Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Cancer Research

Rilevamento di una variante rara trascrizione CDH1 in tessuti di cancro gastrico fresco congelato mediante PCR digitale basata su Chip

doi: 10.3791/57066 Published: February 5, 2018

Summary

Il manoscritto descrive un chip digitale test PCR per rilevare una variante rara di trascrizione CDH1 (CDH1a) nel normale fresco-congelato e tessuti del tumore ottenuti da pazienti con cancro gastrico.

Abstract

CDH1a, una non-canonica trascrizione del gene CDH1 , è stato trovato per essere espresso in alcune linee cellulari di cancro gastrico (CG), mentre è assente nel mucosa gastrico normale. Recentemente, abbiamo rilevato la variante di trascrizione di CDH1a nei tessuti di fresco-congelato del tumore ottenuti da pazienti con GC. L'approccio PCR (dPCR) digitale basata su chip qui presentata è stata studiata l'espressione di questa variante nei campioni di tessuto. dPCR offre il potenziale per una misurazione accurata, robusto e altamente sensibile degli acidi nucleici ed è sempre più utilizzata per molte applicazioni in diversi campi. dPCR è in grado di rilevare gli obiettivi rari; Inoltre, dPCR offre la possibilità di assoluta e precisa quantificazione degli acidi nucleici senza la necessità di calibratori e curve standard. Infatti, la reazione di partizionamento arricchisce la destinazione dallo sfondo, che migliora l'efficienza di amplificazione e tolleranza agli inibitori. Tali caratteristiche rendono dPCR uno strumento ottimo per la rilevazione della trascrizione rara CDH1a .

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Il gene CDH1 codifica per E-caderina, un fattore chiave coinvolti nel mantenimento dell'epitelio gastrico normale attraverso il regolamento di adesione, sopravvivenza, proliferazione e migrazione delle cellule1. Perdita della proteina di E-caderina a seguito di germline deleteri o alterazioni somatiche del CDH1 sono state associate con lo sviluppo di GC2,3. Trascritti non canonici derivanti da introne 2 del gene inoltre sono stati supposti per svolgere un ruolo nella carcinogenesi gastrica4,5. In particolare, una tale trascrizione, CDH1a, ha dimostrato di essere espressi in linee cellulari di GC ma è assente dalla stomaco normale4. Abbiamo recentemente rilevato CDH1a nei campioni di tessuto di GC da pazienti di gascromatografia usando basata su chip dPCR5. dPCR è stato utilizzato per valutare, per la prima volta, la presenza della trascrizione del gene CDH1a in GC intestinale e nel tessuto normale.

Il metodo gold standard per determinare l'espressione genica è Real-Time PCR quantitativa (qPCR). Tuttavia, i dati risultanti possono a volte essere variabile e di scarsa qualità, soprattutto quando il livello di destinazione nel campione è basso. Questa variabilità può essere causata da contaminanti, che inibiscono l'attività della polimerasi e primer di ricottura, che conduce a lato competitivo reazioni6e amplificazione aspecifici.

Anche se i principi di base biochimici di dPCR sono simili a quelli di qPCR, dPCR Mostra alcuni vantaggi, consentendo misurazioni molto precise del DNA genomico (gDNA) / complementari molecole di DNA (cDNA). Infatti, dPCR è una reazione di punto finale che si basa sulla compartimentazione calibrato di un campione in migliaia di pozzi, affinché ciascun pozzetto contiene zero o una molecola bersaglio singolo. Amplificazione, quindi, si verifica solo nei pozzetti contenenti una copia del database di destinazione e viene indicato da un segnale fluorescente. Il numero assoluto di molecole bersaglio nel campione originale può quindi essere calcolato determinando il rapporto di positivo per partizioni totali utilizzando binomiale Poisson statistiche7.

Inoltre, la tecnica di dPCR Elimina la necessità per l'esecuzione di una curva standard e, quindi, il bias associato e variabilità, che consente una quantificazione diretta di obiettivi8,9; produce risultati più precisi e riproducibili indipendentemente da contaminanti ed efficienza grazie alla sua elevata tolleranza a inibitori10; esso è più sensibile e specifico rispetto qPCR e così è un metodo affidabile per la rilevazione di un obiettivo raro. Infine, la suddivisione del campione in reazioni multiple riduce la concorrenza con molecole di fondo e migliora il limite di individuazione del bersaglio, rendendo possibile l'amplificazione e facilitando la rilevazione di singole molecole di gDNA/cDNA6 . La rilevazione e la quantificazione degli acidi nucleici da dPCR basata su chip è stato sempre più applicato per copiare numero variazione, frammenti di quantificazione del DNA e mutazione analizza11,12,13, dato il precisione e basso materiale requisito del metodo di input. Inoltre, dPCR recentemente è stato integrato nell'analisi di entrambi i microRNA14 e gene trascrizioni5,15.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Il protocollo segue le linee guida del Comitato di etica IRST umana ricerca.

Nota: Questa procedura è specificamente progettata per il rilevamento di un basso numero di molecole di cDNA in tessuti umani fresco-congelato. Le sezioni di tessuto sono state tagliate il ghiaccio secco, mentre ancora congelato, da tumore gastrico paziente-derivato precedentemente convalidato o campioni di tessuto normale.

1. RNA isolamento e purificazione

  1. Estrazione del RNA
    Nota: Isolamento del RNA viene eseguita sotto il cofano usando un prodotto specifico (Vedi Tabella materiali). Tuttavia, una varietà di kit di isolamento sono disponibili in commercio.
    1. Omogeneizzare 50-100 mg di campione di tessuto fresco congelato tagliato finemente in una provetta da 1,5 mL con 1 mL di reagente di isolamento del RNA e vortice vigorosamente per 15 s. Incubare le provette a-80 ° C durante la notte.
    2. Incubare la provetta contenente il campione a temperatura ambiente per 5 minuti e mescolare nel Vortex per 15 s.
    3. Tenere il tubo sul ghiaccio, aggiungere 200 µ l di cloroformio e agitare vigorosamente per 15 s.
    4. Incubare le provette a temperatura ambiente per 60 s e centrifugare a 12.000 x g per 15 min a 4 ° C.
    5. Trasferire la fase acquosa in una provetta da 1,5 mL e aggiungere 20 µ g di glicogeno.
      Nota: È importante evitare accuratamente di trasferire qualsiasi interfase o strato organico al fine di ridurre la contaminazione.
    6. Aggiungere 500 µ l di isopropanolo, invertendo il tubo per miscelare e incubare in ghiaccio per 10 min.
    7. Centrifugare la provetta a 12.000 x g per 15 min a 4 ° C per precipitare il RNA.
      Nota: RNA sarà presente un simil-gel a pellet sul lato e sul fondo della provetta, spesso invisibile dopo la centrifugazione.
    8. Rimuovere il sopranatante senza disturbare il precipitato e lavare con 1 mL di etanolo al 75% di pipettaggio.
    9. Centrifugare la provetta a 7.500 x g per 5 min a 4 ° C e rimuovere il sopranatante senza disturbare il pellet.
    10. Lasciate che il pellet a secco fino a quando il precipitato diventa trasparente e scioglierla in 50 µ l di acqua RNAsi-libera.
    11. Congelare i campioni a-80 ° C almeno una notte prima di quantificazione.
  2. Eliminazione del DNA genomico e purificazione di RNA
    Nota: Una fase di digestione DNasi, seguita da una purificazione di RNA basata su colonne, è consigliabile per le analisi degli obiettivi di basso-abbondanza per digerire DNA contaminante.
    1. Sciogliere il liofilizzato dnasi I (1.500 unità Kunitz) nel 550 µ l di RNAsi-libera dell'acqua utilizzando una siringa, mix delicatamente capovolgendo il flacone e dividere la soluzione ricostituita di stock in aliquote.
    2. Trasferire in una provetta da 1,5 mL il volume calcolato del campione con 15 µ g di RNA, 10 µ l di dnasi digestione dal kit (elencati in Tabella materiali), 2,5 µ l di dnasi I stock soluzione tampone e RNAsi-libera di acqua a 100 µ l. Incubare a temperatura ambiente per 10 min.
    3. Aggiungere 350 µ l di tampone di lisi del tessuto (da kit, Vedi Tabella materiali) e Miscelare pipettando.
    4. Aggiungere 250 µ l di etanolo al 100% e mescolare pipettando.
    5. Trasferire l'intero volume (700 µ l) in una nuova colonna di spin e centrifugare a 12.000 x g per 15 s.
    6. Il filtro di trasferimento in una nuova provetta di raccolta, aggiungere 500 µ l di etanolo di 80% per la colonna e centrifugare a 12.000 x g per 2 min.
    7. Aprire il coperchio della centrifuga colonna e centrifugare a 12.000 x g per 5 min con un nuovo tubo di raccolta per asciugare il filtro; quindi trasferire il filtro in una provetta da 1,5 mL.
    8. Aggiungere 14 µ l di acqua RNAsi-libera direttamente alla colonna filtro e centrifugare a 12.000 x g per 1 min.
    9. Mantenere i campioni su ghiaccio e procedere alla quantificazione utilizzando 2 µ l del campione su un spettrofotometro da banco o memorizzare il RNA a-80 ° C fino all'utilizzo.

2. sintesi del cDNA

  1. Posto 1.000 ng di RNA, 4 µ l di master mix, 1 µ l di trascrittasi inversa e RNAsi-libera di acqua ad un volume finale di 20 µ l in una provetta sterile da PCR. Mescolare delicatamente e rotazione verso il basso.
  2. Incubare il mix di reazione in un termociclatore, applicando le seguenti condizioni: 5 min a 25 ° C, 30 min a 42 ° C, 5 min a 85 ° C.
  3. Centrifugare brevemente le provette e procedere all'analisi dPCR o conservare a-20 ° C fino a quando necessario.

3. reazione di PCR digitale impostato

  1. reazione di dPCR mescolare e preparazione dei campioni
    1. Scongelare il mix master e test a temperatura ambiente per almeno 20 min.
    2. Diluire i campioni di cDNA a una concentrazione di 300 ng in 6 µ l di acqua.
    3. Delicatamente vortice il master mix e preparare la miscela in una provetta sterile con 8,7 µ l di master mix, 0,87 µ l di primer personalizzato progettato saggio CDH1a e 1,83 µ l di acqua priva di nucleasi per un volume finale di 11,4 µ l.
      Nota: Per CDH1a personalizzato progettato saggio primer dettagli vedere la Tabella dei materiali.
    4. Trasferire il campione di cDNA diluito 11,4 µ l della miscela preparata, mescolare delicatamente e centrifugare brevemente.
      Nota: I volumi comprendono l'eccesso del 20% per compensare la perdita di volume da pipettaggio. Preparare la miscela per tutti i campioni e un controllo privo di templato (NTC).
  2. Preparazione chip
    Nota: Per risultati ottimali caricare i chip più presto possibile.
    1. Collegare il caricatore di chip e attendere finché l'indicatore luminoso diventa verde.
    2. Rimuovere il cappuccio della siringa fluido immersione delicatamente tirando indietro lo stantuffo 1-2 mm e rilasciarlo per facilitare questo passaggio e sostituirlo con una punta.
    3. Prendere un nuovo chip e prendere nota del codice scritto sul coperchio per associarlo con il campione.
    4. Tenere il coperchio con attenzione dal suo lato, togliere la pellicola protettiva e posizionare il coperchio con il viso appiccicoso fino con l'orientamento corretto.
    5. Attentamente pick up un chip, avendo cura di non per toccare la parte interna e caricarlo sul nido di chip nella posizione corretta premendo verso il basso la leva per aprire il morsetto.
    6. Caricare una nuova pala di caricamento sul caricatore e spingerlo delicatamente per garantire che sia saldamente in posizione.
    7. Trasferire 14.5 µ l della miscela di reazione dPCR sulla lama caricamento senza fare bolle d'aria o deviare la lama, dopo che stampa il nero carico pulsante per distribuire il volume sul chip.
    8. Utilizzare la siringa del liquido di immersione per trasferire circa 20 gocce sulla superficie del chip facendo attenzione a non per toccare la superficie con la punta.
      Nota: È importante coprire l'intera superficie senza versare il liquido sopra i bordi.
    9. Ruotare il braccio caricatore per fare il coperchio venga a contatto con il chip e premere verso il basso per 15 s.
    10. Premere l'apposito pulsante per rilasciare il chip e riportare il braccio in posizione.
    11. Tenere il chip montato a un angolo di 45° e attentamente erogare il liquido di immersione con la siringa attraverso la porta di riempimento, ruotare il chip leggermente per assicurarsi che ci siano bolle d'aria e rimuovere il liquido in eccesso con un panno sterile.
    12. Sigillare il caso di chip da staccando delicatamente l'etichetta in cima al coperchio di chip e premere sopra la porta di riempimento per almeno 5 s.
    13. Conservare il chip al buio fino al momento di caricare nel termociclatore.
      Nota: Chip preparato deve essere utilizzato entro 2 h.
  3. reazione di dPCR
    1. Aprire il coperchio e installare gli adattatori per entrambi i blocchi, anche quando viene utilizzato un unico blocco.
    2. Posizionare la fiches sul blocco campione nella posizione corretta.
      Nota: La porta di riempimento deve essere orientata verso la parte anteriore del termociclatore in una posizione elevata per consentire eventuali bolle d'aria a galleggiante verso l'alto senza disturbare la finestra del chip. Utilizzare chip vuoto per bilanciare i due blocchi.
    3. Posare il pad termico sul blocco campione per coprire completamente i chip.
    4. Chiudere il coperchio e iniziare la PCR esegue, applicando le seguenti condizioni: tenere a 96 ° C per 10 min; 45 cicli di 60 ° C per 2 min e 98 ° C per 30 s; tenere a 60 ° C per 2 min; tenere a 4 ° C. Spegnere il termociclatore e scongelare i chip a temperatura ambiente per almeno 10 min.
      Nota: Analisi di Chip devono essere eseguito entro un'ora.
  4. Analisi di chip
    1. Aprire il coperchio dello strumento e rimuovere i thermal pad, quindi rimuovere i chip dalle schede.
      Nota: Conservare i chip in un luogo scuro, pulito fino all'analisi.
    2. Pulire la superficie del chip con isopropanolo e un panno sterile.
      Nota: Ispezionare ogni chip per perdite o problemi potenziali.
    3. Inserire il cavo USB nel sistema rivelatore per salvare i dati.
    4. Aprire il vassoio del sistema rivelatore, caricare il chip a faccia in su nella posizione corretta e quindi chiudere il vassoio.
    5. Aspettare 30 s per l'elaborazione, quindi rimuovere il chip e inserire quello successivo.
    6. Attendere l'analisi essere completato per tutti i chip trasformati quindi inserire il cavo USB in un computer per trasferire i file.
      Nota: Il tempo totale per l'analisi è di circa 2 a 3 min/chip.

4. dati analisi e interpretazione

  1. Connettersi alla piattaforma cloud-based del software necessario per svolgere tutte le analisi a valle.
  2. Creare un progetto e importare tutti i file di dati dei chip di interesse.
  3. Immettere il nome del campione; Selezionare la tintura e il dosaggio utilizzato nella scheda "Definire Chips".
  4. Determinare se il chip è accettabile da visualizzarlo direttamente nella scheda "Modifica dati", il controllo come accuratamente il campione è stato caricato sul chip e quanti punti dati sono valutabili.
    Nota: Rifiutare chip con meno di 13.000 punti dati valutabili.
  5. Passare alla dispersione del chip selezionato sul lato destro dello schermo; applica una soglia di 6.000 per i segnali di colorante reporter di fluorescina amidite (FAM) (asse y) a tutte le chips.
    Nota: Impostata la soglia può variare sulla base di analisi utilizzate.
  6. Rimuovi qualsiasi dubbie segnali positivi per evitare risultati falsi positivi selezionando il relativo posto lo scatter plot usando lo strumento lazo e premendo su "indeterminato". Tutti i rimanenti punti positivi indicano la presenza di copie del cDNA della rara destinazione analizzati.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Utilizzando la procedura qui presentata, abbiamo controllato per l'espressione della variante rara trascrizione CDH1a in tessuti gastrici fresco-congelato. L'analisi di dPCR è stato effettuato su campioni 21-accoppiato di tessuto normali e tumorali e in 11 campioni tumorali aggiuntive. CDH1a era rilevabile nei tumori 15 su 32 (47%), mentre nessun campioni di tessuto normali hanno mostrato la presenza di questa rara trascrizione5. Nella nostra analisi, chip con meno di 13.000 punti di dati sono stati respinti, come erano patatine con caricamento non omogenei. Figura 1 Mostra un chip Mostra valutabili (Figura 1A) sia non valutabili (Figura 1B, C) per i campioni. Nel secondo caso, il chip deve essere scartato a causa della presenza di bolle multiple (Figura 1B), una singola bolla grande (Figura 1), o come risultato di un insufficiente numero di punti di dati sopra soglia (Figura 1B). Questi campioni devono essere eseguiti nuovamente per ottenere risultati interpretabili. Per quanto riguarda il tracciato a dispersione fornito dal software (Figura 2), raffigura normalmente i segnali dalla tintura di reporter FAM (asse y) contro i segnali dalla tintura di reporter di VIC (proprietario del produttore) (asse x). I punti di dati presentati sul grafico a dispersione sono color-coded, e qui, abbiamo solo visualizzati i segnali di colorante reporter FAM in blu (Figura 2A), che indica i pozzi in cui il bersaglio è stato amplificato. Questi segnali sono situati più vicino all'asse y e più lontano l'origine della trama. Il secondo colore visto sulla trama è giallo ed è indicativo dei pozzetti in cui si è verificato nessuna amplificazione. Una soglia affidabile per i segnali positivi è stata impostata e applicata a tutti i chip per evitare bias di chiamata. Qui, la soglia selezionata era 6.000 basato sulla gamma dei segnali osservati per i vari chip in questi esperimenti. CDH1a cDNA copie (segnali blu) sono state trovate in un numero di campioni tumorali, mostrando una chiara differenza nell'ampiezza da segnali negativi (Figura 2A). Al contrario, nessun segnale sopra la soglia selezionata sono stato trovato nei campioni negativo per CDH1a trascrizione, cioè, tutti i campioni di tessuto normale e alcuni campioni di tumore (Figura 2B). Allo stesso modo, nessun segnali positivi sono stati rilevati in NTC in cui è stato aggiunto acqua invece di cDNA, quindi serve come controllo negativo per la reazione di dPCR (Figura 2).

Un'analisi di chip bene devono essere applicati ai punti dati filtro la bassa qualità ed eliminare il rischio di risultati ambigui. Questo è stato fatto visualizzando il chip per determinare la posizione esatta del corrispondente segnale positivo: se il segnale blu si trova alle frontiere molto del chip (Figura 3A) o intorno a bolle (Figura 1B), il segnale è respinto dall'analisi . Per evitare ulteriormente il rischio di falsi positivi, i segnali sopra 6.000 per il canale di FAM e all'estrema destra della trama sono stati considerati come probabilmente aspecifica e così sono stati filtrati fuori, anche se sono stati localizzati anche all'interno del chip (Figura 3B). In questo modo, un campione è considerato positivo per l'espressione della trascrizione rara, CDH1a, anche se si vede un segnale singolo amplificazione, finchè quel segnale soddisfa le condizioni di cui sopra.

Figure 1
Figura 1 . Rappresentante chip valutabili e non valutabili. I punti blu sono pozzi in cui è stata amplificata la trascrizione di CDH1a ; i puntini gialli sono pozzi in cui si è verificato nessuna amplificazione; i punti bianchi sono pozzi vuoti. Punti di dati sopra soglia sono indicati sotto ogni chip. (A), un chip valutabile con blue segnali localizzati anche all'interno dei confini del chip. (B), un chip non valutabili con meno di 13.000 punti dati sopra soglia. (C) A chip non valutabili con una grande bolla. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 2
Figura 2 . Rappresentante digitale PCR dispersione di CDH1a espressione. Trame raffigurano i segnali provenienti dalla tintura di reporter FAM (asse y) contro i segnali dalla tintura di reporter di VIC (asse x). I punti blu sono segnali positivi di espressione di CDH1a , mentre i puntini gialli sono i segnali di "Amplificazione". (A) CDH1a-campione positivo. (B) CDH1a-campione negativo. (C) nessun controllo del modello (NTC) risultati zero espressione di CDH1a . Clicca qui per visualizzare una versione più grande di questa figura.

Figure 3
Figura 3 . Analisi rappresentativa di multa-chip di dispersione PCR digitale trame. Sulla sinistra è la vista di chip con i segnali di interesse zoom-in un nero quadrato, mentre sulla destra è il corrispondente diagramma a dispersione. (A) un segnale blu localizzato sulla frazione corretta della trama, ma al bordo del chip. (B) tre segnali blu evidenziati in grigio localizzato all'estrema destra della trama, ma all'interno del chip. Clicca qui per visualizzare una versione più grande di questa figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

dPCR è stato originariamente sviluppato per DNA molecolare misure10,11,12,13 e nel tempo che questa tecnologia è stata adattata per la quantificazione dei microRNA e RNA trascrizioni5, 14,15. In questo protocollo abbiamo esteso l'elenco delle applicazioni per includere il rilevamento delle rare trascrizioni derivate da campioni di tessuto fresco congelato. A tale scopo abbiamo utilizzato una quantità piuttosto elevata di cDNA (300 ng). Anche se tale importo non è il massimo che può essere utilizzato in dPCR, era sufficiente a configurare condizioni standardizzate per confrontare tutti i nostri campioni. Impostando la soglia di segnale di estirpare a 6.000 e badando le posizioni di amplificazione positivi segnali su entrambi i chip e scatter plot, abbiamo rilevato con successo questo obiettivo raro nei campioni di tessuto del tumore gastrico.

Da dPCR, noi non potevamo assolutamente quantificare CDH1a, a causa di una quantità molto bassa del target, ma abbiamo potuto valutare in modo affidabile la presenza/assenza di questa rara trascrizione. Infatti, la natura quantitativa di questa tecnica è limitata dal numero iniziale di bersagli presenti nei campioni analizzati7. Di rilevanza, la stessa tecnica resta abbastanza costosi e tempo ad alta intensità. Così, quando l'analisi di numerosi campioni e/o di obiettivi diversi è necessaria, tecniche alternative dovrebbero essere considerati7,8.

Detto questo, dPCR indubbiamente fornisce la piattaforma ideale per misura sensibile e quantificazione degli acidi nucleici, come migliora la precisione e la riproducibilità rispetto qPCR7,8. Inoltre, potrebbe essere considerato come l'unico metodo disponibile per l'analisi di espressione genica di basso-abbondanti acidi nucleici che vicino al limite di qPCR sensibilità6.

Il protocollo qui descritto può essere adattato a RNA da tessuti, che permette la rilevazione di bersagli rari, come nel nostro studio. Inoltre, il test potrebbe essere esteso sulla quantificazione assoluta delle trascrizioni. In tali casi, il numero di copie / µ l segnalati dallo strumento per un dato campione deve essere moltiplicato per il volume di reazione caricato semplicemente e diviso per la quantità iniziale di cDNA. Per superare la variabilità prodotta da d'inversione-trascrizione, calibratori di gene-specifico dovrebbero essere inclusi, quando possibile6. Guardando al futuro, dPCR detiene un notevole potenziale a diventare la piattaforma di gold standard, non solo per il rilevamento della sequenza rara, ma anche la rilevazione di mutazione rara e precisa copia numero quantificazione7. Questo è particolarmente rilevante in mosaicismo genetico, così come nella ricerca sul cancro dove eterogeneità del tumore possono influire sull'esito clinico di un paziente e risposta al trattamento.

Dal punto di vista pratico, quando si imposta il protocollo di dPCR ci sono più passaggi critici che devono essere evidenziate. Prima di tutto, la miscela di reazione contenente la quantità appropriata di cDNA sulla base del livello di espressione di destinazione previsto, devono essere trasferiti con grande cura della lama di caricamento per non creare bolle d'aria, che potrebbe interferire con l'omogeneità del campione. Inoltre, la lama stessa in primo luogo deve essere posizionata in modo appropriato; in caso contrario potrebbe portare a una distribuzione irregolare del campione. Inoltre, dovrebbe essere effettuata sempre sufficiente rivestimento con immersione fluido e preciso di tenuta del coperchio. Per quanto riguarda l'analisi ed elaborazione chip, è importante essere consapevoli della possibilità di accumulo condensa sul chip; in tale scenario, il chip dovrebbe essere ri-cancellato con isopropanolo e ri-analizzato. Inoltre, come dPCR è basata sulle statistiche di Poisson, un numero minimo di dati valutabili punti (> 10.000) deve essere presente sul chip, altrimenti l'esempio dovrebbe essere eseguito nuovamente. Infine, per esperimenti a bersaglio basso copia rilevamento, un fattore critico di confusione potrebbe essere il rapporto segnale-rumore, ma un posizionamento affidabile soglia può aiutare nell'identificazione di segnali reali positivi.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori non segnalano conflitti di interesse per questo lavoro.

Acknowledgments

Gli autori desiderano ringraziare Gráinne Tierney per assistenza editoriale.

Materials

Name Company Catalog Number Comments
TRIazol Reagent Thermo Fisher Scientific 15596018
Glycogen 20 mg/ml ROCHE 10901393001
RNeasy MinElute Cleanup kit QIAGEN 74204
iScript cDNA Synthesis kit BioRad 1708891
QuantStudio 3D Digital PCR Master Mix v2 Thermo Fisher Scientific A26358
CDH1a IDT custom designed assay Integrated DNA Technologies (IDT) NA F) GCTGCAGTTTCACTTTTAGTG
(R) ACTTTGAATCGGGTGTCGAG
(P)/FAM/CGGTCGACAAAGGACAGCCTATT/TAMRA/
[dPCR optimized assay concentrations: 900 nM (F),        900 nM (R), 250 nM (P)]
QuantStudio 3D Digital PCR 20K Chip Kit v2 Thermo Fisher Scientific A26316
Heraeus Biofuge Fresco Thermo  Scientific 75002402
Thermocycler (Labcycler) Sensoquest 011-103
GeneAmp PCR System 9700 Thermo Fisher Scientific N805-0200
Dual Flat Block Sample Module Thermo Fisher Scientific 4425757
QuantStudio 3D Tilt Base for Dual Flat Block GeneAmp PCR System 9700 Thermo Fisher Scientific 4486414
QuantStudio 3D Digital PCR Chip Adapter Kit for Flat Block Thermal Cycler Thermo Fisher Scientific 4485513
QuantStudio 3D Digital PCR Chip Loader Thermo Fisher Scientific 4482592
QuantStudio 3D Digital PCR Instrument with power cord Thermo Fisher Scientific 4489084

DOWNLOAD MATERIALS LIST

References

  1. van Roy, F., Berx, G. The cell-cell adhesion molecule E-cadherin. Cell Mol Life Sci. 65, (23), 3756-3788 (2008).
  2. Carneiro, P., et al. E-cadherin dysfunction in gastric cancer: cellular consequences, clinical applications and open questions. FEBS Lett. 586, (18), 2981-2989 (2012).
  3. Corso, G., et al. Somatic mutations and deletions of the E-cadherin gene predict poor survival of patients with gastric cancer. J Clin Oncol. 31, (7), 868-875 (2013).
  4. Pinheiro, H., et al. Transcription initiation arising from E-cadherin/CDH1 intron2: a novel protein isoform that increases gastric cancer cell invasion and angiogenesis. Hum Mol Genet. 21, (19), 4253-4269 (2012).
  5. Abou Khouzam, R., et al. Digital PCR identifies changes in CDH1 (E-cadherin) transcription pattern in intestinal-type gastric cancer. Oncotarget. 8, (12), 18811-18820 (2017).
  6. Taylor, S. C., Laperriere, G., Germain, H. Droplet Digital PCR versus qPCR for gene expression analysis with low abundant targets: from variable nonsense to publication quality data. Sci Rep. 7, (1), (2017).
  7. Basu, A. S. Digital Assays Part I: Partitioning statistics and digital PCR. SLAS Technol. 22, (4), 369-386 (2017).
  8. Huggett, J. F., Whale, A. Digital PCR as a novel technology and its potential implications for molecular diagnostics. Clin Chem. 59, (12), 1691-1693 (2013).
  9. Alikian, M., et al. RT-qPCR and RT-Digital PCR: A comparison of different platforms for the evaluation of residual disease in chronic myeloid leukemia. Clin Chem. 63, (2), 525-531 (2017).
  10. Hoshino, T., Inagaki, F. Molecular quantification of environmental DNA using microfluidics and digital PCR. Syst Appl Microbiol. 35, (6), 390-395 (2012).
  11. Salvi, S., et al. Circulating AR copy number and outcome to enzalutamide in docetaxel-treated metastatic castration-resistant prostate cancer. Oncotarget. 7, (25), 37839-37845 (2016).
  12. Tessitore, M. V., et al. Detection of newly produced T and B lymphocytes by digital PCR in blood stored dry on nylon flocked swabs. J.Transl.Med. 15, (1), (2017).
  13. Sho, S., et al. Digital PCR Improves mutation analysis in pancreas fine needle aspiration biopsy specimens. PLoS One. 12, (1), e0170897 (2017).
  14. Conte, D., et al. Novel method to detect microRNAs using chip-based QuantStudio 3D digital PCR. BMC Genomics. 16, 849 (2015).
  15. Sanders, R., Mason, D. J., Foy, C. A., Huggett, J. F. Evaluation of digital PCR for absolute RNA quantification. PLoS One. 8, (9), e75296 (2013).
Rilevamento di una variante rara trascrizione <em>CDH1</em> in tessuti di cancro gastrico fresco congelato mediante PCR digitale basata su Chip
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Molinari, C., Abou Khouzam, R., Salvi, S., Rossi, T., Ranzani, G. N., Calistri, D. Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR. J. Vis. Exp. (132), e57066, doi:10.3791/57066 (2018).More

Molinari, C., Abou Khouzam, R., Salvi, S., Rossi, T., Ranzani, G. N., Calistri, D. Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR. J. Vis. Exp. (132), e57066, doi:10.3791/57066 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter