The manuscript describes a chip-based digital PCR assay to detect a rare CDH1 transcript variant (CDH1a) in fresh-frozen normal and tumor tissues obtained from patients with gastric cancer.
A subscription to JoVE is required to view this content. Sign in or start your free trial.
Method Article
The manuscript describes a chip-based digital PCR assay to detect a rare CDH1 transcript variant (CDH1a) in fresh-frozen normal and tumor tissues obtained from patients with gastric cancer.
CDH1a, a non-canonical transcript of the CDH1 gene, has been found to be expressed in some gastric cancer (GC) cell lines, whereas it is absent in normal gastric mucosa. Recently, we detected CDH1a transcript variant in fresh-frozen tumor tissues obtained from patients with GC. The expression of this variant in tissue samples was investigated by the chip-based digital PCR (dPCR) approach presented here. dPCR offers the potential for an accurate, robust, and highly sensitive measurement of nucleic acids and is increasingly utilized for many applications in different fields. dPCR is capable of detecting rare targets; in addition, dPCR offers the possibility for absolute and precise quantification of nucleic acids without the need for calibrators and standard curves. In fact, the reaction partitioning enriches the target from the background, which improves amplification efficiency and tolerance to inhibitors. Such characteristics make dPCR an optimal tool for the detection of the CDH1a rare transcript.
The CDH1 gene encodes for E-cadherin, a key factor involved in the maintenance of the normal gastric epithelium through the regulation of cell adhesion, survival, proliferation, and migration1. Loss of E-cadherin protein as a result of deleterious germline or somatic alterations of CDH1 has been associated with the development of GC2,3. Non-canonical transcripts arising from intron 2 of the gene have also been hypothesized to play a role in gastric carcinogenesis4,5. In particular, one such transcript, CDH1a, has been shown to be expressed in GC cell lines but is absent from the normal stomach4. We recently detected CDH1a in GC tissue samples from GC patients using chip-based dPCR5. dPCR was used to evaluate, for the first time, the presence of the CDH1a gene transcript in intestinal GC and in normal tissue.
The gold standard method to determine gene expression is Real-Time quantitative PCR (qPCR). However, the resulting data can sometimes be variable and of poor quality, especially when the level of target in the sample is low. This variability can be caused by contaminants, which inhibit polymerase activity and primer annealing, leading to non-specific amplification and competitive side reactions6.
Although the basic biochemical principles of dPCR are similar to those of qPCR, dPCR shows some advantages, allowing for very precise measurements of genomic DNA (gDNA)/complementary DNA (cDNA) molecules. Indeed, dPCR is an end-point reaction that relies on the calibrated partitioning of a sample into thousands of wells, so that each well contains zero or a single target molecule. Amplification then occurs only in the wells containing a copy of the target and is indicated by a fluorescent signal. The absolute number of target molecules in the original sample can then be calculated by determining the ratio of positive to total partitions using binomial Poisson statistics7.
In addition, the dPCR technique eliminates the need for running a standard curve and, hence, the associated bias and variability, allowing for a direct quantification of targets8,9; it produces more precise and reproducible results independently of contaminants and efficiency due to its high tolerance to inhibitors10; it is more sensitive and specific than qPCR, and is thus a reliable method for the detection of a rare target. Finally, the partitioning of the sample into multiple reactions reduces the competition with background molecules and improves the limit of target detection, making amplification possible and facilitating the detection of single molecules of gDNA/cDNA6. The detection and quantification of nucleic acids by chip-based dPCR has been increasingly applied to copy number variation, quantification of DNA fragments, and mutation analyses11,12,13, given the precision and low material input requirement of the method. In addition, dPCR has recently been integrated into the analysis of both microRNAs14 and gene transcripts5,15.
Access restricted. Please log in or start a trial to view this content.
The protocol follows the guidelines of the IRST Human Research Ethics Committee.
NOTE: This procedure is specifically designed for the detection of a low number of cDNA molecules in human fresh-frozen tissues. The tissue sections have been cut on dry ice, while still frozen, from previously validated patient-derived gastric tumor or normal tissue samples.
1. RNA Isolation and Purification
2. cDNA Synthesis
3. Digital PCR Reaction Set Up
4. Data Analysis and Interpretation
Access restricted. Please log in or start a trial to view this content.
Using the procedure presented here, we checked for the expression of the rare transcript variant CDH1a in gastric fresh-frozen tissues. The analysis by dPCR was performed on 21-paired normal and cancer tissue samples and in 11 additional tumor samples. CDH1a was detectable in 15 out of 32 (47%) tumors, whereas no normal tissue samples showed the presence of this rare transcript5. In our analysis, chips with less than 13,000 data points were reject...
Access restricted. Please log in or start a trial to view this content.
dPCR was originally developed for DNA molecular measurements10,11,12,13 and in time this technology was adapted for the quantification of microRNAs and RNA transcripts5,14,15. In this protocol we have extended the list of applications to include detection of rare transcripts derived from fresh-frozen t...
Access restricted. Please log in or start a trial to view this content.
The authors report no conflicts of interest for this work.
The authors wish to thank Gráinne Tierney for editorial assistance.
Access restricted. Please log in or start a trial to view this content.
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| TRIazol Reagent | Thermo Fisher Scientific | 15596018 | |
| Glycogen 20 mg/ml | ROCHE | 10901393001 | |
| RNeasy MinElute Cleanup kit | QIAGEN | 74204 | |
| iScript cDNA Synthesis kit | BioRad | 1708891 | |
| QuantStudio 3D Digital PCR Master Mix v2 | Thermo Fisher Scientific | A26358 | |
| CDH1a IDT custom designed assay | Integrated DNA Technologies (IDT) | NA | F) GCTGCAGTTTCACTTTTAGTG (R) ACTTTGAATCGGGTGTCGAG (P)/FAM/CGGTCGACAAAGGACAGCCTATT/TAMRA/ [dPCR optimized assay concentrations: 900 nM (F), 900 nM (R), 250 nM (P)] |
| QuantStudio 3D Digital PCR 20K Chip Kit v2 | Thermo Fisher Scientific | A26316 | |
| Heraeus Biofuge Fresco | Thermo Scientific | 75002402 | |
| Thermocycler (Labcycler) | Sensoquest | 011-103 | |
| GeneAmp PCR System 9700 | Thermo Fisher Scientific | N805-0200 | |
| Dual Flat Block Sample Module | Thermo Fisher Scientific | 4425757 | |
| QuantStudio 3D Tilt Base for Dual Flat Block GeneAmp PCR System 9700 | Thermo Fisher Scientific | 4486414 | |
| QuantStudio 3D Digital PCR Chip Adapter Kit for Flat Block Thermal Cycler | Thermo Fisher Scientific | 4485513 | |
| QuantStudio 3D Digital PCR Chip Loader | Thermo Fisher Scientific | 4482592 | |
| QuantStudio 3D Digital PCR Instrument with power cord | Thermo Fisher Scientific | 4489084 |
Access restricted. Please log in or start a trial to view this content.