Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Un protocolo de laboratorio vivienda de turquesa killis (Nothobranchius furzeri)

doi: 10.3791/57073 Published: April 11, 2018

Summary

Vivienda de laboratorio de turquesa killis pueden ampliarse a la casa y eficientemente recaudar miles de peces individuales en un sistema de filtración de agua centralizado, utilizando la misma infraestructura que se utiliza para las instalaciones estándar de pez cebra. Aquí detallamos una lista de procedimientos estandarizados que permiten killis eficiente mantenimiento.

Abstract

El desarrollo de las prácticas de cría en laboratorio no modelo pescado utilizado para los propósitos experimentales ha beneficiado en gran medida de la creación de peces de la referencia sistemas modelo, como el pez cebra y medaka. En los últimos años, un pez emergente – los killis turquesa (Nothobranchius furzeri) – ha sido adoptado por un número creciente de grupos de investigación en los campos de la biología del envejecimiento y la ecología. Con un palmo de vida cautivado de 4 a 8 meses, esta especie es el vertebrado shortest-lived criado en cautiverio y permite a la comunidad científica a prueba – en poco tiempo, las intervenciones experimentales que puede llevar a alteraciones de la tasa de envejecimiento y esperanza de vida. Dada la singular biología de esta especie, caracterizada por la diapausa embrionaria, maduración sexual explosivo, marcado dimorfismo sexual morfológica y de comportamiento - y su relativamente corta vida adulta - especial cría de prácticas están en urgente demanda. Este protocolo informa un conjunto de medidas clave de cría que permitan killis turquesa óptima atención del laboratorio, permitiendo a la comunidad científica adopte esta especie como un modelo animal de laboratorio de gran alcance.

Introduction

Dada su vida corta y rápido ciclo de vida, killis turquesa están creciendo rápidamente como un prometedor nuevo organismo modelo en biología1,2,3. Esta especie se caracteriza por un único ciclo de vida para un teleósteos, consistiendo en diapausa embrionaria, rápida maduración sexual y una extendida vida post-reproductivos etapa4,5. Trabajo reciente ha contribuido a dilucidar la biología de esta especie en cautiverio y en el salvaje6,7. Killis turquesa viven en cuerpos de agua dulce estacionales que se forman durante la temporada de lluvias en la sabana africana en Zimbabwe y Mozambique. Durante la estación seca, los embriones sobreviven en el barro seco en la ausencia de agua en virtud de una etapa de vida resistente al estrés llamada diapausa.

Mapas genéticos de esta especie han generado8,9, y recientemente su genoma ha sido secuenciado y ensamblado10,11. Se han desarrollado varias variedades de peces de laboratorio endogámicas y transgénesis y edición vía CRISPR/Cas9 genómica se han convertido en disponibles en esta especie, de hecho promover killis turquesa como organismo modelo vertebrados laboratorio competitivo 1213,de,14.

Aunque ya ha sido publicado un protocolo de laboratorio para esta especie15, en el presente Protocolo desarrollamos una amplia lista de guías de laboratorio experimental que específicamente están dirigidas a estudios de investigación de envejecimiento y la supervivencia. El presente Protocolo permite a los investigadores ya están familiarizados con la cría de pez cebra y medaka ser versado en la cría de killis turquesa adoptando un mínimo de ajustes claves. Al mismo tiempo, este protocolo ofrece a los investigadores sin experiencia en la cría de peces con las herramientas esenciales para crear una floreciente Colonia de killis turquesa.

Protocol

Peces son criados a 28 ° C en un sistema de recirculación de agua (véase parámetros de agua), con eliminación de agua diaria 10-20%. Se recomiendan tres tamaños diferentes de tanque: 0.8 L, 2.8 L y L. 9,5 Cada tanque recibe un flujo de agua constante de 2 mL/s.

1. reactivos preparación (no incluida materiales)

Nota: Killis turquesa Africana (Nothobranchius furzeri) pueden suministrarse desde una acción de laboratorio establecidas. Los embriones resistente a la desecación de killis anuales pueden ser enviados por correo. Es fundamental enviar embriones dentro de 8-30 ° C de temperatura.

  1. Preparar la solución de ácido húmico (eclosión) disolviendo 1 g/L de ácido húmico en sistema de agua. Autoclave y almacenar a 4 ° C durante hasta 10 semanas.
  2. Para la preparación de enriquecimiento de Artemia de HUFA, añadir enriquecimiento de HUFA a camarón de salmuera hatcher diariamente a una concentración de 500 μl/L de solución de camarón de salmuera.
  3. Preparar la solución de azul de metileno disolviendo 100 μl/L de solución madre de azul de metileno en el agua del sistema previamente esterilizado. Puesto que el azul de metileno es sensible a la luz, conservar la solución en botellas oscuras, o cubierta con papel de aluminio. Tienda a TA.
  4. Preparar la fibra de coco como sustrato sólido para la incubación del embrión. Como alternativa, utilice un papel de filtro (vea la sección 1.5).
    1. Remojo la fibra de coco con agua destilada. Autoclave y almacenar a 4 ° C hasta por 5 semanas.
    2. En el día de la transferencia de embriones, preparar la placa de Petri con fibra de coco húmeda.
    3. Llene un 90 mm de diámetro placa de Petri con fibra de coco bajo una campana de humos y junto a una llama, para reducir la contaminación por levaduras y bacterias.
    4. Compacto de fibra de coco a una altura de 1 cm, con tejido estéril. Eliminar la mayor parte de la humedad de la fibra de coco pulsando una toalla de papel sobre la placa, dejando el papel para absorber el exceso de agua. Una cuchara de metal de calor sobre la llama y presione hacia abajo sobre toda la superficie de la fibra de coco. Esto previene la contaminación de hongos de la fibra de coco.
  5. Preparar el papel de filtro como sustrato sólido para la incubación del embrión.
    1. En el día de la transferencia de embriones, poner 3 capas de discos de papel de filtro que el plato de Petri de 90 mm. Añadir 5 mL de solución de ácido húmico para mantener la humedad.

2. cría

  1. Cría de killis turquesa para el mantenimiento de la cepa
    Nota: Siguiendo este protocolo, la madurez sexual se alcanza a ~ 4 semanas después de la eclosión y fecundidad picos entre 7-9 semanas. Es fundamental tener en cuenta que la fecundidad depende de alimentación frecuencia y calidad de los alimentos; por lo tanto, se recomiendan al menos dos comidas al día por el tanque de cría para aumentar la producción de embriones (ver sección 5.6).
    1. Instalación de un tanque de cría de 9,5 L. Llene con agua del sistema y añadir dos peces hembra y un macho.
    2. Killis turquesa africanas hombres Mostrar dominación durante el apareamiento, que podría conducir al acoso de las hembras, de elegir un hombre con un tamaño de cuerpo ligeramente más pequeño que la hembra para reducir la tensión de acoplamiento y aumentar la reproducción. Establecer 5 semanas de edad los machos con las hembras de 6/7 semanas de edad.
    3. Llenar un recipiente de plástico (10 x 10 x 5 cm) con arena esterilizada alcanzando una profundidad final de ~ 2-3 cm y colocar la caja de la arena en el centro del tanque de cría.
    4. Que turquesa killis se reproducen continuamente y una vez por semana para la incubación de embriones de embriones la cosecha.
      Nota: El uso de sustrato arena plantea desafíos a los sistemas de filtración centralizada y debe sustituirse por métodos alternativos en el futuro. Alternativas posibles podrían ser el uso del pez cebra tanques de cría.
  2. Mejoramiento de transgénesis
    Nota: Embriones para inyecciones deben estar sincronizados en la etapa de una célula, y esto requiere que se recogen inmediatamente después de la fertilización.
    1. Para recolectar embriones de una célula de fases a utilizar para la inyección y generación de líneas transgénicas, instaló un tanque de cría con un macho y dos hembra peces (igual que 2.1.).
    2. Dos días antes de la recogida de embriones, aislar al varón en un tanque individual y mantener al hombre en contacto visual con las hembras adultas.
    3. En el día de colección, agregue el macho y una caja de arena al tanque de cría y que desovan durante 2 h.

3. embrión cría

  1. Colección de embriones
    Nota: La colección embrionaria se realiza por tamizado y la recolección de embriones de la caja de arena. En condiciones normales, cada caja de la arena debe contener de 30 a 200 embriones.
    1. En el día de colección, quitar caja de arena desde el tanque de cría. Vacíe la caja de la arena en un tamiz (tamaño de cepa ~0.9 mm) y enjuague con agua del sistema. Esto puede hacerse en un tanque grande para recoger arena para el autoclave.
    2. Parcialmente sumerja el filtro en sistema de agua y agitar suavemente, dejando que los embriones destinados a agrupar en el centro.
    3. Recoger embriones con 10 mL pipeta Pasteur.
    4. Transferir los embriones a un 90 mm plato de Petri en 40 mL de agua del sistema.
    5. Inspeccione los embriones en la placa de Petri bajo un estereomicroscopio luz y los que presentan ruptura del corion y signos de daño.
    6. Proceder directamente a blanqueo de embrión.
      Nota: Siempre use un colador por cepa de pescado para evitar posibles contaminaciones de la Cruz-tensión embrión.
  2. Embrión de blanqueo
    Nota: Embrión blanqueo evita que microorganismos presentes en los tanques de pescados contaminen los medios de incubación.
    1. Antes de blanquear, utilice una pipeta de Pasteur desechable para quitar el agua del sistema de la caja de Petri que contienen embriones colectados.
    2. Para evitar el crecimiento de hongo y bacterianos no deseado, añadir 50 mL de recién preparado H2O2 (1% v/v en autoclave sistema de agua) a los embriones colectados.
    3. Agite los embriones durante 5 min a baja velocidad en cajas Petri de 90 mm en 50 mL de solución.
    4. Solución de H2O2 con la pipeta Pasteur desechables Lave y embriones tres veces durante 5 min con 50 mL de solución de azul de metileno. Eliminar la solución de azul de metileno.
    5. Añadir 50 mL de H2O2 (1% v/v en autoclave sistema de agua) a los embriones y agite por 5 minutos.
    6. Retire la solución de H2O2 y lavar tres veces durante 5 min con 50 mL de solución de azul de metileno.
    7. Incubar embriones a 28 ° C para incrementar el desarrollo de embriones sincrónico, con una densidad máxima de 100 embriones por 90 mm plato de Petri en 40 mL de solución de azul de metileno.
      Nota: No extienda la incubación del embrión en la solución de blanqueaba. Esto puede causar daños en el corion del huevo y aumentar la mortalidad embrionaria. Embrión de blanqueo podría causar cambios físico-químicos en el corion del huevo que puede resultar en la fisiología alterada del corion y éxito de eclosión.
  3. Incubación del embrión en el azul de metileno
    Nota: Líquido incubación en solución de azul de metileno evita el crecimiento del parásito y permite la detección de huevos no fertilizados y embriones muertos.
    1. Inspeccione embriones incubados, quitar cualquier embriones muertos (teñidos de azul por el azul de metileno) de la caja Petri para evitar la contaminación de hongo y bacterias que afectan la supervivencia de embriones sanos vivos.
    2. Quite la vieja solución de azul de metileno y reemplácelo con solución fresca.
    3. Regresar de Petri a 28 ° C la incubadora (figura 1A). En 7-10 días, asegúrese de que los embriones desarrollados muestran ojos negros visibles. Transferencia de estos embriones a la fibra de coco o el medio de sustrato sólido de papel de filtro (figura 1B).
    4. Conservar embriones subdesarrollados en azul de metileno, supervisar diariamente y transferencia al medio de sustrato sólido una vez que han desarrollado ojos negros.
    5. Repita pasos 3.3.1-3.3.3 diariamente hasta que los embriones tienen ojos negros visibles.
      Nota: La constante exposición de embriones a azul de metileno puede inducir cambios a largo plazo en fisiología de peces adultos.
  4. Transferencia de embriones a papel de filtro
    Nota: Embriones de killis turquesa pueden convertirse en un sustrato seco, recapitulando las condiciones naturales. Además, incubación del embrión seco permite a los investigadores a sincronizar embriones y eclosionan en el mismo día.
    1. Embriones desarrollados tener ojos negros visibles en 7-10 días, use una pipeta de Pasteur desechable o finas pinzas curvas para transferir embriones de la solución de azul de metileno en un plato de papel de filtro previamente preparado.
    2. Difundir embriones ~ 5 mm. con pinzas, hasta 100 embriones por placa 90 mm (figura 1B).
    3. Sello de la caja Petri con parafilm.
    4. Incubar embriones a 28 ° C durante 2-3 semanas, hasta que se han desarrollado completamente el iris dorado y están listos para la incubación (figura 1).
      Nota: No prolongar la incubación de embriones de la listo-a-hatch por más de 2 semanas como se reducirá dramáticamente su viabilidad.
  5. Transferencia del embrión a la fibra de coco
    Nota: Fibra coco estéril, esterilizado (o turba orgánica) puede utilizarse como un medio alternativo válido para la incubación del sustrato sólido.
    1. Use una pipeta de Pasteur desechable o finas pinzas curvas para transferir embriones de la solución de azul de metileno en una placa de fibra de coco listo para su uso.
    2. Difundir embriones ~ 5 mm., hasta 100 embriones por placa 90 mm (figura 1B).
    3. Sello de la caja Petri con parafilm.
    4. Incubar embriones a 28 ° C durante 2-3 semanas, hasta que se han desarrollado completamente oro iris (por ejemplo en la figura 1).
      Nota: Para almacenamiento a largo plazo (hasta un año), transferir los embriones en la colección de post 3 días desde soluciones de azul de metileno a una placa de substrato sólido a 17 ° C. Incubar embriones hasta que desarrollan ojos negros.

4. Incubar killis turquesa

Nota: Embriones de killis turquesa pueden ser tramados con éxito en una solución de ácido húmico14.

  1. Utilizando pinzas curvas finas, transferencia cuidadosamente 50-100 desarrollado embriones en la caja de incubación llenada con la solución de ácido húmico a 4 ° C. La solución de ácido húmico consiste en ácido húmico 1 g/L en agua del sistema. Autoclave y almacenar a 4 ° C durante hasta 10 semanas. Asegúrese de que todos los embriones se sumergen completamente. La solución de ácido húmico debe ser poco profunda, no más de 2 cm.
    Nota: Baja temperatura de la solución de ácido húmico mejora eclosión y una inmersión completa de los embriones en la solución permite la eclosión sincronizada.
  2. Coloque la caja de incubar en la incubadora de la eclosión de 28 ° C. Cubierta de la caja de incubación con la tapa. Para suministrar aireación suficiente, conecte la caja de incubación por tubería con suministro de aire.
    Nota: No es suficiente aireación durante la incubación resulta en altas tasas de alevines no ha podido llenar la vejiga natatoria (fenotipo "vientre-slider", ver nota en sección 5.1)
  3. Desde el día después de la eclosión, para mantener la calidad de agua adecuada en el cuadro de la trama, añadir agua sistema autoclave una vez al día en la proporción de 1:1, manteniendo una profundidad final de 2 cm.
  4. Transferencia embriones eclosionados hacia el sustrato sólido y tratar de incubar una semana más tarde.
    Nota: Al nacer, killis turquesa son fácilmente capaces de la absorción y consuman alimento vivo. Para un crecimiento óptimo, alimentación crías dos veces al día con Artemia recién eclosionada exceso (Artemia salina). La señal de saciedad completo es el abdomen de color naranja de alevines después de 10-15 minutos de cada sesión de alimentación. Sifón al camarón de salmuera sobrante, sin comer y descompuesto con una pipeta Pasteur sobre una base diaria.

5. criar peces juveniles y adultos

  1. A los cinco días post eclosión, hacia a menores del sistema de recirculación de agua. Con pipetas desechables de plástico (o una cuchara de plástico), con cuidado transferencia cinco menores de edad por depósito 0,8 L equipado con pantalla de alevines de 400 μm (figura 2).
    Nota: Es posible que una porción de killis juvenil no habrá llenado la vejiga natatoria, lo que resulta en un fenotipo típico "vientre-slider", caracterizado por peces no alcanzar flotabilidad adecuada, les obliga a nadar continuamente, causando malformaciones severas en peces adultos. Estos peces no se puede utilizar para los ensayos de supervivencia o para la cría eficiente y que deba ser censurado.
  2. La alimentación con Artemia recién eclosionada en exceso juveniles dos veces al día hasta 14 días post eclosión. Sifón diariamente los desechos de la parte inferior de cada tanque.
  3. A los 14 días de edad, transferencia juveniles a 2,8 L tanque equipado con una pantalla de alevines de 850 μm. Desde este punto de la etiqueta cada tanque con la identificación de peces, indicando fecha de Portilla, información de cepa, género de peces y número de identificación de peces (figura 3). Para los ensayos de supervivencia, de la casa individualmente cada pescado en tanques individuales de aquí en adelante.
  4. Los siguientes 7 días, alimentación a juveniles dos veces al día con 2 mL de Artemia por pescado. En esta etapa los peces pueden complementarse con gusanos de sangre en 1-3 (en el caso de las larvas de gusano de sangre son demasiado grandes para los peces, picarlos en trozos pequeños con una cuchilla de afeitar). Para evitar el deterioro de la calidad del agua, sifón sin comer alimentos y residuos adicionales dos veces por semana.
  5. Después de 3 semanas de incubación, desmontar la pantalla fría de la parte posterior del tanque y comience a alimentar cada peces dos veces al día mL ~ 2 de camarón de salmuera y 0,5 mL de gusano de sangre. En esta etapa, juveniles deben han alcanzado 1 cm de tamaño del cuerpo y deben ser capaces de ingerir gusano de sangre completo.
  6. En 4 semanas de edad, alimentar cada pescado dos veces por día con 2mL de camarón de salmuera y 1 mL de gusano de sangre. Hembras pueden alojarse co a una densidad de 3 hembras por tanque de 2.8 L.
  7. En esta etapa asegurar que los peces alcanzan la maduración sexual completa. Comprobar la presencia de grandes aletas dorsales, anales y caudales con signos de coloración en los machos y alrededor de abdomen lleno de huevos en las hembras.
    Nota: Cría de peces adultos en tanques individuales para estudios de cohortes de supervivencia puede afectar negativamente salud y comportamiento de peces. Sin embargo, el alojamiento en grupo para los estudios de cohorte de supervivencia agrega importantes factores de confusión debido al establecimiento de la dominación social y territorios masculinos, llevando a la estricta jerarquía social.

6. la alimentación

Nota: Killis turquesa de laboratorio se pueden alimentar una combinación de bebé Artemia (nauplios deArtemia salina ) y gusano de sangre (larvas deChironomus spp. ). Killis turquesa alevines se alimentan exclusivamente camarón de salmuera del bebé. Peces juveniles y adultos son alimentados dos veces al día camarón de salmuera y gusano de sangre (figura 2). Idealmente, peces pueden alimentarse varias veces al día, superando las 2 alimentaciones indica en este protocolo.

  1. Cultivo de camarón de salmuera
    1. Añadir 10 litros de agua de ósmosis inversa (RO) y 350 g de sal de mar rojo a una eclosión de Artemia y disolver por la aireación con un tubo de aireación.
    2. Enriquecer la cultura con 5 mL de ácidos grasos altamente insaturados (HUFA).
    3. Añadir 20 g de quistes de Artemia en la solución de la trama. Inspeccionar que los quistes de Artemia no flotan en la superficie del agua y asegurar oxigenación adecuada y la circulación de la cultura.
      Nota: Diario alícuotas de quistes de Artemia secos pueden conservarse a 4 ° C.
    4. En la tarde del día siguiente, fuente de la cultura con otra alícuota de 5 mL de HUFA.
  2. Recolección de Artemia eclosionado
    Nota: Después de ~ 36 h de la cultura partida, camarón de salmuera está listo para cosechar (estadio II fase).
    1. Recoger 5 L de la cultura en un recipiente con el grifo en la parte inferior de la nacedora y dejar reposar durante 10 minutos.
    2. Después de 10 minutos, quitar las cáscaras de camarón de salmuera (color marrón) de la parte superior del recipiente de 5 L y filtro de la Artemia eclosionada (color naranja) a través de una malla. Preste atención a excluir el sedimento encontrado en el fondo del recipiente ya que contiene huevos no eclosionados y Artemia muerta.
    3. Enjuague había tramado camarón de salmuera con agua del RO en un recipiente de 2 L y deja reposar durante 10 minutos.
    4. Después de 10 min, camarón de salmuera nuevamente a través de una malla de filtro y recoger en 2 L de agua del RO.
    5. Repita los tres pasos anteriores hasta que el camarón de salmuera solución está libre de cáscaras de quistes y camarón de salmuera no nacieron.
    6. Transferencia de camarón de salmuera del recipiente de 2 L en botellas squeeze para alimentar.
      Nota: Cultivo de camarón de salmuera es bastante robusto y fiable. Sin embargo, para evitar la escasez del camarón de salmuera en caso fracasado incubación, nacedoras backup de pequeñas (500 mL) pueden utilizarse.
  3. Configuración del copia de seguridad hatcher
    1. Disolver 17,5 g de sal de mar rojo en 500 mL de agua del RO por aireación.
    2. Enriquecer la cultura con 500 μl de HUFA.
    3. Añadir 2 g de quistes de Artemia.
    4. Después de 18-24 h, fuente de la cultura una vez más con 500 μl de HUFA.
      Nota: camarón de salmuera está listo para cosechar después de ~ 24 h.
  4. Preparación de gusano de sangre viva
    1. Inmediatamente antes de alimentar, filtrar una cantidad apropiada de gusano de sangre a través de un colador con agua Osmotizada.
      Nota: Gusano de sangre vivo puede almacenarse a 4 ° C durante 7-10 días.
    2. Enjuague el gusano de la sangre con una pequeña cantidad de agua del RO en un recipiente de plástico.
    3. Con un plástico Pasteur pipeta (punta estrecha quitada), tomar la mezcla de sangre gusano para la alimentación.
      Nota: Killis laboratorio de alimentación colonias con alimento vivo de fuentes no controladas añade un riesgo de contaminación externa de parásitos y comunidades microbianas potencialmente patógenas. En el futuro, se debe desarrollar una alimentación especial peces estériles.

7. killis laboratorio cepa Genotyping

Nota: Para distinguir entre cepas de killis turquesa, así como para determinar el sexo dentro de cada cepa, marcadores específicos genéticos (microsatélites) pueden ser usado9 (tabla 1).

  1. Toma de muestras
    1. Sujetar firmemente el pez en una red en la parte superior de esponja mojada.
    2. Limpiar 2-3 escalas del cuerpo de peces desde el opérculo a la aleta caudal con bastoncillos de algodón.
    3. Elegir escalas de la torunda y transferencia escamas de 2-3 en un tubo de 1 mL con solución de NaOH (200 μL 0.5 mol/L NaOH, 1% β-mercaptoetanol y pirrolidona polivinilo 0,5%).
    4. Girar los tubos PCR por 15 s para asegurarse de que escalas se sumergen completamente en la solución de NaOH.
  2. Aislamiento de ADN genómico
    1. Incubar la muestra durante 20 min a 95 ° C.
    2. Enfriar a temperatura ambiente, neutralizar la muestra con 1/10 volumen de 1 M Tris-HCl, pH 8,0.
    3. Centrifugar la muestra durante 5 minutos a toda velocidad.

8. parámetros del agua

Nota: Cría de organismos cuyo uso es fenotipo adulto requiere condiciones de cría altamente estable a lo largo de la vida de las especies objetivo. Por lo tanto, organismos de agua, como killis turquesa, el cultivo requiere estricto control de parámetros del agua. Recirculación del agua, con cuatro pasos más filtración de agua, asegura una base sólida para lograr control sobre los parámetros del agua, proporcionando todos los depósitos con las mismas condiciones de agua en el tiempo. Se recomienda reconstituir el agua del sistema de agua de ósmosis inversa (RO), agregada comercial sal marina y bicarbonato de sodio.

  1. Esquema de sistema de circulación de agua: en primer lugar, aguas residuales de peces tanques de flujos a través de filtro metálico de partículas sólidas que captura todos los restos de alimentos no se comen y las partículas más grandes. Filtros metálicos se lavan tres veces por semana; En segundo lugar, después de la primera filtración mecánica, el agua es transportado en grandes colectores de aceite y luego bombeado a un biofiltro, donde las bacterias convierten el amoníaco en nitritos y nitratos; En tercer lugar, de los filtros, el agua se bombea a mangas de filtro de 25 μm, que atrapan las partículas de tamaño más finas. Finalmente, el agua fluye a través de las lámparas (Ultravioleta) ULTRAVIOLETA que esterilización el agua de bacterias y virus. Siguiendo estos cuatro pasos, agua filtrada regresa a los tanques de peces.
  2. Para reducir el crecimiento de microorganismos en los tanques, evitar la acumulación de nitratos y reducir total salinidad, 10-20% del agua del sistema es dispuesta sobre una base diaria.
  3. Mantener constante de la temperatura del agua a 28 ° C, constante de pH del agua dentro de la gama de 7.0 a 7.5.
  4. Aunque killis toleran amplio rango de salinidad, para evitar oodinosis, mantener la conductividad dentro de la gama 650-710 micro-Siemens. Un ciclo de luz/oscuridad de 12 h año asegura la productividad y la salud de la Colonia.
    Nota: Killis pueden tolerar agua conductividad hasta 1500 micro-Siemens.

Representative Results

Adecuada cría de killis turquesa resultados en supervivencia media que oscila entre 12-18 semanas en la cepa GRZ (e.g. Figura 4A). Variaciones de la mediana de la supervivencia dependen de la dieta, frecuencia de alimentación y las condiciones de temperatura de la vivienda. Resultados de cría pobre en las curvas de supervivencia que presenta aumentaron de la mortalidad temprana y gotas repentinas, repetitivas de supervivencia a través del tiempo, caracterizado por varios puntos de inflexión (Figura 4B).

Figure 1
Figura 1: representante de etapas de desarrollo embrionarias con sustrato de incubación correspondiente. (A) recién recogida de embriones, incubados en solución de azul de metileno en la incubadora a 28 ° C. (B) embriones listos para ser transferido a un medio sólido, ya sea filtro de fibra de papel o de coco. (C) embriones listos para ser tramado, mostrando típico iris oro. La barra de escala es igual a 1 mm. haga clic aquí para ver una versión más grande de esta figura.

Figure 2
Figura 2: etapas de killis turquesa post eclosión desarrollo. Haga clic aquí para ver una versión más grande de esta figura.

Figure 3
Figura 3: etiqueta de ID de pescado representativo de pescados de la etapa 3. Haga clic aquí para ver una versión más grande de esta figura.

Figure 4
Figura 4: curva de supervivencia representativas para killis turquesa macho 70. (A) curva de supervivencia típico para killis turquesa criados en laboratorio. (B) comparación de las curvas de supervivencia obtenidas de pescado criado en condiciones óptimas de cría (negro) y la pobre cría (rojo y azul). La línea horizontal roja discontinua indica el 50% de supervivencia, curva de supervivencia que se cruzan a media vida (indicado en el eje x). Haga clic aquí para ver una versión más grande de esta figura.

ID Primer avance Primer revés Gama del tamaño (bp)
* NfuSU0007 GGCTAAGCCTTGCTGACAGA CAGGGAGCTGAAAACCTCAG 166 - 214
* NfuSU0010 CGCAGTCTGATCAAATCGTGT TGTTTGAAGGTTCACATTCATTATC 220 - 272
NfuSU0016 CATGGCTAAACCGTGATGAA GAAGGACGCCAGCTATGAAG 209 - 240
NfuSU0022 AACACAGCTCTCGTAAGGAGGTA TTCAGACTTGTCTTACTACCATGTTT 198 - 238
NfuSU0027 TCCAGCTGAATCGGTAATGA AAACTCGAGGGTGCAATCTG 164 - 226
NfuSU0049 CTGGACAAAGTGCCAATCAC CTCCCACAGTCCCAAAACAT 196 - 197
NfuSU0050 CCAGAATGAACAATACTCAGATCAA GCAGCTTAGTTTAATGATATCACAATG 252 - 295
NfuSU0060 CTAGCCACTCCCCTGGTTTA CCGTCACGATGTGCTGATAC 216 - 248
NfuFLI0030 CAGAAGCTAAAGGCCAGACG GGGAAACAATAGGGAACCAC 174 - 205
* NfuFLI0091 ACGCTGACTCTACCCAGTC CTGCCTGCTACTGACAATG 355 - 373
* - marcadores de determinación del sexo

Tabla 1: Cartillas de genotipado para identificación de la cepa.

Discussion

Se describe un protocolo para el cultivo de laboratorio de killis turquesa, colección embrionaria, incubación, así como vivienda de peces adultos, de cría y alimentación. Nuestro protocolo está dirigido específicamente a los laboratorios que realizan investigación en peces adultos, en particular para estudios experimentales sobre el envejecimiento y la vida. Killis turquesa pueden ser levantado en una instalación de peces cebra estándar; sin embargo, aspectos importantes de la cría de killis difieren de pez cebra estándar atención16. Estos ajustes incluyen la primera transición de una dieta única de camarón de salmuera a una dieta suplementada con gusano de sangre rica en proteínas, así como medidas específicas de incubación del embrión, que consiste en una etapa de incubación líquidos y secos.

Pasos críticos en el protocolo incluyen envío embriones dentro de 8-30 ° C de temperatura. En caso de reproducción, fecundidad depende de alimentación frecuencia y calidad de los alimentos; por lo tanto, se recomiendan por lo menos dos alimentaciones al día por cría tanque para elevar la producción de embriones (ver apartado 5.6.). Durante el blanqueamiento del embrión, no se extienden incubación del embrión en la solución de blanqueaba. Esto puede causar daño en el corion del huevo y mortalidad embrionaria creciente. Cuando incubar embriones con azul de metileno, no prolongar la incubación de embriones de la listo-a-hatch por más de 2 semanas como se reducirá dramáticamente su viabilidad. Para tramar killis turquesa, baja temperatura de la solución de ácido húmico mejora eclosión y una inmersión completa de los embriones en la solución permite la eclosión sincronizada. No suficiente aireación durante los resultados de incubación en las altas tasas de alevines no ha podido llenar la vejiga natatoria (fenotipo "vientre-slider", ver notas en la sección 5.1).

Limitación del protocolo para la cría incluye el uso del sustrato arena que plantea desafíos a centralizan sistemas de filtración y deben sustituirse por métodos alternativos en el futuro. Alternativas posibles podrían ser el uso del pez cebra tanques de cría. Embrión de blanqueo podría causar cambios físico-químicos en el corion del huevo que puede resultar en la fisiología alterada del corion y éxito de eclosión. Constante exposición de embriones a azul de metileno puede inducir cambios a largo plazo en fisiología de peces adultos. Criar peces adultos en tanques individuales para estudios de cohortes de supervivencia puede afectar negativamente salud y comportamiento de peces. Sin embargo, el alojamiento en grupo para los estudios de cohorte de supervivencia agrega importantes factores de confusión debido al establecimiento de la dominación social y territorios masculinos, llevando a la estricta jerarquía social. Por lo tanto, juzgamos que el aislamiento de peces machos para estudios de supervivencia es un compromiso razonable. Colonias de killis laboratorio alimentación con alimento vivo de fuentes no controladas añadir un riesgo de contaminación externa de los parásitos y comunidades microbianas potencialmente patógenas. En el futuro, se debe desarrollar una alimentación especial peces estériles.

Futuras mejoras en el presente Protocolo se centrarán en una dieta controlada, no vivo, que aún lidera a la finalización de la maduración sexual en 3-4 semanas. En Resumen, nuestro protocolo ofrece accesibilidad a killis turquesa laboratorio cultivo a una comunidad científica amplia.

Disclosures

Los autores no declaran a no financieros y los intereses en competencia.

Acknowledgments

Agradecemos Alessandro Cellerino, Tyrone Genade, Anne Brunet, Sabrina Sharp, Mickie Powell, Simone Keil, Yumi Kim, Patrick Smith, Kai Mathar y todos los miembros del laboratorio de Valenzano en el Instituto Max Planck para la biología del envejecimiento que contribuyen a diferentes aspectos del actual protocolo de cría de killis en los años.

Materials

Name Company Catalog Number Comments
Probe calibration buffer solution pH=7.0 Roth A518.1 1L buffer solution pH=7.0 to calibrate water system pH-electrode
Probe calibration buffer solution pH=4.0 Roth P712.1 1L buffer solution pH=4.0 to calibrate water system pH-electrode
Conductivity standard VWR 83607.260 500 mL Conductivity standard 1,413 uS/cm to calibrate water system conductivity-electrode
Easy Strips Test 6in1 JBL 2533900 Test strips for determination chlorine values of system water
Ammonia Test JBL 2536500 Test to determine ammonia content of system water
Red Sea Salt Red Sea 22 kg bucket
Sodium hydrogen carbonate VWR 27780.360
Humic acid Sigma- Aldrich 53680-50G
New HUFA Artemia enrichment ZM Systems UK 75g bottle
Methylene blue Roth AE64.1
Hydrogen peroxide solution Sigma- Aldrich 31642-1L 30% (w/w)
Coconut fiber Dragon ZCS010
Whatman paper GE healthcare 3030-690
Ethanol pure VWR 20821.467 100%
Silica sand local pet shop
Artemia Eggs Premium Grade Sanders
Bloodworm local distributor Poseidon Aquakultur Germany
dNTPs solution mix Biolabs N04472 10mM
Taq DNA polymerase Invitrogen 18038-042 5U/uL
PCR 10x Buffer Invitrogen 18038-042
MgCl2 Invitrogen 18038-042 50mM
NaOH Sigma- Aldrich S8045-500g 50mM
Tris-HCl, pH=8.0 solution Sigma- Aldrich T2694-1L 1M
HCl 37% Sigma- Aldrich H1758-500mL
Fish tanks Aquaneering volume: 0.8L, 2.8L, 9.5L; equipped with baffles, fry mesh and lids
Orbital shaker VWR 89032-100 model 5000
Microbiological incubator Thermo Scientific, Heratherm 50125882 model IMC18; for storage embryos in the liquid phase, set to t=27-28°C
Cooling Incubator Binder 9020-0209 model KT115; for storage embryos in the solid phase, set to t=27-28°C
Hatching incubator Thermo Scientific, Heratherm 51028114 model OGS180; for embryos hatching, set to t=27-28°C
Stereomicroscope Leica model M80
Breeding sand/hatching boxes Roth 1598.1 1000mL
Petri dish Sarstedt 82.1473 92x16mm
50 mL Conical tube Sarstedt 62.547.254
15 mL Conical tube Sarstedt 62.554.002
Disposable Plastic Pasteur pipette Roth EA71.1 2mL; For fish feeding with bloodworms, or embryos selection cut off the tip to open 3-4mm diameter
Serological pipette Sarstedt 86.1689.001 50mL
Syringe Henke Sass Wolf 4100-000V0 10mL
Metal strainer fineness <1mm; for embryos collection
Tweezers Dumont 0508-5/45-PO type5/45; for embryos transfer
25 L Brine shrimp hatcher Aquaneering ZHBS25 main hatcher
500 mL Brine shrimp hatcher JBL 6106100 model Artemio 1; backup hatcher
Narrow-mesh fish nets JBL
Sand beaker VWR BURK7102-5000 5000mL
Brine shrimp separation beaker VWR BURK7102-2000 2000mL
Plastic zipper bag Roth P279.2 for dead fish storage
Pipetboy Integra 155000 model Pipetboy acu2
Parafilm P-Lab P701605
Air tubing www.zajac.de AQ380 4-6 mm diameter
1 L Glass bottle VWR 215-1595
2 L Glass bottle VWR 215-1596
500 mL Squeeze bottle Roth K665.1 for fish feeding with brine shrimp
120-μm brine shrimp strainer Florida Aqua Farms BB-PC2 for brine shrimp/bloodworm collection
Finish filter socks Aquaneering MFVB025C 25-μm
Central filtration fish housing system Aquaneering, Techniplast, Aquatic Habitats, Aqua Schwarz

DOWNLOAD MATERIALS LIST

References

  1. Valenzano, D. R., Aboobaker, A., Seluanov, A., Gorbunova, V. Non-canonical aging model systems and why we need them. EMBO J. 36, (8), 959-963 (2017).
  2. Harel, I., Brunet, A. The African Turquoise Killifish: A Model for Exploring Vertebrate Aging and Diseases in the Fast Lane. Cold Spring Harb Symp Quant Biol. 80, 275-279 (2015).
  3. Smith, P., et al. Regulation of life span by the gut microbiota in the short-lived African turquoise killifish. Elife. 6, (2017).
  4. Cellerino, A., Valenzano, D. R., Reichard, M. From the bush to the bench: the annual Nothobranchius fishes as a new model system in biology. Biol Rev Camb Philos Soc. 91, (2), 511-533 (2016).
  5. Kim, Y., Nam, H. G., Valenzano, D. R. The short-lived African turquoise killifish: an emerging experimental model for ageing. Dis Model Mech. 9, (2), 115-129 (2016).
  6. Blazek, R., et al. Repeated intraspecific divergence in life span and aging of African annual fishes along an aridity gradient. Evolution. 71, (2), 386-402 (2017).
  7. Terzibasi, E., et al. Large differences in aging phenotype between strains of the short-lived annual fish Nothobranchius furzeri. PLoS One. 3, (12), e3866 (2008).
  8. Kirschner, J., et al. Mapping of quantitative trait loci controlling lifespan in the short-lived fish Nothobranchius furzeri--a new vertebrate model for age research. Aging Cell. 11, (2), 252-261 (2012).
  9. Valenzano, D. R., et al. Mapping loci associated with tail color and sex determination in the short-lived fish Nothobranchius furzeri. Genetics. 183, (4), 1385-1395 (2009).
  10. Reichwald, K., et al. Insights into Sex Chromosome Evolution and Aging from the Genome of a Short-Lived Fish. Cell. 163, (6), 1527-1538 (2015).
  11. Valenzano, D. R., et al. The African Turquoise Killifish Genome Provides Insights into Evolution and Genetic Architecture of Lifespan. Cell. 163, (6), 1539-1554 (2015).
  12. Harel, I., et al. A platform for rapid exploration of aging and diseases in a naturally short-lived vertebrate. Cell. 160, (5), 1013-1026 (2015).
  13. Valenzano, D. R., Sharp, S., Brunet, A. Transposon-Mediated Transgenesis in the Short-Lived African Killifish Nothobranchius furzeri, a Vertebrate Model for Aging. G3. 1, (7), Bethesda. 531-538 (2011).
  14. Harel, I., Valenzano, D. R., Brunet, A. Efficient genome engineering approaches for the short-lived African turquoise killifish. Nat Protoc. 11, (10), 2010-2028 (2016).
  15. Polacik, M., Blazek, R., Reichard, M. Laboratory breeding of the short-lived annual killifish Nothobranchius furzeri. Nat Protoc. 11, (8), 1396-1413 (2016).
  16. Avdesh, A., et al. Regular care and maintenance of a zebrafish (Danio rerio) laboratory: an introduction. J Vis Exp. (69), e4196 (2012).
Un protocolo de laboratorio vivienda de turquesa killis (<em>Nothobranchius furzeri</em>)
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Dodzian, J., Kean, S., Seidel, J., Valenzano, D. R. A Protocol for Laboratory Housing of Turquoise Killifish (Nothobranchius furzeri). J. Vis. Exp. (134), e57073, doi:10.3791/57073 (2018).More

Dodzian, J., Kean, S., Seidel, J., Valenzano, D. R. A Protocol for Laboratory Housing of Turquoise Killifish (Nothobranchius furzeri). J. Vis. Exp. (134), e57073, doi:10.3791/57073 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter