 proteinkrystaller.
  2. Optimalisering av rBC1531 krystalliseringsbetingelser
    1. Forbered 500 μl av den valgte innledende krystalliseringstilstandsoppløsningen ( f.eks. 0,1 M natriumkacodylat, pH 6,5 og 1,0 M natriumcitrat) og fyll en 24-brønn krystallisasjonsplate for sittefasen.
    2. Tilsett 0,5 μL av 18,5 mg / mL rBC1531 proteinoppløsningen til en seter seng, bland med 0,5 μL av brønnoppløsningen, og dekk straks platen med klar limfilm. Plasser tallerkenen ved 18 ° C.
    3. Følg krystallveksten under et lysmikroskop i en uke.
    4. Optimaliser ulike krystalliseringsbetingelser ved å variere pH ( dvs.PH 5,5-6,8) av 0,1 M kakodylat og ved å endre saltkonsentrasjonen ( dvs. 0,9-1,2 M) natriumcitrat for å oppnå singulære krystaller. Overvåk krystallveksten i ~ 1 uke og samle røntgendiffraksjonsdata 12 .

3. Karakterisering av nukleosidtrifosfatase (NTPase) aktivitet av rBC1531

  1. Validering av den uorganiske fosfatavhengige kolorimetriske studien
    1. Forbered en bestanddel av pyrofosfat (100 mM) og fortynn den til endelige konsentrasjoner på 0,1, 0,25, 0,5, 1,0, 5,0, 10, 50, 100 og 250 uM i 200 ul reaksjonsbuffer (20 mM HEPES, pH 7,4; 150 MM NaCl og 2 mM MgCl2) i duplikatplater med 96 brønner. Bruk den første platen som en kontroll (dette inneholder ikke pyrofosfatase). Kontroller at den andre platen inneholder pyrofosfatase som arbeidsplate, som angitt i trinn 3.1.2.
    2. Legg til 0,01 enhet Saccharomyces cerevisiae uorganisk sYrofosfatase (1 μl) til brønnene på arbeidsplaten og inkuber ved 20 ° C i 30-60 minutter.
    3. Klargjør molybdatsyreoppløsning ved å blande ammoniummolybdat (0,86% volum / volum) og ascorbinsyre (14% volum / volum) oppløsninger i et 7: 3-forhold. Tilsett 16 μL molybdat syreoppløsning til både arbeids- og kontrollbrønnene og vent i 15 minutter.
    4. Les den optiske tettheten ved 690 nm (OD 690nm ).
  2. Colorimetrisk NTPase-analyse
    1. Forbered en stamme av 100 mM nukleosidtrifosfat (NTP) substrat og fortynne til ønsket konsentrasjon ( f.eks. 0, 0.2, 4.4, 11, 22, 44, 88 eller 132 μM) i 180 μl assaybuffer (20 mM HEPES, PH 7,4, 150 mM NaCl og 2 mM MgCl2).
    2. Tilsett 20 μg rBC1531 (1,5 mM) og NTP-substratene fra trinn 3.2.1 til 200 μl per reaksjon i en 96-brønn plate og pipett opp og ned for å blande godt. Dekk platen med lokket og plasser den i en 37 ° C inkubator i 30 minutterÅ utføre substrathydrolysereaksjonen.
    3. Overfør platen til et 70 ° C vannbad og la stå i 15 minutter for å stoppe rBC1531-medierte katalytiske reaksjoner.
    4. Tilsett 0,01 enhet S. cerevisiae uorganisk pyrofosfatase (1 μl) til hver brønn i reaksjonsplaten (fra trinn 3.2.3) og inkuber ved 20 ° C i 30 minutter. Tilsett 16 μL molybdat syreoppløsning på reaksjonsplaten for å utvikle fargen (~ 15 min). Les på OD 690nm .
    5. Analyser ved hjelp av Michaelis-Menten-ligningen, som beskrevet 12 .

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Karakterisering av proteinet av interesse i denne studien begynte ved å fremstille en tilstrekkelig mengde rekombinant B. cereus bc1531 (rBC1531) protein, fortrinnsvis mer enn flere milligram. DNA-fragmentet som koder for BC1531-proteinet ble fremstilt ved PCR under anvendelse av det genomiske DNA fra B. cereus som en mal, da den inneholder orthologe gener som er identiske med ba1554 . RBC1531 ble overuttrykt som et løselig protein i E. coli- celler. RBC1531-proteinet ble uttrykt med en 6x-histidin-tag og et trombin-spaltningssted ved dets N-ende 12 . Som et første trinn med rensing ble rBC1531 renset ved nikkel-affinitetskromatografi ( figur 1A ). Deretter ble det utført en trombinfordøyningsforsøk for å bestemme den laveste mengden trombin som kreves for fullstendig fordøyelse av affinitetsmerket fra rBC1531 ( figur 1A ). I våre hender var 0,3 enheter trombin sufEr villig til å helt fjerne affinitetsmerket fra rBC1531. Således ble 10 mg rBC1531 ved skalering behandlet med 60 enheter trombin for tagfjerning. Etter trombinfordøyning ble det taggfrie rBC1531 påført på en SEC-kolonne for å fjerne eventuelle oppløselige aggregater og forurensninger med høyere eller lavere molekylvekt. RBC1531-fraksjonene ble analysert ved SDS-PAGE, hvor resultatene foreslo at rBC1531 var ~ 99% rent ( figur 1A ). Totalt ga 1 liter kultur ca ~ 8 mg rBC1531 protein.

For å estimere oligomer status av rBC1531, ble SEC utført. En standard lineær kurve som korrelerer logverdien av molekylvektene til prøvene med deres tilsvarende elueringsvolumer ble plottet ved hjelp av toppene av proteinstandardene ( figur 1B ). RBC1531 ble eluert ved et elueringsvolum på ~ 84 ml, og dens tilsynelatende molekylvekt ble estimert som ~ 55 kDa. Gitt at den beregnede molekylære viÅtte av rBC1531-monomeren er ~ 13 kDa, disse resultatene indikerer at rBC1531 samles som en tetramer.

Renset rBC1531 ble screenet for krystallisering ved bruk av ~ 400 betingelser i en sitte-dråpedampdiffusjonsmetode. RBC1531 krystallene dukket opp i ~ 2 dager ved to betingelser: tilstand-A, 0,1 M natriumcitrat (pH 5,5) og 20% ​​PEG 3000 ( figur 2A ) og tilstand B, 0,1 M natriumcacodylat (pH 6,5) og 1,0 M natrium Citrat ( figur 2B ). Krystallisasjonsbetingelsene ble optimalisert ved å variere pH (0,1 M natriumcitrat, pH 5,0-6,0) og konsentrasjonen av PEG 3000 (18-21% PEG 3000) fra tilstand A og ved å modifisere pH (0,1 M natriumkakodylat, pH 5,5-6,8) og saltkonsentrasjon (0,9-1,2 M natriumcitrat) fra tilstand B. Diffraksjons-passende krystaller ble bare oppnådd for tilstand B, mens krystallene fra tilstand A hadde en tendens til å være vekst i stedet for singulær. Tilstand-B krystallerDiffrakterte røntgenstråler til en oppløsning på 2,74 Å ( figur 2C ) og ble brukt til rBC1531 strukturbestemmelse.

Observasjonen av et konservert MazG-domene i BA1554-proteinsekvensen foreslo nærværet av NTPaseaktivitet som er i stand til å hydrolyse NTPs. NTP hydrolyse gir vanligvis nukleosiddifosfat (NDP) og uorganisk fosfat (Pi) eller nukleosidmonofosfat (NMP) og pyrofosfat (PPi). PPi krever ytterligere pyrofosfataseaktivitet for å gi Pi. Nivåer av Pi kan måles direkte ved bruk av molybdat, som danner et blåfarget kompleks med Pi (molybdat-Pi) som kan overvåkes ved bruk av den optiske densitet ved en bølgelengde på 690 nm (OD 690 nm) ( Figur 3A ). I vår studie, etter NTP hydrolyse ved rBC1531, ble det ikke produsert noen synlig blå farge etter tilsetning av molybdat ( Figur 3B ). Imidlertid ble pyrofosfatase tilsatt til rBC1531-mediert NTP-hydrolysen rEaction, fargen endret til dyp blå ( figur 3B ), hvilket indikerer at rBC1531 har NTP pyrofoshydrolase aktivitet. Et plott av OD 690 nm og NTP konsentrasjonen ble analysert ved hjelp av en ikke-lineær regresjonsmetode for å bestemme de kinetiske parametrene (V max på 0,75 og K m på 10 μM) for rBC1531-enzymet ( Figur 3C ).

Figur 1
Figur 1: SDS-PAGE og size-exclusion chromatography (SEC) analyse. ( A ) SDS-PAGE analyse av rBC1531. (Venstre) rBC1531-elueringstoppene fra nikkelaffinitetskromatografi (felt 2, Ni) og SEC (felt 3) ble analysert sammen med proteinstandarder (felt 1, merket i kDa). (Høyre) Analyse av trombinfordøyelsen av rBC1531 for fjerning av affinitetsmerket. Mengden av trombin tilsatt til 50 ug rBC1531 i forskjellige reaksjoner er indIcated i enheter over gelen. ( B ) Størrelsesekskluderingskromatografi (SEC) analyse av rBC1531 og proteinstandardene. (Venstre) Elueringsprofiler av rBC1531 (blå) og standarder (rød). Molekylvektene til standardproteinene er vist over hver topp, i kDa. De vertikale (y) og horisontale (x) aksene viser henholdsvis milliabsorbsjonsenhetene (mAU ved 280 nm) og retensjonsvolumene (mL). (Høyre) Den tilsynelatende molekylære størrelsen av rBC1531 ble estimert ved bruk av et lineært plott for molekylvektene, i loggeskala og elueringsvolumer av proteinstandarder (R2 = 0,9934). Vennligst klikk her for å se en større versjon av denne figuren.

Figur 2
Figur 2: Krystallisering og røntgendiffraksjon. ( A ) rBC1531 krystaller i kondisjon0,1 M natriumcitrat (pH 5,5) og 20% ​​PEG 3000. ( B ) rBC1531 krystaller i tilstand B, 0,1 M natriumkacodylat (pH 6,5) og 1,0 M natriumcitrat. Initial (venstre) og optimalisert (midt og høyre) krystaller vises. Den optimaliserte rBC1531 krystallet (høyre, ~ 0,35 mm x ~ 0,35 mm x ~ 0,20 mm) ble brukt til røntgendiffraksjon. Skalestenger = 100 μm. ( C ) røntgendiffraksjon bilde av rBC1531 krystall oppnådd ved PAL strålelinjen BL-7A 12 . Pilen indikerer et sted med høy oppløsning. Vennligst klikk her for å se en større versjon av denne figuren.

Figur 3
Figur 3: NTPase aktivitet. ( A ) Dannelsen av molybden-Pi-komplekset er avhengig av Pi-konsentrasjon. Optisk tetthet ved 690 nm er diRett forbundet med økning i Pi nivåer. Y-aksen og X-aksen representerer henholdsvis OD 690nm og konsentrasjonen (μM) av Pi. ( B ) Farge endres ved tilsetning av pyrofosfatase. I den første rad av brønner ble ikke pyrofosfatase tilsatt og dannet ikke det blåfarvede Pi-komplekset. Den andre raden består imidlertid av brønner der rBC1531-NTP-reaksjonene ble behandlet med pyrofosfatase og utviklet en blå farge. OD 690nm verdiene økte med økning i NTP konsentrasjoner. ( C ) Michaelis-Menten-plottet av rBC1531-NTP-reaksjonene. Y-aksen og X-aksen representerer OD 690 nm og konsentrasjon (0-120 μM) av NTP-substratene, henholdsvis. Feillinjene representerer standardavviket for tre separate eksperimenter. Vennligst klikk her for å se en større versjon av denne figuren.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har ingenting å avsløre.

Acknowledgments

Røntgendiffraksjonsdatasettene ble samlet ved strålelinje 7A i Pohang Accelerator Laboratory (Korea). Denne studien ble støttet av grunnforskningsprogrammet administrert gjennom Nasjonalt forskningsstiftelse i Korea, finansiert av departementet for naturvitenskap, IKT og fremtidig planlegging (2015R1A1A01057574 til MH).

Materials

Name Company Catalog Number Comments
Bacillus cereus ATCC14579 Korean Collection for Tissue Culture 3624
Genomic DNA prep kit GeneAll 106-101 Genomic DNA preparation
Forward primer Macrogen GAAGGATCCGGAAGCAAAAA
CGATGAAAGATATGCA
BamHI site is underlined
Reverse primer Macrogen CTTGTCGACTTATTCTTTCTCT
CCCTCATCAATACGTG
SalI site is underlined
nPfu-Forte Enzynomics P410 PCR polymerase
BamHI Enzynomics R003S
SalI Enzynomics R009S
pET49b expression vector Novagen 71463 Expression vector was modified to add affinity tags and BamHI/SalI sites10
T4 DNA ligase Enzynomics M001S
Dialysis memebrane Thermofisher 18265017
Dry block heater JSR JSBL-02T
LB broth (Luria-Bertani) LPS solution LB-05
LB Agar, Miller (Luria-Bertani) Becton, Dickinson and Company
Kanamycin LPS solution KAN025
Mini-prep kit Favorgen FAPDE300 Plasmid DNA preparation
BL21(DE3) Competent cell Novagen 69450-3CN
Isopropyl β-D-1-thiogalactopyranoside (IPTG) Fisher BioReagents 50-213-378
Sodium chloride Daejung 7548-4100 PBS material
Potassium chloride Daejung 6566-4405 PBS material
Potassium phosphate Bio Basic Inc PB0445 PBS material
Sodium phosphate Bio Basic Inc S0404 PBS material
Imidazole Bio Basic Inc IB0277
Sonicator Sonics VCX 130
Ni-NTA agaros Qiagen 30210 Nickel bead
Rotator Finepcr AG
Precision Plus Protein Dual Color Standards Bio-rad 1610374 SDS-PAGE protein standard
Coonmassie Brilliant Blue R-250 Fisher BioReagents BP101-25 Coomassie staining solution
Methyl alcohol Samchun chemical M0585 Coomassie staining solution
Acetic acid Daejung 1002-4105 Coomassie staining solution
Dialysis memebrane Thermofisher 68035
2-Mercaptoethanol Sigma-aldrich M6250
Thrombin Merckmillipore 605157-1KUCN Prepare aliquots of 20 μL (1 Unit per μL) and store at 70 °C and thaw before use
Superdex 200 16/600 General Electric 28989335 Size exclusion chromatography
Gel filtration standard Bio-rad 151-1901
Centrifugal filter Amicon UFC800396
Crystralization plates Hampton research HR3-083 96-well sitting drop plate
The JCSG core suite I-IV Qiagen 130924-130927 Crystallization secreening solution
Microscope Nikon SMZ745T
Cryschem plates Hampton research HR3-158 24-well sitting drop plate
Inorganic pyrophosphatase Sigma 10108987001
Ammonium molybdate solution Sigma 13106-76-8
L-ascorbic acid Sigma 50-81-7
NTP substrate Startagene 200415-51
Spectrophotometer Biotek SynergyH1 microplate reader
GraphPad Prism 5 GraphPad Prism 5 for Window

DOWNLOAD MATERIALS LIST

References

  1. Ivanova, N., et al. Genome sequence of Bacillus cereus and comparative analysis with Bacillus anthracis. Nature. 423, 87-91 (2003).
  2. Spencer, R. C. Bacillus anthracis. J Clin Pathol. 56, 182-187 (2003).
  3. Deli, A., et al. LmbE proteins from Bacillus cereus are de-N-acetylases with broad substrate specificity and are highly similar to proteins in Bacillus anthracis. FEBS J. 277, 2740-2753 (2010).
  4. Gross, M., Marianovsky, I., Glaser, G. MazG -- a regulator of programmed cell death in Escherichia coli. Mol Microbiol. 59, 590-601 (2006).
  5. Galperin, M. Y., Moroz, O. V., Wilson, K. S., Murzin, A. G. House cleaning, a part of good housekeeping. Mol Microbiol. 59, 5-19 (2006).
  6. Lee, S., et al. Crystal structure of Escherichia coli MazG, the regulator of nutritional stress response. J Biol Chem. 283, 15232-15240 (2008).
  7. Moroz, O. V., et al. Dimeric dUTPases, HisE, and MazG belong to a new superfamily of all-alpha NTP pyrophosphohydrolases with potential "house-cleaning" functions. J Mol Biol. 347, 243-255 (2005).
  8. Robinson, A., et al. A putative house-cleaning enzyme encoded within an integron array: 1.8 A crystal structure defines a new MazG subtype. Mol Microbiol. 66, 610-621 (2007).
  9. Moroz, O. V., et al. The crystal structure of a complex of Campylobacter jejuni dUTPase with substrate analogue sheds light on the mechanism and suggests the "basic module" for dimeric d(C/U)TPases. J Mol Biol. 342, 1583-1597 (2004).
  10. Green, M., Sambrook, J. Molecular cloning: A laboratory Manual. 1, John Inglis. (2012).
  11. Brown, T. A. Gene cloning an introduction. Chapman & Hall. (1986).
  12. Kim, M. I., Hong, M. Crystal structure of the Bacillus-conserved MazG protein, a nucleotide pyrophosphohydrolase. Biochem Biophys Res Commun. 472, 237-242 (2016).
  13. Sheehan, D. Physical biochemistry: Principles and applications. A John Wiley & Sons. (2009).
  14. Lesley, S. A., Wilson, I. A. Protein production and crystallization at the joint center for structural genomics. J Struct Funct Genomics. 6, 71-79 (2005).
  15. Jeon, Y. J., et al. Structural and biochemical characterization of bacterial YpgQ protein reveals a metal-dependent nucleotide pyrophosphohydrolase. J Struct Biol. 195, 113-122 (2016).
Rekombinant Proteinuttrykk, Krystallisering og Biofysiske Studier av a<em&gt; Bacillus</em&gt; -konserverte nukleotidpyrofosforylase, BcMazG
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Kim, M. I., Lee, C., Hong, M. Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG. J. Vis. Exp. (123), e55576, doi:10.3791/55576 (2017).More

Kim, M. I., Lee, C., Hong, M. Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG. J. Vis. Exp. (123), e55576, doi:10.3791/55576 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter