Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

फ़िरोज़ा Killifish की प्रयोगशाला आवास के लिए एक प्रोटोकॉल (Nothobranchius furzeri)

doi: 10.3791/57073 Published: April 11, 2018

Summary

फ़िरोज़ा killifish के प्रयोगशाला आवास घर के लिए बढ़ाया जा सकता है और कुशलता से एक केंद्रीकृत पानी छानने का काम प्रणाली में व्यक्तिगत मछली के हजारों बढ़ा, एक ही मानक zebrafish सुविधाओं के लिए इस्तेमाल किया बुनियादी सुविधाओं को रोजगार । यहां हम विस्तार मानकीकृत प्रक्रियाओं की एक सूची है कि कुशल killifish रखरखाव की अनुमति ।

Abstract

प्रायोगिक प्रयोजनों के लिए प्रयुक्त गैर-मॉडल प्रयोगशाला मछली में पशुपालन पद्धतियों के विकास से zebrafish और medaka जैसे संदर्भ मछली मॉडल प्रणालियों की स्थापना से काफी लाभ हुआ है. हाल के वर्षों में, एक उभरती हुई मछली-फ़िरोज़ा killifish (Nothobranchius furzeri) – उम्र बढ़ने और पारिस्थितिकी के जीवविज्ञान के क्षेत्रों में अनुसंधान समूहों की बढ़ती संख्या के द्वारा अपनाया गया है. 4-8 महीने के एक बंदी जीवन अवधि के साथ, इस प्रजाति के सबसे कम रहते हड्डीवाला कैद में उठाया और वैज्ञानिक समुदाय परीक्षण के लिए अनुमति देता है-एक कम समय में-प्रयोगात्मक हस्तक्षेप है कि उंर बढ़ने की दर और जीवन प्रत्याशा के परिवर्तन के लिए नेतृत्व कर सकते हैं । इस प्रजाति के अद्वितीय जीवविज्ञान को देखते हुए, भ्रूण diapause, विस्फोटक यौन परिपक्वता, चिह्नित रूपात्मक और व्यवहार यौन dimorphism की विशेषता-और उनके अपेक्षाकृत कम वयस्क जीवन काल- तदर्थ पशुपालन प्रथाओं अत्यावश्यक में हैं मांग. इस प्रोटोकॉल कुंजी पशुपालन उपाय है कि इष्टतम फ़िरोज़ा killifish प्रयोगशाला देखभाल, वैज्ञानिक समुदाय के लिए एक शक्तिशाली प्रयोगशाला पशु मॉडल के रूप में इस प्रजाति को अपनाने को सक्षम करने की अनुमति का एक सेट की रिपोर्ट ।

Introduction

अपने छोटे जीवन काल और तेजी से जीवन चक्र को देखते हुए, फ़िरोज़ा killifish तेजी से जीव विज्ञान1,2,3में एक होनहार नए मॉडल जीव के रूप में बढ़ रहे हैं । इस प्रजाति के एक teleost के लिए एक अनूठा जीवन चक्र की विशेषता है, भ्रूण diapause से मिलकर, तेजी से यौन परिपक्वता, और एक विस्तारित पोस्ट-प्रजनन जीवन स्टेज4,5. हाल ही में काम दोनों कैद में और जंगली6,7में इस प्रजाति के जीव विज्ञान elucidating में योगदान दिया है । फ़िरोज़ा killifish मौसमी ताजा पानी निकायों में रहते हैं जो जिंबाब्वे और मोजाम्बिक में अफ्रीकी सवाना में बरसात के मौसम के दौरान बनाते हैं । शुष्क मौसम के दौरान, भ्रूण एक तनाव प्रतिरोधी जीवन diapause बुलाया मंच के आधार पर पानी के अभाव में सूखी कीचड़ में जीवित रहते हैं ।

इस प्रजाति के लिए आनुवंशिक नक्शे8,9उत्पंन किया गया है, और हाल ही में उनके जीनोम का अनुक्रम किया गया है और10,11इकट्ठे हुए । कई नस्लीय प्रयोगशाला मछली उपभेदों विकसित किया गया है, और transgenesis और CRISPR/Cas9 के माध्यम से जीनोम संपादन इस प्रजाति में उपलब्ध हो गए हैं, वास्तविक एक प्रतियोगी प्रयोगशाला हड्डीवाला मॉडल जीव के रूप में फ़िरोज़ा killifish को बढ़ावा देने 12,13,14.

हालांकि एक प्रयोगशाला प्रोटोकॉल पहले से ही इस प्रजाति के लिए प्रकाशित किया गया है15, वर्तमान प्रोटोकॉल में हम प्रयोगात्मक प्रयोगशाला दिशानिर्देश है कि विशेष रूप से अध्ययन है कि उंर बढ़ने और अस्तित्व की जांच के उद्देश्य से कर रहे है की एक व्यापक सूची विकसित करना । वर्तमान प्रोटोकॉल zebrafish और medaka पशुपालन के साथ पहले से ही परिचित शोधकर्ताओं ने कुंजी समायोजन की एक न्यूनतम संख्या को अपनाने से फ़िरोज़ा killifish पशुपालन में निपुण बनने के लिए सक्षम बनाता है. एक ही समय में, इस प्रोटोकॉल आवश्यक उपकरणों के साथ मछली पालन में पूर्व अनुभव के बिना शोधकर्ताओं के लिए एक संपंन फ़िरोज़ा killifish कॉलोनी बढ़ाने प्रदान करता है ।

Protocol

मछली 28 डिग्री सेल्सियस में एक पानी परिसंचरण प्रणाली में उठाया (पानी के मापदंडों देखें), 10-20% दैनिक पानी के निपटान के साथ कर रहे हैं । तीन अलग टैंक आकार की सिफारिश कर रहे हैं: ०.८ एल, २.८ एल, और ९.५ एल । प्रत्येक टैंक 2 मिलीलीटर की एक निरंतर जल प्रवाह प्राप्त/

1. रिएजेंट्स तैयारी (सामग्री में शामिल नहीं)

नोट: अफ्रीकी फ़िरोज़ा killifish (Nothobranchius furzeri) एक स्थापित प्रयोगशाला स्टॉक से प्रदान किया जा सकता है । वार्षिक killifish सुखाना-प्रतिरोधी भ्रूणों को डाक द्वारा भेज दिया जा सकता है. यह 8-30 डिग्री सेल्सियस तापमान रेंज के भीतर भ्रूण जहाज के लिए महत्वपूर्ण है ।

  1. प्रणाली के पानी में 1 ग्राम/L humic अम्ल को भंग करके humic अम्ल (सेने) समाधान तैयार करें । आटोक्लेव और 10 सप्ताह तक के लिए 4 डिग्री सेल्सियस पर स्टोर ।
  2. HUFA Artemia संवर्धन की तैयारी के लिए, नमकीन चिंराट समाधान के एक एकाग्रता ५०० µ एल/एल पर दैनिक नमकीन चिंराट मछली पालन के लिए HUFA संवर्धन जोड़ें ।
  3. पहले autoclaved प्रणाली पानी में methylene नीले स्टॉक समाधान के १०० µ एल/एल भंग करके methylene ब्लू समाधान तैयार करें । चूंकि methylene नीले प्रकाश के प्रति संवेदनशील है, अंधेरे बोतलों में समाधान रखने के लिए, या पंनी के साथ कवर । RT पर स्टोर.
  4. भ्रूण मशीन के लिए एक ठोस सब्सट्रेट के रूप में नारियल फाइबर तैयार करें । वैकल्पिक रूप से, किसी फ़िल्टर काग़ज़ का उपयोग करें (अनुभाग १.५ देखें) ।
    1. आसुत पानी के साथ नारियल फाइबर भिगोना । आटोक्लेव और 5 सप्ताह के लिए 4 डिग्री सेल्सियस पर स्टोर ।
    2. भ्रूण हस्तांतरण के दिन, नम नारियल फाइबर के साथ पेट्री पकवान तैयार करते हैं ।
    3. एक धुएं-डाकू के तहत नारियल फाइबर के साथ एक ९० मिमी व्यास पेट्री पकवान भरें और एक लौ के बगल में, खमीर और बैक्टीरिया से संक्रमण को कम करने के लिए ।
    4. कॉंपैक्ट नारियल फाइबर 1 सेमी की ऊंचाई के लिए, बाँझ ऊतक के साथ । प्लेट के ऊपर एक कागज तौलिया दबाकर नारियल फाइबर से नमी के अधिकांश निकालें, कागज अतिरिक्त पानी को अवशोषित करने के लिए दे । लौ पर एक धातु चंमच गर्मी, और नारियल फाइबर की पूरी सतह पर नीचे दबाएँ । यह नारियल फाइबर कवक जीवाणु संक्रमण को रोकता है ।
  5. भ्रूण मशीन के लिए एक ठोस सब्सट्रेट के रूप में फिल्टर पेपर तैयार करें ।
    1. भ्रूण स्थानांतरण के दिन, प्लेस फ़िल्टर पेपर डिस्क के 3 परतों है कि ९०-mm पेट्री डिश फिट । नमी रखने के लिए humic एसिड सॉल्यूशन के 5 मिलीलीटर डालें ।

2. प्रजनन

  1. प्रजनन फ़िरोज़ा killifish तनाव रखरखाव के लिए
    नोट: इस प्रोटोकॉल के बाद, यौन परिपक्वता पर पहुंच गया है ~ 4 सप्ताह के बाद सेने और 7-9 सप्ताह के बीच fecundity चोटियों । यह नोट करने के लिए महत्वपूर्ण है कि fecundity खिला आवृत्ति और भोजन की गुणवत्ता पर निर्भर करता है; इसलिए, प्रजनन टैंक प्रति एक दिन में कम दो भक्षण भ्रूण उपज बढ़ाने के लिए सिफारिश कर रहे है (५.६ अनुभाग देखें.)
    1. सेटअप एक ९.५ एल प्रजनन टैंक । प्रणाली पानी के साथ भरें और एक पुरुष और दो मादा मछली जोड़ें ।
    2. संभोग के दौरान पुरुष अफ्रीकी फ़िरोज़ा killifish प्रदर्शन प्रभुत्व के रूप में, जो महिलाओं के उत्पीड़न के लिए नेतृत्व कर सकते हैं, संभोग तनाव को कम करने और प्रजनन उत्पादन में वृद्धि करने के लिए महिला से थोड़ा छोटे शरीर के आकार के साथ एक पुरुष का चयन करें । 6/7-सप्ताहीय महिलाओं के साथ 5-सप्ताहीय नर सेट करें ।
    3. autoclaved रेत के साथ एक प्लास्टिक कंटेनर (10 x 10 x 5 सेमी) भरें ~ 2-3 सेमी की एक अंतिम गहराई तक पहुंचने और प्रजनन टैंक के केंद्र में रेत बॉक्स जगह है ।
    4. फ़िरोज़ा killifish नस्ल लगातार और भ्रूण फसल के लिए एक सप्ताह में एक बार भ्रूण की कटाई करते हैं ।
      नोट: रेत सब्सट्रेट का उपयोग केंद्रीकृत निस्पंदन सिस्टम के लिए चुनौतियां बन गया है और भविष्य में वैकल्पिक तरीकों से प्रतिस्थापित किया जाना चाहिए । संभव विकल्प zebrafish प्रजनन टैंक का उपयोग हो सकता है ।
  2. transgenesis के लिए प्रजनन
    नोट: इंजेक्शन के लिए उपयोग करने के लिए भ्रूण एक सेल चरण में सिंक्रनाइज़ करने की आवश्यकता है, और यह है कि वे तुरंत निषेचन के बाद एकत्र कर रहे है की आवश्यकता है ।
    1. फसल के लिए एक सेल स्टेज भ्रूण इंजेक्शन और ट्रांसजेनिक लाइनों की पीढ़ी के लिए उपयोग करने के लिए, एक पुरुष और दो मादा मछली के साथ एक प्रजनन टैंक की स्थापना (२.१ के रूप में ही.) ।
    2. दो दिन पहले भ्रूण संग्रह करने के लिए, एक व्यक्ति के टैंक में पुरुष को अलग और वयस्क महिलाओं के साथ दृश्य संपर्क में पुरुष रहते हैं ।
    3. संग्रह के दिन, प्रजनन टैंक के लिए पुरुष और एक रेत बॉक्स जोड़ें और उन्हें 2 एच के लिए अंडे देते हैं ।

3. भ्रूण पालन

  1. भ्रूण संग्रह
    नोट: भ्रूण संग्रह रेत बॉक्स से sieving और कटाई भ्रूण द्वारा किया जाता है । सामांय परिस्थितियों में, प्रत्येक रेत बॉक्स 30 से २०० भ्रूण को शामिल करना चाहिए ।
    1. कलेक्शन के दिन ब्रीडिंग टैंक से रेत का डिब्बा हटा । एक छलनी (~ ०.९ mm तनाव आकार) में रेत बॉक्स खाली है और प्रणाली के पानी के साथ कुल्ला । इस autoclaving के लिए रेत इकट्ठा करने के लिए एक बड़े टैंक पर किया जा सकता है ।
    2. आंशिक रूप से प्रणाली पानी और भंवर में छलनी जलमग्न, भ्रूण दे समूह के लिए केंद्र में एक साथ ।
    3. एक 10 मिलीलीटर पाश्चर पिपेट के साथ भ्रूण ले लीजिए ।
    4. प्रणाली पानी की ~ ४० मिलीलीटर में एक ९० mm पेट्री डिश के लिए भ्रूण स्थानांतरण ।
    5. एक प्रकाश stereomicroscope के तहत पेट्री डिश में भ्रूण का निरीक्षण और टूटना घर का काम और नुकसान के संकेत पेश उन को हटा दें ।
    6. सीधे भ्रूण ब्लीचिंग को आगे बढ़ाएं ।
      नोट: हमेशा मछली तनाव के प्रति एक छलनी का उपयोग करने के लिए संभावित पार तनाव भ्रूण संदूषणों को रोकने के ।
  2. भ्रूण ब्लीचिंग
    नोट: भ्रूण ब्लीचिंग मशीन मीडिया को दूषित करने से मछलियों के टैंकों में मौजूद सूक्ष्मजीवों को रोकता है ।
    1. ब्लीच करने से पहले, एक डिस्पोजेबल पाश्चर पिपेट एकत्र भ्रूण युक्त पेट्री पकवान से प्रणाली के पानी को दूर करने के लिए उपयोग करें ।
    2. अवांछित फफूंद और बैक्टीरियल विकास को रोकने के लिए, एकत्र भ्रूण के लिए ५० मिलीलीटर हौसले से तैयार एच22 (1% v/v autoclaved प्रणाली पानी में) जोड़ें ।
    3. एक कम गति में ९० mm पेट्री डिश में ५० मिलीलीटर समाधान में 5 मिनट के लिए भ्रूण शेक ।
    4. एच22 समाधान के साथ निकालें डिस्पोजेबल पाश्चर पिपेट और धो भ्रूण methylene ब्लू समाधान के ५० मिलीलीटर के साथ 5 मिनट के लिए तीन बार । methylene ब्लू समाधान निकालें ।
    5. autoclaved प्रणाली पानी में एच22 (1% वी/वी के ५० मिलीलीटर जोड़ें और 5 मिनट के लिए हिला ।
    6. एच22 समाधान निकालें और 5 मिनट के लिए ५० मिलीलीटर methylene ब्लू समाधान के साथ तीन बार धो लो ।
    7. 28 डिग्री सेल्सियस पर भ्रूण मशीन methylene ब्लू समाधान के ४० मिलीलीटर में ९० mm पेट्री डिश प्रति १०० भ्रूण की अधिकतम घनत्व पर तुल्यकालिक भ्रूण विकास, वृद्धि हुई है ।
      नोट: ब्लीचिंग सॉल्यूशन में भ्रूण की गर्मी का विस्तार न करें । इससे अंडे की चोरियों को नुकसान हो सकता है और भ्रूण मृत्युदर में वृद्धि हो सकती है । भ्रूण ब्लीचिंग अंडे की चोरियों में प्रमुख शारीरिक-रासायनिक परिवर्तन है कि बदल चोरियों शरीर विज्ञान और सेने सफलता में परिणाम सकता है पैदा कर सकता है ।
  3. methylene ब्लू में भ्रूण की मशीन
    नोट: methylene ब्लू समाधान में तरल गर्मी परजीवी विकास को रोकता है और मृत भ्रूण और निषेचित अंडे का पता लगाने में सक्षम बनाता है ।
    1. मशीन भ्रूण का निरीक्षण, किसी भी मृत भ्रूण को हटाने (नीले methylene द्वारा नीले दाग) पेट्री डिश से कवक और जीवाणु संक्रमण है कि जीवित स्वस्थ भ्रूण के अस्तित्व को प्रभावित रोकने के लिए ।
    2. पुराने methylene ब्लू समाधान निकालें और ताजा समाधान के साथ बदलें ।
    3. वापसी पेट्री डिश के लिए 28 डिग्री सेल्सियस मशीन (चित्र 1a) । 7-10 दिनों के भीतर, यह सुनिश्चित करें कि विकसित भ्रूण दिखाई काले आंखों दिखा । नारियल फाइबर या फिल्टर कागज ठोस सब्सट्रेट मध्यम (चित्र 1b) के लिए इन भ्रूण स्थानांतरण.
    4. methylene नीले, मॉनिटर दैनिक में अविकसित भ्रूण बनाए रखने, और ठोस सब्सट्रेट मध्यम करने के लिए स्थानांतरण एक बार काली आंखें विकसित की है ।
    5. दोहराएँ चरण 3.3.1-3.3.3 दैनिक जब तक भ्रूण काली आंखें दिखाई है ।
      नोट: methylene नीले भ्रूण के निरंतर जोखिम वयस्क मछली शरीर क्रिया विज्ञान में दीर्घकालिक परिवर्तन के लिए प्रेरित कर सकते हैं ।
  4. फिल्टर पेपर को भ्रूण हस्तांतरण
    नोट: फ़िरोज़ा killifish भ्रूण एक सूखी सब्सट्रेट, recapitulating प्राकृतिक स्थितियों पर विकसित कर सकते हैं । इसके अतिरिक्त, शुष्क भ्रूण गर्मी शोधकर्ताओं को सक्षम बनाता है भ्रूण सिंक्रनाइज़ और उंहें एक ही दिन में हैच ।
    1. के रूप में विकसित भ्रूण दिखाई देगा काली आंखें 7-10 दिनों के भीतर, एक डिस्पोजेबल पाश्चर पिपेट या ठीक एक पहले से तैयार फिल्टर कागज प्लेट पर methylene नीले समाधान से भ्रूण हस्तांतरण करने के लिए घुमावदार चिमटी का उपयोग करें ।
    2. फैल भ्रूण ~ 5 संदंश के साथ मिमी, ९० mm प्लेट प्रति १०० भ्रूण के लिए (चित्र 1b) ।
    3. parafilm के साथ पेट्री डिश को सील कर दीजिये ।
    4. 2-3 सप्ताह के लिए 28 ° c में भ्रूण की मशीन, जब तक वे पूरी तरह से स्वर्ण आईरिस विकसित किया है और(चित्रा 1C) सेने के लिए तैयार हैं ।
      नोट: अब तक 2 सप्ताह के लिए तैयार करने के लिए हैच भ्रूण की मशीन लंबा नहीं के रूप में उनकी व्यवहार्यता नाटकीय रूप से कम हो जाएगा ।
  5. नारियल फाइबर को भ्रूण हस्तांतरण
    नोट: Autoclaved, बाँझ नारियल फाइबर (या कार्बनिक पीट काई) ठोस सब्सट्रेट मशीन के लिए एक वैध वैकल्पिक माध्यम के रूप में इस्तेमाल किया जा सकता है ।
    1. एक तैयार करने के लिए उपयोग नारियल फाइबर प्लेट पर methylene नीले समाधान से भ्रूण हस्तांतरण करने के लिए एक डिस्पोजेबल पाश्चर पिपेट या बारीक घुमावदार चिमटी का प्रयोग करें ।
    2. फैल भ्रूण ~ 5 मिमी के अलावा, अप करने के लिए १०० भ्रूण प्रति ९० mm प्लेट (चित्र 1b) ।
    3. parafilm के साथ पेट्री डिश को सील कर दीजिये ।
    4. 2-3 सप्ताह के लिए 28 ° c में भ्रूण की मशीन, जब तक वे पूरी तरह से विकसित किया है गोल्डन आईरिस ( जैसेचित्रा 1C में) ।
      नोट: लंबी अवधि के भंडारण के लिए (एक वर्ष के लिए), methylene नीले समाधान से 17 डिग्री सेल्सियस पर एक ठोस सब्सट्रेट प्लेट के लिए 3 दिनों के बाद संग्रह में भ्रूण हस्तांतरण. जब तक वे काली आंखें विकसित भ्रूण गर्मी ।

4. सेने फ़िरोज़ा Killifish

नोट: फ़िरोज़ा killifish भ्रूण सफलतापूर्वक एक humic एसिड समाधान14में रचा जा सकता है ।

  1. ठीक घुमावदार चिमटी का उपयोग करना, ध्यान से स्थानांतरण ५०-१०० 4 डिग्री सेल्सियस पर humic एसिड समाधान से भरा सेने बॉक्स में भ्रूण विकसित. humic एसिड समाधान प्रणाली पानी में 1 जी/एल humic एसिड के होते हैं । आटोक्लेव और 10 सप्ताह तक के लिए 4 डिग्री सेल्सियस पर स्टोर । सुनिश्चित करें कि सभी भ्रूण पूरी तरह से डूबे हुए हैं । humic एसिड समाधान उथले होना चाहिए, 2 सेमी से गहरा नहीं ।
    नोट: humic एसिड समाधान के कम तापमान सेने और समाधान में भ्रूण की पूरी विसर्जन को बेहतर बनाता है सेने सिंक्रनाइज़ अनुमति देता है ।
  2. 28 ° c सेने मशीन में सेने बॉक्स प्लेस । ढक्कन के साथ सेने बॉक्स कवर । पर्याप्त वातन की आपूर्ति करने के लिए, हवा की आपूर्ति के साथ टयूबिंग द्वारा सेने बॉक्स कनेक्ट ।
    नोट: पर्याप्त नहीं वातन के उच्च दरों में गर्मी के परिणाम के दौरान गैस मूत्राशय को भरने में सक्षम नहीं है ("पेट-स्लाइडर" phenotype, अनुभाग ५.१ में नोट देखें)
  3. दिन से सेने के बाद, अंडे सेने बॉक्स में पर्याप्त पानी की गुणवत्ता को बनाए रखने के लिए, 1:1 के अनुपात में एक दिन में एक बार autoclaved प्रणाली पानी जोड़ने, 2 सेमी की एक अंतिम गहराई रखते हुए ।
  4. ठोस सब्सट्रेट करने के लिए वापस रची भ्रूण स्थानांतरण, और एक सप्ताह के बाद सेने का प्रयास ।
    नोट: सेने पर, फ़िरोज़ा killifish आसानी से लेने के लिए सक्षम होते हैं और लाइव भोजन का उपभोग करते हैं । इष्टतम विकास के लिए, फ़ीड प्रति दिन दो बार अतिरिक्त हौसले से रची नमकीन पानी चिंराट (Artemia सलीना) के साथ भून । पूर्ण तुष्टि का चिह्न प्रत्येक खिलाने के 10-15 मिन के बाद नारंगी रंग के पेट को भूनकर दिया जाता है. अतिरिक्त, खाया और विघटित नमकीन पानी एक दैनिक आधार पर एक पाश्चर पिपेट का उपयोग चिंराट बाहर खाना ।

5. किशोर और वयस्क मछली स्थापना

  1. पांच दिनों के बाद सेने, किशोरों पानी पुनः संचलन प्रणाली के लिए ले जाएं । डिस्पोजेबल प्लास्टिक पिपेट (या एक प्लास्टिक चंमच) का उपयोग करना, ध्यान से ४०० µm तलना स्क्रीन (चित्रा 2) के साथ सुसज्जित ०.८ एल टैंक प्रति पांच किशोर हस्तांतरण ।
    नोट: यह संभव है कि किशोर killifish के एक हिस्से को गैस मूत्राशय भर नहीं होगा, एक ठेठ "पेट में जिसके परिणामस्वरूप स्लाइडर" phenotype, मछली उचित उछाल तक पहुंचने नहीं की विशेषता, उंहें लगातार तैरने के लिए मजबूर, गंभीर विकृतियों के कारण वयस्क मछली । इन मछली अस्तित्व परख के लिए या कुशल प्रजनन के लिए इस्तेमाल नहीं किया जा सकता है और सेंसर किया जाना चाहिए ।
  2. 14 दिनों के बाद जब तक अतिरिक्त में हौसले से रचा नमकीन चिंराट के साथ प्रति दिन दो बार किशोर फ़ीड । प्रत्येक टैंक के नीचे से मलबे बाहर खाना दैनिक ।
  3. उंर के 14 दिनों में, एक ८५० µm तलना स्क्रीन के साथ सुसज्जित २.८ एल टैंक के लिए किशोर मछली हस्तांतरण । इस बिंदु के बाद से, मछली आईडी के साथ प्रत्येक टैंक लेबल, हैच तिथि, तनाव की जानकारी, मछली लिंग और मछली पहचान संख्या (चित्रा 3) का संकेत है. अस्तित्व परख के लिए, व्यक्तिगत रूप से एक टैंक में इस बिंदु के बाद से प्रत्येक मछली घर ।
  4. निंनलिखित 7 दिनों के लिए, प्रति दिन दो बार किशोर फ़ीड मछली प्रति नमकीन चिंराट के ~ 2 मिलीलीटर के साथ । इस स्तर पर मछली के साथ पूरक किया जा सकता है 1-3 लाइव रक्त कीड़े (मामले में रक्त कीड़ा लार्वा मछली के लिए बहुत बड़े हैं, उन्हें एक उस्तरा ब्लेड के साथ छोटे टुकड़ों में काटना). पानी की गुणवत्ता की गिरावट को रोकने के लिए, प्रति सप्ताह दो बार खाया भोजन और अतिरिक्त अपशिष्ट बाहर खाना बनाना ।
  5. सेने से 3 सप्ताह के बाद, टैंक के पीछे से भून स्क्रीन को हटाने और प्रत्येक मछली दिन में दो बार खिलाने के लिए शुरू ~ नमकीन चिंराट के 2mL और रक्त कृमि के ०.५ मिलीलीटर । इस स्तर पर, किशोर शरीर के आकार में 1 सेमी तक पहुंच जाना चाहिए और पूर्ण आकार रक्त कीड़ा घूस में सक्षम होना चाहिए ।
  6. उंर के 4 सप्ताह में, प्रत्येक मछली के साथ दो बार प्रति दिन फ़ीड ~ नमकीन चिंराट और रक्त कृमि के 1 मिलीलीटर के 2mL । महिलाओं को सह किया जा सकता है अप करने के लिए एक घनत्व पर घर २.८ एल टैंक प्रति 3 महिलाओं ।
  7. इस स्तर पर सुनिश्चित करें कि मछली पूरा यौन परिपक्वता तक पहुंचने । पुरुषों और दौर महिलाओं में अंडे से भरा पेट में रंगाई के लक्षण के साथ बड़े पृष्ठीय, गुदा और caudal पंख की उपस्थिति के लिए जांच करें ।
    नोट: अस्तित्व पलटने के लिए व्यक्तिगत टैंक में वयस्क मछली स्थापना अध्ययन नकारात्मक मछली व्यवहार और स्वास्थ्य को प्रभावित कर सकते हैं । हालांकि, जीवन रक्षा पलटन अध्ययन के लिए समूह आवास सामाजिक प्रभुत्व और पुरुष शासित प्रदेशों की स्थापना के कारण महत्वपूर्ण निराधार कारक कहते हैं, जो कि सख्त सामाजिक पदानुक्रमों में अग्रणी है ।

6. फीडिंग

नोट: प्रयोगशाला फ़िरोज़ा killifish बेबी नमकीन चिंराट (Artemia सलीना nauplii) और रक्त कृमि (Chironomus एसपीपी. लार्वा) का एक संयोजन खिलाया जा सकता है । फ़िरोज़ा killifish फ्राई विशेष रूप से बेबी नमकीन चिंराट खिलाया जाता है । किशोर और वयस्क मछली दो बार एक दिन दोनों नमकीन चिंराट और रक्त कृमि (चित्रा 2) खिलाया जाता है । आदर्श रूप में, मछली एक दिन में कई बार खिलाया जा सकता है, 2 इस प्रोटोकॉल में संकेत भक्षण से अधिक है ।

  1. संवर्धन नमकीन चिंराट
    1. रिवर्स असमस के 10 एल जोड़ें (आरओ) पानी और लाल सागर नमक के ३५० ग्राम एक नमकीन चिंराट मछली पालने के लिए और एक वातन ट्यूब के साथ वातन द्वारा भंग ।
    2. उच्च unसंतृप्त फैटी एसिड (HUFA) के 5 मिलीलीटर के साथ संस्कृति को समृद्ध ।
    3. सेने समाधान में नमकीन चिंराट अल्सर के 20 ग्राम जोड़ें । जांच करें कि नमकीन चिंराट अल्सर पानी की सतह पर नाव नहीं है और उचित ऑक्सीजन और संस्कृति के संचलन सुनिश्चित करते हैं ।
      नोट: सूखी नमकीन चिंराट अल्सर के दैनिक aliquots 4 डिग्री सेल्सियस पर संग्रहित किया जा सकता है ।
    4. अगले दिन की दोपहर को, HUFA की 5 मिलीलीटर की एक और aliquot के साथ संस्कृति की आपूर्ति ।
  2. फसल रची नमकीन चिंराट
    नोट: के बाद शुरू संस्कृति से ~ ३६ ज, नमकीन चिंराट कटाई (instar द्वितीय चरण) के लिए तैयार हैं ।
    1. एक कंटेनर में संस्कृति के 5 एल इकट्ठा करने के लिए मछली पालने के नीचे पर नल का उपयोग और चलो 10 मिनट के लिए बैठते हैं ।
    2. 10 मिनट के बाद, 5 एल कंटेनर के ऊपर से नमकीन चिंराट के गोले (भूरे रंग) को हटाने और एक जाल के माध्यम से रची नमकीन चिंराट (नारंगी रंग) फिल्टर । ध्यान देना कंटेनर के तल पर पाया तलछट को बाहर करने के रूप में यह गैर रची अंडे और मृत नमकीन चिंराट शामिल हैं ।
    3. कुल्ला एक 2 एल कंटेनर में आरओ पानी के साथ नमकीन चिंराट रची और चलो 10 मिनट के लिए बैठते हैं ।
    4. 10 मिनट के बाद, फिल्टर नमकीन पानी फिर से एक जाल के माध्यम से चिंराट और आरओ जल के 2 एल में इकट्ठा ।
    5. पिछले तीन चरणों को दोहराएं जब तक नमकीन चिंराट समाधान गैर रची अल्सर और नमकीन चिंराट के गोले से मुक्त है ।
    6. स्थानांतरण 2 एल कंटेनर से नमकीन चिंराट खिलाने के लिए निचोड़ की बोतलों में ।
      नोट: संवर्धन नमकीन चिंराट काफी मजबूत और विश्वसनीय है । हालांकि, असफल सेने के मामले में नमकीन चिंराट की कमी से बचने के लिए, छोटे (५०० मिलीलीटर) बैकअप सेने वालों इस्तेमाल किया जा सकता है ।
  3. बैकअप के लिए सेट करना
    1. वातन द्वारा RO पानी की ५०० मिलीलीटर में लाल सागर नमक के १७.५ जी भंग ।
    2. HUFA के ५०० µ एल के साथ संस्कृति को समृद्ध ।
    3. नमकीन चिंराट अल्सर के 2 जी जोड़ें ।
    4. 18-24 ज के बाद, HUFA के ५०० µ एल के साथ एक बार और संस्कृति की आपूर्ति ।
      नोट: नमकीन चिंराट के बाद फसल के लिए तैयार कर रहे है ~ 24 एच ।
  4. लाइव रक्त कृमि की तैयारी
    1. तुरंत भोजन से पहले, एक आरओ पानी का उपयोग कर छलनी के माध्यम से रक्त कृमि के एक उचित मात्रा फिल्टर ।
      नोट: लाइव रक्त कीड़ा 7-10 दिनों के लिए 4 डिग्री सेल्सियस पर संग्रहीत किया जा सकता है ।
    2. एक प्लास्टिक कंटेनर में आरओ पानी की एक छोटी राशि के साथ कुल्ला रक्त कीड़ा ।
    3. एक प्लास्टिक पाश्चर पिपेट (संकीर्ण टिप हटा) के साथ, खिलाने के लिए रक्त कृमि मिश्रण ले ।
      नोट: संयुक्त राष्ट्र नियंत्रित स्रोतों से जीवित भोजन के साथ प्रयोगशाला killifish कालोनियों परजीवी और संभवतः रोगजनक माइक्रोबियल समुदायों से बाहरी प्रदूषण के लिए एक जोखिम कहते हैं । भविष्य में, एक तदर्थ बाँझ मछली फ़ीड विकसित किया जाना चाहिए ।

7. Killifish प्रयोगशाला तनाव Genotyping

नोट: फ़िरोज़ा killifish उपभेदों के बीच भेद करने के लिए, के रूप में अच्छी तरह से प्रत्येक तनाव के भीतर सेक्स का निर्धारण, विशिष्ट आनुवंशिक (माइक्रोसेटेलाइट) मार्करों9 (तालिका 1) इस्तेमाल किया जा सकता है ।

  1. नमूना
    1. गीला स्पंज के शीर्ष पर एक जाल में सुरक्षित रूप से मछली पकड़ो ।
    2. operculum से caudal पंख कपास झाड़ू का उपयोग करने के लिए मछली शरीर से झाड़ू 2-3 तराजू ।
    3. झाड़ू से उठाओ तराजू और एक 1 मिलीलीटर ट्यूब में स्थानांतरण 2-3 तराजू NaOH समाधान युक्त (२०० µ एल ०.५ मॉल/l NaOH, 1% β-Mercaptoethanol, and ०.५% polyvinyl pyrrolidone).
    4. 15 एस के लिए पीसीआर ट्यूबों स्पिन सुनिश्चित करें कि तराजू पूरी तरह से NaOH समाधान में डूबे हुए हैं बनाने के लिए ।
  2. जीनोमिक डीएनए अलगाव
    1. ९५ डिग्री सेल्सियस पर 20 मिनट के लिए नमूना मशीन ।
    2. आरटी में कूल, 1 एम Tris-एचसीएल, पीएच ८.० के 1/10 की मात्रा के साथ नमूना बेअसर ।
    3. पूरी गति से 5 मिनट के लिए नमूना केंद्रापसारक ।

8. पानी के मापदंडों

नोट: जीवों के पशुपालन जिसका इरादा उपयोग वयस्क है phenotyping लक्ष्य प्रजातियों के जीवन काल में अत्यधिक स्थिर पशुपालन शर्तों की आवश्यकता है । इसलिए, संवर्धन जल जीवों, जैसे फ़िरोज़ा killifish, आवश्यक पानी के मापदंडों पर सख्त नियंत्रण । जल परिसंचरण, अतिरिक्त चार कदम पानी छानने का यंत्र के साथ, पानी के मापदंडों पर नियंत्रण प्राप्त करने के लिए एक मजबूत आधार सुनिश्चित करता है, समय के साथ ही पानी की स्थिति के साथ सभी टैंक प्रदान करते हैं । यह प्रणाली पानी रिवर्स से पुनर्गठन की सिफारिश की है-असमस (आरओ) पानी, वाणिज्यिक समुद्री नमक और सोडियम बिकारबोनिट के साथ जोड़ा ।

  1. जल परिसंचरण प्रणाली योजना: पहले, अपशिष्ट पानी मछली टैंक से ठोस कणों धातु फिल्टर है कि सभी संयुक्त राष्ट्र के खाया खाद्य मलबे और बड़े कणों कब्जा के माध्यम से बहती है । धातु फिल्टर एक सप्ताह में तीन बार कुल्ला कर रहे हैं; दूसरा, पहले यांत्रिक निस्पंदन के बाद, पानी बड़े नाबदान में दिया और फिर एक फिल्टर है, जहां बैक्टीरिया nitrites और नाइट्रेट्स अमोनिया को बदलने के लिए पंप; तीसरा, फिल्टर से, पानी 25-µm फिल्टर आस्तीन, जो जाल महीन आकार के कणों को पंप है । अंत में, पानी पराबैंगनी (यूवी) लैंप के माध्यम से बहती है कि बैक्टीरिया और वायरस से पानी निष्फल । इन चार चरणों के बाद, फ़िल्टर्ड पानी मछली टैंक को देता है ।
  2. टैंकों में सूक्ष्मजीव विकास को कम करने के लिए, नाइट्रेट के संचय को रोकने, और समग्र लवणता को कम करने, प्रणाली पानी का 10-20% एक दैनिक आधार पर निपटारा है ।
  3. बनाए रखने के पानी के तापमान में लगातार 28 ° c, जल पीएच स्थिरांक ७.० to ७.५ सीमा के भीतर ।
  4. हालांकि killifish लवणता की व्यापक रेंज बर्दाश्त, oodinosis से बचने के लिए, सीमा के भीतर चालकता बनाए रखने ६५०-७१० माइक्रो-सीमेंस । एक साल के लंबे 12 घंटे के प्रकाश/अंधेरे चक्र कॉलोनी स्वास्थ्य और उत्पादकता सुनिश्चित करता है ।
    नोट: Killifish पानी चालकता बर्दाश्त कर सकते है अप करने के लिए १५०० माइक्रो-सीमेंस ।

Representative Results

फ़िरोज़ा killifish औसत GRZ तनाव में 12-18 सप्ताह के बीच लेकर अस्तित्व में उचित पशुपालन परिणाम (चित्रा 4a) उदा. औसत अस्तित्व के रूपांतरों आहार पर निर्भर, आवृत्ति खिला, और आवास तापमान की स्थिति । अस्तित्व में गरीब पशुपालन परिणाम घटता जल्दी मृत्यु दर और दोहराए, समय के दौरान अस्तित्व के अचानक बूंदें पेश, कई मोड़ अंक (चित्रा 4B) की विशेषता ।

Figure 1
चित्रा 1: संबंधित मशीन सब्सट्रेट के साथ प्रतिनिधि भ्रूण विकास चरणों. (क) हौसले से एकत्र भ्रूण, methylene में नीले रंग समाधान में मशीन 28 डिग्री सेल्सियस पर । (ख) भ्रूण को ठोस माध्यम के लिए हस्तांतरित किया जा करने के लिए तैयार, या तो फिल्टर कागज या नारियल फाइबर. (ग) भ्रूण के लिए तैयार हो, ठेठ स्वर्ण आईरिस प्रदर्शित । स्केल बार 1 mm के बराबर है । इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें.

Figure 2
चित्रा 2: फ़िरोज़ा killifish के बाद के चरण-सेने के विकास । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 3
चित्र 3:3 के बाद मंच से मछली के लिए प्रतिनिधि मछली आईडी टैग । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 4
चित्रा 4:७० पुरुष फ़िरोज़ा killifish के लिए प्रतिनिधि जीवन रक्षा वक्र । (क) प्रयोगशाला के लिए ठेठ अस्तित्व वक्र-फ़िरोज़ा killifish उठाया । (ख) अस्तित्व घटता की तुलना इष्टतम पशुपालन शर्तों (काला) और गरीब पशुपालन (लाल और नीले रंग) के तहत उठाया मछली से प्राप्त की । डैश्ड लाल क्षैतिज रेखा ५०% अस्तित्व को इंगित करती है, माध्य जीवन अवधि में पारस्परिक जीवन रक्षा वक्र (x-अक्ष पर इंगित) । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Id फॉरवर्ड प्राइमर रिवर्स प्राइमर आकार सीमा (बीपी)
* NfuSU0007 GGCTAAGCCTTGCTGACAGA CAGGGAGCTGAAAACCTCAG १६६-२१४
* NfuSU0010 CGCAGTCTGATCAAATCGTGT TGTTTGAAGGTTCACATTCATTATC २२०-२७२
NfuSU0016 CATGGCTAAACCGTGATGAA GAAGGACGCCAGCTATGAAG २०९-२४०
NfuSU0022 AACACAGCTCTCGTAAGGAGGTA TTCAGACTTGTCTTACTACCATGTTT १९८-२३८
NfuSU0027 TCCAGCTGAATCGGTAATGA AAACTCGAGGGTGCAATCTG १६४-२२६
NfuSU0049 CTGGACAAAGTGCCAATCAC CTCCCACAGTCCCAAAACAT १९६-१९७
NfuSU0050 CCAGAATGAACAATACTCAGATCAA GCAGCTTAGTTTAATGATATCACAATG २५२-२९५
NfuSU0060 CTAGCCACTCCCCTGGTTTA CCGTCACGATGTGCTGATAC २१६-२४८
NfuFLI0030 CAGAAGCTAAAGGCCAGACG GGGAAACAATAGGGAACCAC १७४-२०५
* NfuFLI0091 ACGCTGACTCTACCCAGTC CTGCCTGCTACTGACAATG ३५५-३७३
*-सेक्स निर्धारण मार्करों

तालिका 1: तनाव पहचान के लिए Genotyping प्राइमर ।

Discussion

हम भ्रूण संग्रह, मशीन, साथ ही वयस्क मछली आवास, प्रजनन, और खिलाने सहित फ़िरोज़ा killifish के प्रयोगशाला संवर्धन के लिए एक प्रोटोकॉल का वर्णन । हमारे प्रोटोकॉल विशेष प्रयोगशालाओं कि आचरण वयस्क मछली पर ध्यान केंद्रित अनुसंधान उंर बढ़ने और जीवन काल पर प्रयोगात्मक अध्ययन के लिए विशेष रूप से लक्षित है । फ़िरोज़ा killifish एक मानक zebrafish सुविधा पर उठाया जा सकता है; हालांकि, killifish पशुपालन के महत्वपूर्ण पहलुओं मानक zebrafish देखभाल से16अलग । ये समायोजन एक नमकीन से जल्दी संक्रमण शामिल-एक आहार के लिए चिंराट केवल आहार प्रोटीन से भरपूर रक्त कृमि के साथ पूरक है, साथ ही भ्रूण की मशीन में विशिष्ट कदम, एक तरल और शुष्क गर्मी मंच से मिलकर ।

प्रोटोकॉल के भीतर महत्वपूर्ण कदम 8-30 डिग्री सेल्सियस तापमान रेंज के भीतर भ्रूण शिपिंग शामिल हैं । प्रजनन के मामले में, fecundity आवृत्ति और भोजन की गुणवत्ता खिलाने पर निर्भर करता है; इसलिए, हम सिफारिश प्रजनन टैंक प्रति एक दिन में कम से कम दो भक्षण भ्रूण उपज बढ़ाने के लिए (५.६ अनुभाग देखें.) । भ्रूण ब्लीचिंग के दौरान ब्लीचिंग सॉल्यूशन में भ्रूण की गर्मी का विस्तार न करें । इससे अंडे की चोरियों को नुकसान हो सकता है और भ्रूण मृत्युदर में वृद्धि हो सकती है । जब methylene नीले रंग के साथ भ्रूण मशीन, तैयार करने के लिए अब से 2 सप्ताह के लिए हैच भ्रूण के रूप में उनकी व्यवहार्यता नाटकीय रूप से कम हो जाएगा की मशीन लंबा नहीं है । फ़िरोज़ा killifish सेने के लिए, humic एसिड समाधान के कम तापमान सेने और समाधान में भ्रूण की पूरी विसर्जन को बेहतर बनाता है सेने सिंक्रनाइज़ अनुमति देता है । पर्याप्त नहीं वातन के उच्च दरों में गर्मी के परिणाम के दौरान गैस मूत्राशय ("पेट-स्लाइडर" phenotype भरने में सक्षम नहीं है, अनुभाग ५.१ में नोट देखें) ।

प्रजनन के लिए प्रोटोकॉल की सीमा रेत सब्सट्रेट जो केंद्रीकृत निस्पंदन सिस्टम के लिए चुनौतियां बन गया है और भविष्य में वैकल्पिक तरीकों से प्रतिस्थापित किया जाना चाहिए का उपयोग भी शामिल है । संभव विकल्प zebrafish प्रजनन टैंक का उपयोग हो सकता है । भ्रूण ब्लीचिंग अंडे की चोरियों में प्रमुख शारीरिक-रासायनिक परिवर्तन है कि बदल चोरियों शरीर विज्ञान और सेने सफलता में परिणाम सकता है पैदा कर सकता है । methylene नीले भ्रूण के निरंतर जोखिम वयस्क मछली शरीर क्रिया विज्ञान में दीर्घकालिक परिवर्तन के लिए प्रेरित कर सकते हैं । अस्तित्व पलटने के लिए व्यक्तिगत टैंक में वयस्क मछली स्थापना अध्ययन नकारात्मक मछली व्यवहार और स्वास्थ्य को प्रभावित कर सकते हैं । हालांकि, जीवन रक्षा पलटन अध्ययन के लिए समूह आवास सामाजिक प्रभुत्व और पुरुष शासित प्रदेशों की स्थापना के कारण महत्वपूर्ण निराधार कारक कहते हैं, जो कि सख्त सामाजिक पदानुक्रमों में अग्रणी है । इसलिए, हम ंयायाधीश कि अस्तित्व के अध्ययन के लिए पुरुष मछली का अलगाव एक उचित समझौता है । संयुक्त राष्ट्र द्वारा नियंत्रित स्रोतों से जीना भोजन के साथ प्रयोगशाला killifish कालोनियों खिला परजीवी और संभावित रोगजनक माइक्रोबियल समुदायों से बाहरी संदूषणों के लिए एक जोखिम जोड़ें । भविष्य में, एक तदर्थ बाँझ मछली फ़ीड विकसित किया जाना चाहिए ।

इस प्रोटोकॉल के लिए भविष्य में सुधार एक नियंत्रित, गैर रहने आहार है, जो अभी भी 3-4 सप्ताह के भीतर यौन परिपक्वता को पूरा करने की ओर जाता है पर ध्यान दिया जाएगा । संक्षेप में, हमारे प्रोटोकॉल फ़िरोज़ा killifish प्रयोगशाला संवर्धन करने के लिए एक व्यापक वैज्ञानिक समुदाय के लिए पहुंच प्रदान करता है ।

Disclosures

सभी लेखक कोई प्रतिस्पर्धी वित्तीय और गैर वित्तीय हितों की घोषणा ।

Acknowledgments

हम Alessandro Cellerino, Tyrone Genade, ऐनी Brunet, सबरीना शार्प, Mickie पॉवेल, सिमोन Keil, Yumi किम, पैट्रिक स्मिथ, काई मथार और Valenzano लैब के सभी सदस्यों को विभिंन पहलुओं में योगदान के लिए बुढ़ापे की जीव विज्ञान के लिए मैक्स प्लैंक संस्थान में धंयवाद वर्तमान killifish के वर्षों में पशुपालन प्रोटोकॉल ।

Materials

Name Company Catalog Number Comments
Probe calibration buffer solution pH=7.0 Roth A518.1 1L buffer solution pH=7.0 to calibrate water system pH-electrode
Probe calibration buffer solution pH=4.0 Roth P712.1 1L buffer solution pH=4.0 to calibrate water system pH-electrode
Conductivity standard VWR 83607.260 500 mL Conductivity standard 1,413 uS/cm to calibrate water system conductivity-electrode
Easy Strips Test 6in1 JBL 2533900 Test strips for determination chlorine values of system water
Ammonia Test JBL 2536500 Test to determine ammonia content of system water
Red Sea Salt Red Sea 22 kg bucket
Sodium hydrogen carbonate VWR 27780.360
Humic acid Sigma- Aldrich 53680-50G
New HUFA Artemia enrichment ZM Systems UK 75g bottle
Methylene blue Roth AE64.1
Hydrogen peroxide solution Sigma- Aldrich 31642-1L 30% (w/w)
Coconut fiber Dragon ZCS010
Whatman paper GE healthcare 3030-690
Ethanol pure VWR 20821.467 100%
Silica sand local pet shop
Artemia Eggs Premium Grade Sanders
Bloodworm local distributor Poseidon Aquakultur Germany
dNTPs solution mix Biolabs N04472 10mM
Taq DNA polymerase Invitrogen 18038-042 5U/uL
PCR 10x Buffer Invitrogen 18038-042
MgCl2 Invitrogen 18038-042 50mM
NaOH Sigma- Aldrich S8045-500g 50mM
Tris-HCl, pH=8.0 solution Sigma- Aldrich T2694-1L 1M
HCl 37% Sigma- Aldrich H1758-500mL
Fish tanks Aquaneering volume: 0.8L, 2.8L, 9.5L; equipped with baffles, fry mesh and lids
Orbital shaker VWR 89032-100 model 5000
Microbiological incubator Thermo Scientific, Heratherm 50125882 model IMC18; for storage embryos in the liquid phase, set to t=27-28°C
Cooling Incubator Binder 9020-0209 model KT115; for storage embryos in the solid phase, set to t=27-28°C
Hatching incubator Thermo Scientific, Heratherm 51028114 model OGS180; for embryos hatching, set to t=27-28°C
Stereomicroscope Leica model M80
Breeding sand/hatching boxes Roth 1598.1 1000mL
Petri dish Sarstedt 82.1473 92x16mm
50 mL Conical tube Sarstedt 62.547.254
15 mL Conical tube Sarstedt 62.554.002
Disposable Plastic Pasteur pipette Roth EA71.1 2mL; For fish feeding with bloodworms, or embryos selection cut off the tip to open 3-4mm diameter
Serological pipette Sarstedt 86.1689.001 50mL
Syringe Henke Sass Wolf 4100-000V0 10mL
Metal strainer fineness <1mm; for embryos collection
Tweezers Dumont 0508-5/45-PO type5/45; for embryos transfer
25 L Brine shrimp hatcher Aquaneering ZHBS25 main hatcher
500 mL Brine shrimp hatcher JBL 6106100 model Artemio 1; backup hatcher
Narrow-mesh fish nets JBL
Sand beaker VWR BURK7102-5000 5000mL
Brine shrimp separation beaker VWR BURK7102-2000 2000mL
Plastic zipper bag Roth P279.2 for dead fish storage
Pipetboy Integra 155000 model Pipetboy acu2
Parafilm P-Lab P701605
Air tubing www.zajac.de AQ380 4-6 mm diameter
1 L Glass bottle VWR 215-1595
2 L Glass bottle VWR 215-1596
500 mL Squeeze bottle Roth K665.1 for fish feeding with brine shrimp
120-μm brine shrimp strainer Florida Aqua Farms BB-PC2 for brine shrimp/bloodworm collection
Finish filter socks Aquaneering MFVB025C 25-μm
Central filtration fish housing system Aquaneering, Techniplast, Aquatic Habitats, Aqua Schwarz

DOWNLOAD MATERIALS LIST

References

  1. Valenzano, D. R., Aboobaker, A., Seluanov, A., Gorbunova, V. Non-canonical aging model systems and why we need them. EMBO J. 36, (8), 959-963 (2017).
  2. Harel, I., Brunet, A. The African Turquoise Killifish: A Model for Exploring Vertebrate Aging and Diseases in the Fast Lane. Cold Spring Harb Symp Quant Biol. 80, 275-279 (2015).
  3. Smith, P., et al. Regulation of life span by the gut microbiota in the short-lived African turquoise killifish. Elife. 6, (2017).
  4. Cellerino, A., Valenzano, D. R., Reichard, M. From the bush to the bench: the annual Nothobranchius fishes as a new model system in biology. Biol Rev Camb Philos Soc. 91, (2), 511-533 (2016).
  5. Kim, Y., Nam, H. G., Valenzano, D. R. The short-lived African turquoise killifish: an emerging experimental model for ageing. Dis Model Mech. 9, (2), 115-129 (2016).
  6. Blazek, R., et al. Repeated intraspecific divergence in life span and aging of African annual fishes along an aridity gradient. Evolution. 71, (2), 386-402 (2017).
  7. Terzibasi, E., et al. Large differences in aging phenotype between strains of the short-lived annual fish Nothobranchius furzeri. PLoS One. 3, (12), e3866 (2008).
  8. Kirschner, J., et al. Mapping of quantitative trait loci controlling lifespan in the short-lived fish Nothobranchius furzeri--a new vertebrate model for age research. Aging Cell. 11, (2), 252-261 (2012).
  9. Valenzano, D. R., et al. Mapping loci associated with tail color and sex determination in the short-lived fish Nothobranchius furzeri. Genetics. 183, (4), 1385-1395 (2009).
  10. Reichwald, K., et al. Insights into Sex Chromosome Evolution and Aging from the Genome of a Short-Lived Fish. Cell. 163, (6), 1527-1538 (2015).
  11. Valenzano, D. R., et al. The African Turquoise Killifish Genome Provides Insights into Evolution and Genetic Architecture of Lifespan. Cell. 163, (6), 1539-1554 (2015).
  12. Harel, I., et al. A platform for rapid exploration of aging and diseases in a naturally short-lived vertebrate. Cell. 160, (5), 1013-1026 (2015).
  13. Valenzano, D. R., Sharp, S., Brunet, A. Transposon-Mediated Transgenesis in the Short-Lived African Killifish Nothobranchius furzeri, a Vertebrate Model for Aging. G3. 1, (7), Bethesda. 531-538 (2011).
  14. Harel, I., Valenzano, D. R., Brunet, A. Efficient genome engineering approaches for the short-lived African turquoise killifish. Nat Protoc. 11, (10), 2010-2028 (2016).
  15. Polacik, M., Blazek, R., Reichard, M. Laboratory breeding of the short-lived annual killifish Nothobranchius furzeri. Nat Protoc. 11, (8), 1396-1413 (2016).
  16. Avdesh, A., et al. Regular care and maintenance of a zebrafish (Danio rerio) laboratory: an introduction. J Vis Exp. (69), e4196 (2012).
फ़िरोज़ा Killifish की प्रयोगशाला आवास के लिए एक प्रोटोकॉल (<em>Nothobranchius furzeri</em>)
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Dodzian, J., Kean, S., Seidel, J., Valenzano, D. R. A Protocol for Laboratory Housing of Turquoise Killifish (Nothobranchius furzeri). J. Vis. Exp. (134), e57073, doi:10.3791/57073 (2018).More

Dodzian, J., Kean, S., Seidel, J., Valenzano, D. R. A Protocol for Laboratory Housing of Turquoise Killifish (Nothobranchius furzeri). J. Vis. Exp. (134), e57073, doi:10.3791/57073 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter